Development of a Multiplex and Cost-Effective Genotype Test toward More Personalized Medicine for the Antiplatelet Drug Clopidogrel
Abstract
:1. Introduction
2. Results and Discussion
2.1. Results
2.2. Discussion
3. Experimental Section
3.1. Subjects and DNA Samples
3.2. Multiplexing PCR and SNaPshot
3.3. Statistical Analysis
4. Conclusions
Acknowledgments
Conflicts of Interest
- Author ContributionsJae-Gook Shin supervised the study and provided administrative support. Hye-Eun Jeong and Su-Jun Lee performed data analysis and drafted the manuscript. Hye-Eun Jeong and Eun-Young Cha performed the experiments. Eun-Young Kim, Ho-Sook Kim, and Young Hwan Song made critical revisions to the paper.
References
- Savi, P.; Zachayus, J.L.; Delesque-Touchard, N.; Labouret, C.; Herve, C.; Uzabiaga, M.F.; Pereillo, J.M.; Culouscou, J.M.; Bono, F.; Ferrara, P.; et al. The active metabolite of Clopidogrel disrupts P2Y12 receptor oligomers and partitions them out of lipid rafts. Proc. Natl. Acad. Sci. USA 2006, 103, 11069–11074. [Google Scholar]
- Simon, T.; Verstuyft, C.; Mary-Krause, M.; Quteineh, L.; Drouet, E.; Meneveau, N.; Steg, P.G.; Ferrieres, J.; Danchin, N.; Becquemont, L. Genetic determinants of response to clopidogrel and cardiovascular events. N. Engl. J. Med 2009, 360, 363–375. [Google Scholar]
- Mega, J.L.; Close, S.L.; Wiviott, S.D.; Shen, L.; Walker, J.R.; Simon, T.; Antman, E.M.; Braunwald, E.; Sabatine, M.S. Genetic variants in ABCB1 and CYP2C19 and cardiovascular outcomes after treatment with clopidogrel and prasugrel in the TRITON-TIMI 38 trial: A pharmacogenetic analysis. Lancet 2010, 376, 1312–1319. [Google Scholar]
- Wallentin, L.; James, S.; Storey, R.F.; Armstrong, M.; Barratt, B.J.; Horrow, J.; Husted, S.; Katus, H.; Steg, P.G.; Shah, S.H.; et al. Effect of CYP2C19 and ABCB1 single nucleotide polymorphisms on outcomes of treatment with ticagrelor versus clopidogrel for acute coronary syndromes: A genetic substudy of the PLATO trial. Lancet 2010, 376, 1320–1328. [Google Scholar]
- Hwang, S.J.; Jeong, Y.H.; Kim, I.S.; Koh, J.S.; Kang, M.K.; Park, Y.; Kwak, C.H.; Hwang, J.Y. The cytochrome 2C19*2 and *3 alleles attenuate response to clopidogrel similarly in East Asian patients undergoing elective percutaneous coronary intervention. Thromb. Res 2011, 127, 23–28. [Google Scholar]
- Rudez, G.; Bouman, H.J.; van Werkum, J.W.; Leebeek, F.W.; Kruit, A.; Ruven, H.J.; ten Berg, J.M.; de Maat, M.P.; Hackeng, C.M. Common variation in the platelet receptor P2RY12 gene is associated with residual on-clopidogrel platelet reactivity in patients undergoing elective percutaneous coronary interventions. Circ. Cardiovasc. Genet 2009, 2, 515–521. [Google Scholar]
- Mizutani, T. PM frequencies of major CYPs in Asians and Caucasians. Drug Metab. Rev 2003, 35, 99–106. [Google Scholar]
