Herbal Formula HT048 Attenuates Diet-Induced Obesity by Improving Hepatic Lipid Metabolism and Insulin Resistance in Obese Rats
Abstract
:1. Introduction
2. Results
2.1. Food Intake, Body Weight, and Weight Gain
2.2. Changes in Organ Weights
2.3. Biochemical Analysis of Serum Samples
2.4. Expression of Genes Involved in Lipogenesis, β-Oxidation-Related Genes, and Gluconeogenesis in the Liver
2.5. Expression of Fat Accumulation-Related and Inflammatory Genes in WAT
2.6. Expression of Genes Encoding CYP Enzymes
3. Discussion
4. Materials and Methods
4.1. Preparation of HT048
4.2. HPLC Analysis of HT048
4.3. Animal Experiments
4.4. Serum Measurements
4.5. Real-Time Quantitative PCR Analysis
4.6. Micro-Computed Tomography (microCT)
4.7. Statistical Analysis
Author Contributions
Conflicts of Interest
References
- Haslam, D.W.; James, W.P. Obesity. Lancet 2005, 366, 1197–1209. [Google Scholar] [CrossRef]
- Yach, D.; Stuckler, D.; Brownell, K.D. Epidemiologic and economic consequences of the global epidemics of obesity and diabetes. Nat. Med. 2006, 12, 62–66. [Google Scholar] [CrossRef] [PubMed]
- James, W.P. Who recognition of the global obesity epidemic. Int. J. Obes. 2008, 32, S120–S126. [Google Scholar] [CrossRef] [PubMed]
- Jensen, M.D. Is visceral fat involved in the pathogenesis of the metabolic syndrome? Human model. Obesity 2006, 14, 20S–24S. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.J.; Bang, C.Y.; Guo, Y.R.; Choung, S.Y. Anti-obesity effects of aster spathulifolius extract in high-fat diet-induced obese rats. J. Med. Food 2016, 19, 353–364. [Google Scholar] [CrossRef] [PubMed]
- Wildman, R.P.; Muntner, P.; Reynolds, K.; McGinn, A.P.; Rajpathak, S.; Wylie-Rosett, J.; Sowers, M.R. The obese without cardiometabolic risk factor clustering and the normal weight with cardiometabolic risk factor clustering: Prevalence and correlates of 2 phenotypes among the us population (nhanes 1999–2004). Arch. Intern. Med. 2008, 168, 1617–1624. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Li, J.; Song, B.; Xiao, X.; Zhang, B.; Qi, M.; Huang, W.; Yang, L.; Wang, Z. Curcumin rescues high fat diet-induced obesity and insulin sensitivity in mice through regulating srebp pathway. Toxicol. Appl. Pharmacol. 2016, 304, 99–109. [Google Scholar] [CrossRef] [PubMed]
- Daneschvar, H.L.; Aronson, M.D.; Smetana, G.W. FDA-approved anti-obesity drugs in the united states. Am. J. Med. 2016, 129, 879.e1–879.e6. [Google Scholar] [CrossRef] [PubMed]
- Rios-Hoyo, A.; Gutierrez-Salmean, G. New dietary supplements for obesity: What we currently know. Curr. Obes. Rep. 2016, 5, 262–270. [Google Scholar] [CrossRef] [PubMed]
- Park, H.J.; Jung, U.J.; Cho, S.J.; Jung, H.K.; Shim, S.; Choi, M.S. Citrus unshiu peel extract ameliorates hyperglycemia and hepatic steatosis by altering inflammation and hepatic glucose- and lipid-regulating enzymes in db/db mice. J. Nutr. Biochem. 2013, 24, 419–427. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Ra, J.; Song, J.Y.; Gwak, C.; Kwon, H.J.; Yim, S.V.; Hong, S.P.; Kim, J.; Lee, K.H.; Cho, J.J.; et al. Extracts from Citrus unshiu promote immune-mediated inhibition of tumor growth in a murine renal cell carcinoma model. J. Ethnopharmacol. 2011, 133, 973–979. [Google Scholar] [CrossRef] [PubMed]
