Comparison of the Anti-Inflammatory Activities of Supercritical Carbon Dioxide versus Ethanol Extracts from Leaves of Perilla frutescens Britt. Radiation Mutant
Abstract
:1. Introduction
2. Results and Discussion
2.1. Yield and Composition of SFE and EE
2.2. Effect of SFE and EE on Cell Viability
2.3. Effects of SFE and EE on LPS-Stimulated NO Production in RAW 264.7 Cells
2.4. Effects of SFE and EE on Production of Inflammatory Mediators in LPS-Stimulated RAW 264.7 Cells
3. Materials and Methods
3.1. Materials
3.2. Cell Culture
3.3. Ethanol Extraction
3.4. SC-CO2 Extraction
3.5. HPLC Analysis
3.6. Cytotoxicity Assay
3.7. Determination of NO Concentration
3.8. Preparation of Cell Extracts and Western Blot Analysis
3.9. Quantitative Real-Time PCR
3.10. Measurement of MCP-1, IFN-β, and IL-6 by ELISA
3.11. Statistical Methods
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Peng, Y.; Ye, J.; Kong, J. Determination of phenolic compounds in Perilla frutescens L. by capillary electrophoresis with electrochemical detection. J. Agric. Food Chem. 2005, 53, 8141–8147. [Google Scholar] [CrossRef] [PubMed]
- Woo, K.W.; Han, J.Y.; Choi, S.U.; Kim, K.H.; Lee, K.R. Triterpenes from Perilla frutescens var. acuta and their cytotoxic activity. Nat. Product Sci. 2014, 20, 71–75. [Google Scholar]
- Kwak, Y.E.; Ju, J.H. Inhibitory activities of Perilla frutescens britton leaf extract against the growth, migration, and adhesion of human cancer cells. Nutr. Res. Pract. 2015, 9, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.A.; Han, J.S. Anti-inflammatory effect of Perilla frutescens (L.) Britton var. frutescens extract in LPS-stimulated RAW 264.7 macrophage. Prev. Nutr. Food Sci. 2012, 17, 109–115. [Google Scholar] [PubMed]
- Kim, D.H.; Kim, Y.C.; Choi, U.K. Optimization of antibacterial activity of Perilla frutescens var. acuta Leaf against Staphylococcus aureus using evolutionary operation factorial design technique. Int. J. Mol. Sci. 2011, 12, 2395–2407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.Y.; Chen, Y.C.; Lin, C.H.; Kao, S.H. Perilla frutescens leaf extract inhibits mite major allergen Der p 2-induced gene expression of pro-allergic and pro-inflammatory cytokines in human bronchial epithelial cell BEAS-2B. PLoS ONE 2013, 8, e77458. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Huang, X.; Han, J.; Zheng, W.; Ma, W. Extract of Perilla frutescens inhibits tumor proliferation of HCC via PI3K/AKT signal pathway. Afr. J. Tradit. Complement. Altern. Med. 2013, 10, 251–257. [Google Scholar] [CrossRef] [PubMed]
- Sybille, B.W.; Hajime, F.; Claudia, R.; Christiane, S. Perilla extract improves gastrointestinal discomfort in a randomized placebo controlled double blind human pilot study. BMC Complement. Altern. Med. 2014, 14, 173. [Google Scholar]
- Ueda, H.; Yamazaki, M. Inhibition of tumor necrosis factor-alpha production by orally administering a perilla leaf extract. Biosci. Biotechnol. Biochem. 1997, 61, 1292–1295. [Google Scholar] [CrossRef] [PubMed]
- Park, Y.D.; Kang, M.A.; Lee, H.J.; Jin, C.H.; Choi, D.S.; Kim, D.S.; Kang, S.Y.; Byun, M.W.; Jeong, I.Y. Inhibition of an inducible nitric oxide synthase expression by a hexane extract from Perilla frutescens cv. Chookyoupjaso mutant induced by mutagenesis with gamma-ray. J. Radiat. Ind. 1999, 3, 13–18. [Google Scholar]
- Jin, C.H.; Lee, H.J.; Park, Y.D.; Choi, D.S.; Kim, D.S.; Kang, S.Y.; Seo, K.I.; Jeong, I.Y. Isoegomaketone inhibits lipopolysaccharide-induced nitric oxide production in RAW264.7 macrophages through the heme oxygenase-1 induction and inhibition of the interferon-β-STAT-1 pathway. J. Agric. Food Chem. 2010, 58, 860–867. [Google Scholar] [CrossRef] [PubMed]
- Cho, B.O.; Jin, C.H.; Park, Y.D.; Ryu, H.W.; Byun, M.W.; Seo, K.I.; Jeong, I.Y. Isoegomaketone induces apoptosis through caspase-dependent and caspase-independent pathways in human DLD1 cells. Biosci. Biotechnol. Biochem. 2011, 75, 1306–1311. [Google Scholar] [CrossRef] [PubMed]
- Kwon, S.J.; Lee, J.H.; Moon, K.D.; Jeong, I.Y.; Ahn, D.U.; Lee, M.K.; Seo, K.I. Induction of apoptosis by isoegomaketone from Perilla frutescens L. in B16 melanoma cells is mediated through ROS generation and mitochondrial-dependent, -independent pathway. Food Chem. Toxicol. 2014, 65, 97–104. [Google Scholar] [CrossRef] [PubMed]