- Lee, S.J.; Jung, I.S.; Jung, E.J.; Choi, J.Y.; Yeo, C.W.; Cho, D.Y.; Kim, Y.W.; Lee, S.S.; Shin, J.G. Identification of P2Y12 single-nucleotide polymorphisms and their influences on the variation in ADP-induced platelet aggregation. Thromb. Res 2011, 127, 220–227. [Google Scholar]
- Veiga, M.I.; Asimus, S.; Ferreira, P.E.; Martins, J.P.; Cavaco, I.; Ribeiro, V.; Hai, T.N.; Petzold, M.G.; Bjorkman, A.; Ashton, M.; et al. Pharmacogenomics of CYP2A6, CYP2B6, CYP2C19, CYP2D6, CYP3A4, CYP3A5 and MDR1 in Vietnam. Eur. J. Clin. Pharmacol 2009, 65, 355–363. [Google Scholar]
- Solus, J.F.; Arietta, B.J.; Harris, J.R.; Sexton, D.P.; Steward, J.Q.; McMunn, C.; Ihrie, P.; Mehall, J.M.; Edwards, T.L.; Dawson, E.P. Genetic variation in eleven phase I drug metabolism genes in an ethnically diverse population. Pharmacogenomics 2004, 5, 895–931. [Google Scholar]
- Rohrbacher, M.; Kirchhof, A.; Geisslinger, G.; Lotsch, J. Pyrosequencing-based screening for genetic polymorphisms in cytochrome P450 2B6 of potential clinical relevance. Pharmacogenomics 2006, 7, 995–1002. [Google Scholar]
- Lee, S.S.; Lee, S.J.; Gwak, J.; Jung, H.J.; Thi-Le, H.; Song, I.S.; Kim, E.Y.; Shin, J.G. Comparisons of CYP2C19 genetic polymorphisms between Korean and Vietnamese populations. Ther. Drug Monit 2007, 29, 455–459. [Google Scholar]
- Blaisdell, J.; Mohrenweiser, H.; Jackson, J.; Ferguson, S.; Coulter, S.; Chanas, B.; Xi, T.; Ghanayem, B.; Goldstein, J.A. Identification and functional characterization of new potentially defective alleles of human CYP2C19. Pharmacogenetics 2002, 12, 703–711. [Google Scholar]
- Dai, D.; Tang, J.; Rose, R.; Hodgson, E.; Bienstock, R.J.; Mohrenweiser, H.W.; Goldstein, J.A. Identification of variants of CYP3A4 and characterization of their abilities to metabolize testosterone and chlorpyrifos. J. Pharmacol. Exp. Ther 2001, 299, 825–831. [Google Scholar]
- Schaik, R.H.; Heiden, I.P.; Anker, J.N.; Lindemans, J. CYP3A5 variant allele frequencies in Dutch Caucasians. Clin. Chem 2002, 48, 1668–1671. [Google Scholar]
- Kafka, A.; Sauer, G.; Jaeger, C.; Grundmann, R.; Kreienberg, R.; Zeillinger, R.; Deissler, H. Polymorphism C3435T of the MDR-1 gene predicts response to preoperative chemotherapy in locally advanced breast cancer. Int. J. Oncol 2003, 22, 1117–1121. [Google Scholar]
- Kazui, M.; Nishiya, Y.; Ishizuka, T.; Hagihara, K.; Farid, N.A.; Okazaki, O.; Ikeda, T.; Kurihara, A. Identification of the human cytochrome P450 enzymes involved in the two oxidative steps in the bioactivation of clopidogrel to its pharmacologically active metabolite. Drug Metab. Dispos 2010, 38, 92–99. [Google Scholar]
- Bouman, H.J.; Schomig, E.; van Werkum, J.W.; Velder, J.; Hackeng, C.M.; Hirschhauser, C.; Waldmann, C.; Schmalz, H.G.; ten Berg, J.M.; Taubert, D. Paraoxonase-1 is a major determinant of clopidogrel efficacy. Nat. Med 2011, 17, 110–116. [Google Scholar]