- Min, K.Y.; Kim, H.J.; Lee, K.A.; Kim, K.T.; Paik, H.D. Antimicrobial activity of acid-hydrolyzed Citrus unshiu peel extract in milk. J. Dairy Sci. 2014, 97, 1955–1960. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Zhang, C.; Bucheli, P.; Wei, D. Citrus flavonoids in fruit and traditional chinese medicinal food ingredients in china. Plant Foods Hum. Nutr. 2006, 61, 57–65. [Google Scholar] [CrossRef] [PubMed]
- Dahmer, S.; Scott, E. Health effects of hawthorn. Am. Fam. Physician 2010, 81, 465–468. [Google Scholar] [PubMed]
- Chang, Q.; Zuo, Z.; Harrison, F.; Chow, M.S. Hawthorn. J. Clin. Pharmacol. 2002, 42, 605–612. [Google Scholar] [CrossRef] [PubMed]
- Yoo, J.H.; Liu, Y.; Kim, H.S. Hawthorn fruit extract elevates expression of Nrf2/HO-1 and improves lipid profiles in ovariectomized rats. Nutrients 2016, 8, 283. [Google Scholar] [CrossRef] [PubMed]
- Luo, M.; Yang, X.; Hu, J.Y.; Jiao, J.; Mu, F.S.; Song, Z.Y.; Gai, Q.Y.; Qiao, Q.; Ruan, X.; Fu, Y.J. Antioxidant properties of phenolic compounds in renewable parts of Crataegus pinnatifida inferred from seasonal variations. J. Food Sci. 2016, 81, C1102–C1109. [Google Scholar] [CrossRef] [PubMed]
- Lim, D.W.; Song, M.; Park, J.; Park, S.W.; Kim, N.H.; Gaire, B.P.; Choi, H.Y.; Kim, H. Anti-obesity effect of ht048, a herbal combination, in high fat diet-induced obese rats. Molecules 2012, 17, 14765–14777. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.H.; Kim, Y.S.; Song, M.; Lee, M.; Park, J.; Kim, H. A herbal formula HT048, Citrus unshiu and Crataegus pinnatifida, prevents obesity by inhibiting adipogenesis and lipogenesis in 3T3-L1 preadipocytes and HFD-induced obese rats. Molecules 2015, 20, 9656–9670. [Google Scholar] [CrossRef] [PubMed]
- Jang, E.H.; Park, Y.C.; Chung, W.G. Effects of dietary supplements on induction and inhibition of cytochrome P450s protein expression in rats. Food Chem. Toxicol. 2004, 42, 1749–1756. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.A.; Deng, S.; Jiang, D.; Zhang, R.; Zhang, S.; Zhong, J.; Yang, L.; Wang, T.; Hong, S.; Guo, S.; et al. CARD3 deficiency exacerbates diet-induced obesity, hepatosteatosis, and insulin resistance in male mice. Endocrinology 2013, 154, 685–697. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; An, Y.; Zhao, C.; Han, L.; Boakye-Yiadom, M.; Wang, W.; Zhang, Y. Regulation effects of Crataegus pinnatifida leaf on glucose and lipids metabolism. J. Agric. Food Chem. 2011, 59, 4987–4994. [Google Scholar] [CrossRef] [PubMed]
- Sugiura, M.; Ogawa, K.; Yano, M. Effect of chronic administration of fruit extract (Citrus unshiu marc.) on glucose tolerance in gk rats, a model of type 2 diabetes. Biosci. Biotechnol. Biochem. 2006, 70, 293–295. [Google Scholar] [CrossRef] [PubMed]
- Jensen, M.D. Role of body fat distribution and the metabolic complications of obesity. J. Clin. Endocrinol. Metab. 2008, 93, S57–S63. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Cao, P.; Wang, H.; Tang, Z.; Wang, N.; Wang, J.; Zhang, Y. Chronic administration of angelica sinensis polysaccharide effectively improves fatty liver and glucose homeostasis in high-fat diet-fed mice. Sci. Rep. 2016, 6, 26229. [Google Scholar] [CrossRef] [PubMed]