- Guan, W.; Li, S.; Yan, R.; Tang, S.; Quan, C. Comparison of essential oil of clove buds extracted with supercritical carbon dioxide and other three traditional extraction methods. Food Chem. 2007, 101, 1558–1564. [Google Scholar] [CrossRef]
- Sookwong, P.; Suttiarporn, P.; Boontakham, P.; Seekhow, P.; Wangtueai, S.; Mahatheeranont, S. Simultaneous quantification of vitamin E, r-oryzanols and xanthophylls from rice bran essences extracted by supercritical CO2. Food Chem. 2016, 211, 140–147. [Google Scholar] [CrossRef] [PubMed]
- Jung, D.M.; Yoon, S.H.; Jung, M.Y. Chemical properties and oxidative stability of perilla oils obtained from roasted perilla seeds as affected by extraction methods. J. Food Sci. 2012, 77, C1249–C1255. [Google Scholar] [CrossRef] [PubMed]
- Kim, I.H.; Kim, M.H.; Kim, Y.E.; Lee, Y.C. Oxidative stability and extraction of perilla seed oil with supercritical carbon dioxide. Food Sci. Biotech. 1998, 7, 177–180. [Google Scholar]
- Shao, P.; He, J.; Sun, P.; Zhao, P. Analysis of conditions for microwave-assisted extraction of total water-soluble flavonoids from Perilla frutescens leaves. J. Food Sci. Technol. 2012, 49, 66–73. [Google Scholar] [CrossRef] [PubMed]
- Siti, M.Z.; Siti, M.; Mustapa, K. Subcritical water extraction of bioactive compounds from plants and algae: Application in pharmaceutical and food ingredients. Food Eng. Rev. 2016, 8, 23–34. [Google Scholar]
- Ruan, R.S. Possible roles of nitric oxide in the physiology and pathophysiology of the mammalian cochlea. Am. N. Y. Acad. Sci. 2002, 962, 260–274. [Google Scholar] [CrossRef]
- Tylor, B.S.; Kion, Y.M.; Wang, Q.I.; Sharpio, R.A.; Billiar, T.R.; Geller, D.A. Nitric oxide down regulates hepatocyte-inducible nitric oxide synthase gene expression. Arch. Surg. 1997, 1, 1177–1182. [Google Scholar] [CrossRef]
- Banno, N.; Akihisa, T.; Tokuda, H.; Yasukawa, K.; Higashihara, H.; Ukiya, M.; Watanabe, K.; Kimura, Y.; Hasegawa, J.; Nishino, H. Triterpene acids from the leaves of Perilla frutescens and their anti-inflammatory and anti-tumor-promoting effects. Biosci. Biotechnol. Biochem. 2004, 68, 85–90. [Google Scholar] [CrossRef] [PubMed]
- So, Y.K.; Lee, S.Y.; Han, A.R.; Kim, J.B.; Jeong, H.G.; Jin, C.H. Rosmarinic acid methyl ester inhibits LPS-induced NO production via suppression of MyD88-dependent and –independent pathways and induction of HO-1 in RAW 264.7 cells. Molecules 2016, 21, 1083. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.S.; Priyadarshini, M.; Bano, B. Preventive effect of curcumin and quercetin against nitric oxide mediated modification of goat lung cystatin. J. Agric. Food. Chem. 2009, 57, 6055–6059. [Google Scholar] [CrossRef] [PubMed]
- Sample Availability: Not available.
Target Gene | 5′ to 3′ Direction | |
---|---|---|
iNOS | Forward | TGAGAGGGAAATCGTGCGTGAC |
Revers | GCTCGTTGCCAATAGTGATGACC | |
IL-6 | Forward | GTTCTCTGGGAAATCGTGGAA |
Revers | GCAAGTGCATCATCGTTGTTC | |
MCP-1 | Forward | GCATCTGCCCTAAGGTCTTCA |
Revers | AAGTGCTTGAGGTGGTTGTGG | |
β-actin | Forward | TCCTACACCACACCAAACTGTGTGC |
Revers | CTCCAATCTCTGCCTATCCGTCTC |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jin, C.H.; Park, H.C.; So, Y.; Nam, B.; Han, S.N.; Kim, J.-B. Comparison of the Anti-Inflammatory Activities of Supercritical Carbon Dioxide versus Ethanol Extracts from Leaves of Perilla frutescens Britt. Radiation Mutant. Molecules 2017, 22, 311. https://doi.org/10.3390/molecules22020311
Jin CH, Park HC, So Y, Nam B, Han SN, Kim J-B. Comparison of the Anti-Inflammatory Activities of Supercritical Carbon Dioxide versus Ethanol Extracts from Leaves of Perilla frutescens Britt. Radiation Mutant. Molecules. 2017; 22(2):311. https://doi.org/10.3390/molecules22020311
Chicago/Turabian StyleJin, Chang Hyun, Han Chul Park, Yangkang So, Bomi Nam, Sung Nim Han, and Jin-Baek Kim. 2017. "Comparison of the Anti-Inflammatory Activities of Supercritical Carbon Dioxide versus Ethanol Extracts from Leaves of Perilla frutescens Britt. Radiation Mutant" Molecules 22, no. 2: 311. https://doi.org/10.3390/molecules22020311