- Taubert, D.; von Beckerath, N.; Grimberg, G.; Lazar, A.; Jung, N.; Goeser, T.; Kastrati, A.; Schomig, A.; Schomig, E. Impact of P-glycoprotein on clopidogrel absorption. Clin. Pharmacol. Ther 2006, 80, 486–501. [Google Scholar]
- Spiewak, M.; Malek, L.A.; Kostrzewa, G.; Kisiel, B.; Serafin, A.; Filipiak, K.J.; Ploski, R.; Opolski, G. Influence of C3435T multidrug resistance gene-1 (MDR-1) polymorphism on platelet reactivity and prognosis in patients with acute coronary syndromes. Kardiol. Pol 2009, 67, 827–834. [Google Scholar]
- Namazi, S.; Kojuri, J.; Khalili, A.; Azarpira, N. The impact of genetic polymorphisms of P2Y12, CYP3A5 and CYP2C19 on clopidogrel response variability in Iranian patients. Biochem. Pharmacol 2012, 83, 903–908. [Google Scholar]
- Zoheir, N.; Abd Elhamid, S.; Abulata, N.; el Sobky, M.; Khafagy, D.; Mostafa, A. P2Y12 receptor gene polymorphism and antiplatelet effect of clopidogrel in patients with coronary artery disease after coronary stenting. Blood Coagul. Fibrinolysis 2013, 24, 525–531. [Google Scholar]
- Scott, S.A.; Sangkuhl, K.; Stein, C.M.; Hulot, J.S.; Mega, J.L.; Roden, D.M.; Klein, T.E.; Sabatine, M.S.; Johnson, J.A.; Shuldiner, A.R. Clinical pharmacogenetics implementation consortium. Clinical pharmacogenetics implementation Consortium guidelines for CYP2C19 genotype and clopidogrel therapy: 2013 update. Clin. Pharmacol. Ther 2013, 94, 317–323. [Google Scholar]
- Yancy, C.W.; Jessup, M.; Bozkurt, B.; Butler, J.; Casey, D.E.; Drazner, M.H.; Fonarow, G.C.; Geraci, S.A.; Horwich, T.; Januzzi, J.L.; et al. ACCF/AHA guideline for the management of heart failure: Executive summary: A report of the American College of Cardiology Foundation/American Heart Association Task Force on practice guidelines. Circulation 128, 1810–1852.
- Swen, J.J.; Nijenhuis, M.; Boer, A.; Grandia, L.; Maitland, A.H.; Mulder, H.; Rongen, G.A.; Schaik, R.H.; Schalekamp, T.; Touw, D.J.; et al. Pharmacogenetics: From bench to byte—An update of guidelines. Clin. Pharmacol. Ther 2011, 89, 662–673. [Google Scholar]
- Kazi, D.S.; Garber, A.M.; Shah, R.U.; Dudley, R.A.; Mell, M.W.; Rhee, C.; Moshkevich, S.; Boothroyd, D.B.; Owens, D.K.; Hlatky, M.A. Cost-effectiveness of genotype-guided and dual antiplatelet therapies in acute coronary syndrome. Ann. Intern. Med 2014, 160, 221–232. [Google Scholar]
- Tobler, A.R.; Short, S.; Andersen, M.R.; Paner, T.M.; Briggs, J.C.; Lambert, S.M.; Wu, P.P.; Wang, Y.; Spoonde, A.Y.; Koehler, R.T.; et al. The SNPlex genotyping system: A flexible and scalable platform for SNP genotyping. J. Biomol. Tech 2005, 16, 398–406. [Google Scholar]
- Ong, D.C.; Yam, W.C.; Siu, G.K.; Lee, A.S. Rapid detection of rifampicin- and isoniazid-resistant Mycobacterium tuberculosis by high-resolution melting analysis. J. Clin. Microbiol 2010, 48, 1047–1054. [Google Scholar]