- Freitas, R.B.; Novaes, R.D.; Goncalves, R.V.; Mendonca, B.G.; Santos, E.C.; Ribeiro, A.Q.; Lima, L.M.; Fietto, L.G.; Peluzio Mdo, C.; Leite, J.P. Euterpe edulis extract but not oil enhances antioxidant defenses and protects against nonalcoholic fatty liver disease induced by a high-fat diet in rats. Oxid. Med. Cell. Longev. 2016, 2016, 8173876. [Google Scholar] [CrossRef] [PubMed]
- Tarantino, G.; Savastano, S.; Capone, D.; Colao, A. Spleen: A new role for an old player? World J. Gastroenterol. 2011, 17, 3776–3784. [Google Scholar] [CrossRef] [PubMed]
- Altunkaynak, B.Z.; Ozbek, E.; Altunkaynak, M.E. A stereological and histological analysis of spleen on obese female rats, fed with high fat diet. Saudi Med. J. 2007, 28, 353–357. [Google Scholar] [PubMed]
- Saltiel, A.R.; Kahn, C.R. Insulin signalling and the regulation of glucose and lipid metabolism. Nature 2001, 414, 799–806. [Google Scholar] [CrossRef] [PubMed]
- Hariri, N.; Thibault, L. High-fat diet-induced obesity in animal models. Nutr. Res. Rev. 2010, 23, 270–299. [Google Scholar] [CrossRef] [PubMed]
- Valera, A.; Pujol, A.; Pelegrin, M.; Bosch, F. Transgenic mice overexpressing phosphoenolpyruvate carboxykinase develop non-insulin-dependent diabetes mellitus. Proc. Natl. Acad. Sci. USA 1994, 91, 9151–9154. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Q.; Zhang, X.; Wang, O.; Liu, J.; Cai, S.; Wang, R.; Zhou, F.; Ji, B. Anti-diabetic effects of the ethanol extract of a functional formula diet in mice fed with a fructose/fat-rich combination diet. J. Sci. Food Agric. 2015, 95, 401–408. [Google Scholar] [CrossRef] [PubMed]
- Ferre, P.; Foufelle, F. Hepatic steatosis: A role for de novo lipogenesis and the transcription factor SREBP-1c. Diabetes Obes. Metab. 2010, 12, 83–92. [Google Scholar] [CrossRef] [PubMed]
- Horton, J.D.; Goldstein, J.L.; Brown, M.S. Srebps: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Investig. 2002, 109, 1125–1131. [Google Scholar] [CrossRef] [PubMed]
- Shimano, H. Sterol regulatory element-binding proteins (srebps): Transcriptional regulators of lipid synthetic genes. Prog. Lipid Res. 2001, 40, 439–452. [Google Scholar] [CrossRef]
- Sung, S.H.; Lee, M. Anti-adipogenic activity of a new cyclic diarylheptanoid isolated from alnus japonica on 3T3-l1 cells via modulation of PPARγ, c/EBPα and SREBP1c signaling. Bioorg. Med. Chem. Lett. 2015, 25, 4648–4651. [Google Scholar] [CrossRef] [PubMed]
- Ringseis, R.; Eder, K. Regulation of genes involved in lipid metabolism by dietary oxidized fat. Mol. Nutr. Food Res. 2011, 55, 109–121. [Google Scholar] [CrossRef] [PubMed]
- Park, H.S.; Hur, H.J.; Kim, S.H.; Park, S.J.; Hong, M.J.; Sung, M.J.; Kwon, D.Y.; Kim, M.S. Biochanin a improves hepatic steatosis and insulin resistance by regulating the hepatic lipid and glucose metabolic pathways in diet-induced obese mice. Mol. Nutr. Food Res. 2016, 60, 1944–1955. [Google Scholar] [CrossRef] [PubMed]
- Kabir, M.; Catalano, K.J.; Ananthnarayan, S.; Kim, S.P.; van Citters, G.W.; Dea, M.K.; Bergman, R.N. Molecular evidence supporting the portal theory: A causative link between visceral adiposity and hepatic insulin resistance. Am. J. Physiol. Endocrinol. Metab. 2005, 288, E454–E461. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.J.; Choi, M.S.; Cha, B.Y.; Woo, J.T.; Park, Y.B.; Kim, S.R.; Jung, U.J. Long-term supplementation of honokiol and magnolol ameliorates body fat accumulation, insulin resistance, and adipose inflammation in high-fat fed mice. Mol. Nutr. Food Res. 2013, 57, 1988–1998. [Google Scholar] [CrossRef] [PubMed]