- Syrmis, M.W.; Moser, R.J.; Kidd, T.J.; Hunt, P.; Ramsay, K.A.; Bell, S.C.; Wainwright, C.E.; Grimwood, K.; Nissen, M.D.; Sloots, T.P.; et al. High-throughput single-nucleotide polymorphism-based typing of shared Pseudomonas aeruginosa strains in cystic fibrosis patients using the Sequenom iPLEX platform. J. Med. Microbiol 2013, 62, 734–740. [Google Scholar]
- Hurst, C.D.; Zuiverloon, T.C.; Hafner, C.; Zwarthoff, E.C.; Knowles, M.A.A. SNaPshot assay for the rapid and simple detection of four common hotspot codon mutations in the PIK3CA gene. BMC Res. Notes 2009, 2, 66. [Google Scholar]
- Livak, K.J. SNP genotyping by the 5′-nuclease reaction. Methods Mol. Biol 2003, 212, 129–147. [Google Scholar]
- Ronaghi, M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001, 11, 3–11. [Google Scholar]
- Zhou, Z.; Poe, A.C.; Limor, J.; Grady, K.K.; Goldman, I.; McCollum, A.M.; Escalante, A.A.; Barnwell, J.W.; Udhayakumar, V. Pyrosequencing, a high-throughput method for detecting single nucleotide polymorphisms in the dihydrofolate reductase and dihydropteroate synthetase genes of Plasmodium falciparum. J. Clin. Microbiol 2006, 44, 3900–3910. [Google Scholar]
- Ragoussis, J. Genotyping technologies for genetic research. Annu. Rev. Genomics Hum. Genet 2009, 10, 117–133. [Google Scholar]
Alleles | Primer Sequence (5′–3′) | Size (bp) | Annealing Temperature (°C) | References |
---|---|---|---|---|
CYP2B6*9 | F-GGTCTGCCCATCTATAAAC R-CTGATTCTTCACATGTCTGCG | 526 | 57 | [11] |
CYP2C19*2 | F-AATTACAACCAGAGCTTGGC R-TATCACTTTCCATAAAAGAAG | 169 | 57 | [12] |
CYP2C19*3 | F-CCAATCATTTAGCTTCACCC R-ACTTCAGGGCTTGGTCAATA | 262 | 57 | [12] |
CYP2C19*17 | F-GCCCTTAGCACCAAATTCTCT R-CACCTTTACCATTTAACCCCC | 483 | 57 | [13] |
CYP3A4*18 | F-CACATCAGAATGAAACCACC R-AGAGCCTTCCTACATAGAGTCA | 450 | 57 | [14] |
CYP3A5*3 | F-CATGACTTAGTAGACAGATGA R-TATGTTATGTAATCCATACCCC | 423 | 57 | [15] |
MDR3435 | F-GGGTGGTGTCACAGGAAGAG R-CATGCTCCCAGGCTGTTTAT | 113 | 57 | [16] |
CYP2B6*4 | F-GACAGAAGGATGAGGGAGGAAGATG R-CTCCCTCTGTCTTTCATTCTGTCTTC | 640 | 63 | [11] |
MDR2677 | F-TGTTGTCTGGACAAGCACTGA R-GCATAGTAAGCAGTAGGGAGTAACAA | 141 | 63 | [16] |
P2Y12 H2 | F-TGCTGAAAATTGAAGCCATACTGT R-GCATCTACATCTTGGGAATTTGAA | 278 | 63 | - |
Alleles | Location | Primer Sequence (5′–3′) | Concentration (nM) |
---|---|---|---|
3A5*3 seqF (P21) | intron03 | (T)3AGAGCTCTTTTGTCTTTCA | 0.12 |
CYP2C19*17 seqF (P30) | promoter | (T)0TTGTGTCTTCTGTTCTCAAAG | 0.04 |
3CYP3A4*18 SeqF (P19) | exon10 | (T)8CTCCTTTCAGCTCTGTCCGATC | 0.02 |
P2Y12 H2 seqR (P38) | intron02 | (T)12CTACATCTTGGGAATTTGAAATGAC | 0.02 |
CYP2C19*2 seqF (P55) | exon05 | (T)20CACTATCATTGATTATTTCCC | 0.08 |
MDR1 3435 seqR (P39) | exon26 | (T)24GCCTCCTTTGCTGCCCTCAC | 0.01 |
MDR1 2677 seqR (P45) | exon21 | (T)26AGTTTGACTCACCTTCCCAG | 0.03 |
CYP2C19*3 seqR (P50) | exon04 | (T)28CAAAAAACTTGGCCTTACCTGGAT | 0.04 |
CYP2B6*4 seqR (P60) | exon05 | (T)35AGGTAGGTGTCGATGAGGTCC | 0.12 |
CYP2B6*9 seqR (P65) | exon04 | (T)38GATGATGTTGGCGGTAATGGA | 0.12 |