- Lodhi, I.J.; Yin, L.; Jensen-Urstad, A.P.; Funai, K.; Coleman, T.; Baird, J.H.; El Ramahi, M.K.; Razani, B.; Song, H.; Fu-Hsu, F.; et al. Inhibiting adipose tissue lipogenesis reprograms thermogenesis and ppargamma activation to decrease diet-induced obesity. Cell Metab. 2012, 16, 189–201. [Google Scholar] [CrossRef] [PubMed]
- Gomes Natal, D.I.; de Castro Moreira, M.E.; Soares Miliao, M.; dos Anjos Benjamin, L.; de Souza Dantas, M.I.; Machado Rocha Ribeiro, S.; Stampini Duarte Martino, H. Uba mango juices intake decreases adiposity and inflammation in high-fat diet-induced obese wistar rats. Nutrition 2016, 32, 1011–1018. [Google Scholar] [CrossRef] [PubMed]
- Jung, M.S.; Lee, S.J.; Song, Y.; Jang, S.H.; Min, W.; Won, C.K.; Kim, H.D.; Kim, T.H.; Cho, J.H. Rubus crataegifolius bunge regulates adipogenesis through Akt and inhibits high-fat diet-induced obesity in rats. Nutr. Metab. 2016, 13, 29. [Google Scholar] [CrossRef] [PubMed]
- Bouloumie, A.; Drexler, H.C.; Lafontan, M.; Busse, R. Leptin, the product of ob gene, promotes angiogenesis. Circ. Res. 1998, 83, 1059–1066. [Google Scholar] [CrossRef] [PubMed]
- Jeffery, E.; Church, C.D.; Holtrup, B.; Colman, L.; Rodeheffer, M.S. Rapid depot-specific activation of adipocyte precursor cells at the onset of obesity. Nat. Cell Biol. 2015, 17, 376–385. [Google Scholar] [CrossRef] [PubMed]
- Jung, S.; Lee, M.S.; Shin, Y.; Kim, C.T.; Kim, I.H.; Kim, Y. High hydrostatic pressure extract of red ginseng attenuates inflammation in rats with high-fat diet induced obesity. Prev. Nutr. Food Sci. 2015, 20, 253–259. [Google Scholar] [CrossRef] [PubMed]
- Vornoli, A.; Pozzo, L.; Della Croce, C.M.; Gervasi, P.G.; Longo, V. Drug metabolism enzymes in a steatotic model of rat treated with a high fat diet and a low dose of streptozotocin. Food Chem. Toxicol. 2014, 70, 54–60. [Google Scholar] [CrossRef] [PubMed]
- Nelson, D.R.; Koymans, L.; Kamataki, T.; Stegeman, J.J.; Feyereisen, R.; Waxman, D.J.; Waterman, M.R.; Gotoh, O.; Coon, M.J.; Estabrook, R.W.; et al. P450 superfamily: Update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 1996, 6, 1–42. [Google Scholar] [CrossRef] [PubMed]
- Tajima, M.; Ikarashi, N.; Okaniwa, T.; Imahori, Y.; Saruta, K.; Toda, T.; Ishii, M.; Tanaka, Y.; Machida, Y.; Ochiai, W.; et al. Consumption of a high-fat diet during pregnancy changes the expression of cytochrome P450 in the livers of infant male mice. Biol. Pharm. Bull. 2013, 36, 649–657. [Google Scholar] [CrossRef] [PubMed]
- Puccinelli, E.; Gervasi, P.G.; Pelosi, G.; Puntoni, M.; Longo, V. Modulation of cytochrome P450 enzymes in response to continuous or intermittent high-fat diet in pigs. Xenobiotica 2013, 43, 686–698. [Google Scholar] [CrossRef] [PubMed]
- Sample Availability: Milligram quantities of HT048 is available from the authors.
Parameters | STD | HFD | HFD + Orlistat | HFD + 0.2% HT048 | HFD + 0.6% HT048 |
---|---|---|---|---|---|
Food intake (g/day) | 17.90 ± 2.69 a | 14.39 ± 2.25 bc | 15.55 ± 3.74 b | 14.15 ± 1.96 c | 14.31 ± 2.32 bc |
Body weight (g) | |||||
Initial weight | 114.90 ± 8.05 | 114.93 ± 6.40 | 114.93 ± 9.15 | 114.85 ± 4.44 | 114.88 ± 5.94 |