SNP | rs Number | Effect | Frequency (%) (95% CI) | Concordance (%) |
---|---|---|---|---|
CYP2C19*2 | rs4244285 | Splicing defect | 28.5 (19.6–37.3) | 100 |
CYP2C19*3 | rs4986893 | W212X | 9.5 (3.7–15.2) | 100 |
CYP2C19*17 | rs12248560 | −806C>T | 1 (0.0–2.95) | 100 |
CYP2B6*4 | rs2279343 | K262R | 7 (2.1–12.0) | 100 |
CYP2B6*6 | rs3745274, rs2279343 | Q172H, K262R | 15.5 (8.4–22.5) | 100 |
CYP2B6*9 | rs3745274 | Q172H | 0.5 (0.0–1.9) | 100 |
CYP3A4*18 | rs28371759 | L293P | 1.5 (0.0–3.89) | 100 |
CYP3A5*3 | rs776746 | Splicing defect | 76.5 (64.2–84.8) | 100 |
MDR1 2677G>A | rs2032582 | A893ST | 17.5 (10.1–24.9) | 100 |
MDR1 2677G>T | rs2032582 | A893ST | 38 (28.5–47.5) | 100 |
MDR1 3435 C>T | rs1045642 | I1145I | 36.5 (27.1–45.9) | 100 |
P2Y12 H2 | rs2046934 | - | 17.5 (10.1–24.9) | 100 |
Assay Name | Assay Type | Cost per Genotype ($) a | Application | Detection Capacity b | Flexibility | Open Source Reference | Reference |
---|---|---|---|---|---|---|---|
SNPlex | OLA/PCR | 0.24 | ~48 SNP | 504 | − | Protocol No. (cms_042019) c | [27] |
HRM | Melting TM | 0.3 | 1 SNP | >13,800 | − | HRM protocol d | [28] |
Sequenom | Primer Extension | 0.2–0.4 | 40–50 SNP | 1536 | + | Sequenom protocol e | [29] |
SNaPshot (MSSE) | Primer Extension | 1 | ~12 SNP | 3840 | + | SNaPshot protocol c | [30] |
Taqman | 5′-nuclease reaction | 2.39 | 1 SNP | >30,000 | − | Protocol No. (cms_042998) c | [31] |
Pyrosequencing | enzymatic reaction | 4–12 | ~3 SNP | >14,500 | − | Pyrosequencing protocol f | [32,33] |
© 2014 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Jeong, H.-E.; Lee, S.-J.; Cha, E.-Y.; Kim, E.-Y.; Kim, H.-S.; Song, Y.H.; Shin, J.-G. Development of a Multiplex and Cost-Effective Genotype Test toward More Personalized Medicine for the Antiplatelet Drug Clopidogrel. Int. J. Mol. Sci. 2014, 15, 7699-7710. https://doi.org/10.3390/ijms15057699
Jeong H-E, Lee S-J, Cha E-Y, Kim E-Y, Kim H-S, Song YH, Shin J-G. Development of a Multiplex and Cost-Effective Genotype Test toward More Personalized Medicine for the Antiplatelet Drug Clopidogrel. International Journal of Molecular Sciences. 2014; 15(5):7699-7710. https://doi.org/10.3390/ijms15057699
Chicago/Turabian StyleJeong, Hye-Eun, Su-Jun Lee, Eun-Young Cha, Eun-Young Kim, Ho-Sook Kim, Young Hwan Song, and Jae-Gook Shin. 2014. "Development of a Multiplex and Cost-Effective Genotype Test toward More Personalized Medicine for the Antiplatelet Drug Clopidogrel" International Journal of Molecular Sciences 15, no. 5: 7699-7710. https://doi.org/10.3390/ijms15057699
APA StyleJeong, H.-E., Lee, S.-J., Cha, E.-Y., Kim, E.-Y., Kim, H.-S., Song, Y. H., & Shin, J.-G. (2014). Development of a Multiplex and Cost-Effective Genotype Test toward More Personalized Medicine for the Antiplatelet Drug Clopidogrel. International Journal of Molecular Sciences, 15(5), 7699-7710. https://doi.org/10.3390/ijms15057699