Final weight | 444.50 ± 20.64 c | 508.83± 17.04 a | 460.00 ± 32.50 bc | 479.92 ± 29.56 b | 474.75 ± 31.74 b |
Weight gain | 329.60 ± 22.88 c | 393.91 ± 18.69 a | 345.07 ± 29.17 bc | 365.07 ± 30.92 b | 359.88 ± 31.12 b |
Organ weight (g) | |||||
Liver | 10.19 ± 0.83 b | 11.07 ± 0.51 a | 10.46 ± 1.13 ab | 10.02 ± 0.96 b | 9.91 ± 0.70 b |
Spleen | 0.83 ± 0.09 ab | 0.86 ± 0.16 a | 0.81 ± 0.11 ab | 0.76 ± 0.09 b | 0.75 ± 0.10 b |
Epididymal | 7.01 ± 1.70 c | 13.15 ± 2.65 a | 9.16 ± 2.58 b | 9.94 ± 1.69 b | 10.11 ± 2.57 b |
Mesenteric | 2.49 ± 0.66 d | 6.55 ± 1.50 a | 3.86 ± 1.27 c | 5.11 ± 1.09 b | 5.10 ± 1.69 b |
Perirenal | 5.63 ± 2.04 c | 13.01 ± 3.14 a | 8.63 ± 1.94 b | 10.55 ± 2.36 b | 9.61 ± 2.94 b |
Total WAT | 15.13 ± 3.83 c | 32.72 ± 5.22 a | 21.65 ± 5.40 b | 25.60 ± 4.00 b | 24.81 ± 5.61 b |
Parameters | STD | HFD | HFD + Orlistat | HFD + 0.2% HT048 | HFD + 0.6% HT048 |
---|---|---|---|---|---|
Glucose (mg/dL) | 89.29 ± 14.13 a | 120.29 ± 21.69 b | 106.64 ± 11.42 b | 111.29 ± 16.99 b | 117.46 ± 13.43 b |
Insulin (ng/mL) | 0.62 ± 0.57 a | 1.42 ± 1.05 b | 0.48 ± 0.10 a | 0.74 ± 0.47 a | 0.96 ± 0.71 ab |
Gene | Forward Primer (5’-3’) | Reverse Primer (5’-3’) |
---|---|---|
SREBP1c | AAAACCAGCCTCCCCAGAGC | CCAGTCCCCATCCACGAAGA′ |
SREBP2 | CACTCACGCTCCTCGGTCAC | CGGATAAGCAGGTCTGTAGGTTGG |
PPARα | TGGAGTCCACGCATGTGAAG | CGCCAGCTTTAGCCGAATAG |
CPT-1 | TAGGACAGGCAGAAAATTGC | CAGTAGGAGCCGATTCAAAA |
PEPCK | GAGGAGCTGTTCGGAATCTCTA | CCTCTCTATTTCGTAAGGGAGGTC |
G6Pase | GTCAGTCTTATCCCCTACTGCCTA | CGCTGACTTGTGTCAGAGACTT |
GK | GAGTCTCTCTAGCTGAGACCAACA | CAGACCTCCTTGACTAACTCAGGT |
PPARγ | CCCTGGCAAAGCATTTGTAT | GGTGATTTGTCTGTTGTCTTTCC |
aP2 | GGCTTCGCCACCAGGAA | CCCTTCTACGCTGATGATCAAGT |
LPL | CAGCAAGGCATACAGGTG | CGAGTCTTCAGGTACATCTTAC |
MCP-1 | AATGAGTCGGCTGGAGAACTAC | GATCTCTCTCTTGAGCTTGGTGAC |
TNF-α | GGCAGGTCTACTTTGGAGTCAT | GAGTAGACGATAAAGGGGTCAGAG |
CYP1A2 | GTCACCTCAGGGAATGCTGTG | GTTGACAATCTTCTCCTGAGG |
CYP2C11 | AAAAGCACAATCCGCAGTCT | GCATCTGGCTCCTGTCTTTC |
CYP3A1 | CTTCACAAACCGGAGGCCTTTGGT | ATCAGGGTGAGTGGCCAGTTCTAC |
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, Y.H.; Jin, B.; Lee, S.H.; Song, M.; Bae, H.; Min, B.J.; Park, J.; Lee, D.; Kim, H. Herbal Formula HT048 Attenuates Diet-Induced Obesity by Improving Hepatic Lipid Metabolism and Insulin Resistance in Obese Rats. Molecules 2016, 21, 1424. https://doi.org/10.3390/molecules21111424
Lee YH, Jin B, Lee SH, Song M, Bae H, Min BJ, Park J, Lee D, Kim H. Herbal Formula HT048 Attenuates Diet-Induced Obesity by Improving Hepatic Lipid Metabolism and Insulin Resistance in Obese Rats. Molecules. 2016; 21(11):1424. https://doi.org/10.3390/molecules21111424
Chicago/Turabian StyleLee, Yoon Hee, Bora Jin, Sung Hyun Lee, MiKyung Song, HyeonHui Bae, Byung Jae Min, Juyeon Park, Donghun Lee, and Hocheol Kim. 2016. "Herbal Formula HT048 Attenuates Diet-Induced Obesity by Improving Hepatic Lipid Metabolism and Insulin Resistance in Obese Rats" Molecules 21, no. 11: 1424. https://doi.org/10.3390/molecules21111424
APA StyleLee, Y. H., Jin, B., Lee, S. H., Song, M., Bae, H., Min, B. J., Park, J., Lee, D., & Kim, H. (2016). Herbal Formula HT048 Attenuates Diet-Induced Obesity by Improving Hepatic Lipid Metabolism and Insulin Resistance in Obese Rats. Molecules, 21(11), 1424. https://doi.org/10.3390/molecules21111424