Search Results (15)

Oat seeds contain peroxygenase, a heme enzyme localized in both the microsomal and the lipid droplet fractions, which are usually separated by multiple ultracentrifugation steps. In this work, it was shown that peroxygenase activity is retained in the lipid fraction (LF) of oat seeds, which is obtained by simple extraction of flour with organic solvents. The enzymatic activity of this crude preparation was tested in the oxidation of thioanisole in comparison with a peroxygenase-containing microsome preparation (MP) from the same plant source in both aqueous medium and pure organic solvents. In most cases, higher activity was observed in the LF preparation, which proved to be stable in organic solvents for at least 24 h, thus offering a good option for the oxidation of highly water-insoluble substrates. LF-peroxygenase maintained the same stereoselectivity features observed with MP, as also demonstrated in the epoxidation reaction of limonene. A protocol for the oxidation of thioanisole in CH₃CN was set up on a preparative scale, and the corresponding sulfoxide was obtained at concentration of 1.7 M and with 84% ee. Full article

Enzymes of the cytochrome P450 monooxygenase family 4 (CYP4) in mammals are generally involved either in endobiotic metabolism (e.g., acting on fatty acids or eicosanoids), or the modification of xenobiotics including therapeutic drugs. CYP4B1 is special, as it is an enigmatic enzyme acting at the interface between xenobiotic and endobiotic metabolism. However, a systematic analysis of CYP4B1’s substrate scope has not yet been reported. Herein, a three-step approach to identify novel substrates for three CYP4B1 orthologs (namely from rabbits, green monkeys, and mouse lemurs) is described. First, screening of a library containing 502 natural products revealed potential novel substrate groups for CYP4B1. Second, based on these results, a systematic library was defined consisting of 63 compounds representing 10 compound groups. Third, in vitro conversion of these compounds by CYP4B1 and identification of conversion products were conducted, supported by in silico docking, allowing the prediction of binding probabilities and potential oxidation sites. We report five new substrate groups (acyclic, monocyclic and bicyclic terpenoids, stilbenoids, and vanilloids), twenty-eight new substrates (inter alia capsaicin, gingerol, genistein, stilbene, myristicin, thioanisole), and two new reaction types for CYP4B1 (S-oxidation, O-demethylation). Consequently, CYP4B1 is a far more promiscuous enzyme than previously thought. Full article

Perylenetetracarboxylic dianhydride (PTCDA) derivatives have received significant attention as molecule photocatalysts. However, the poor recyclability of molecule-type photocatalysts hinders their widespread applications. Herein, immobilization of PTCDA on Al₂O₃ was achieved by simply physical mixing, which not only dramatically improved their recyclability, but also surprisingly improved the reactivity. A mechanism study suggested that the photo-exited state (PTCDA*) of PTCDA could promote the oxidation of thioanisole to generate PTCDA^•−, which sequentially reduces oxygen to furnish superoxide radicals to achieve the catalytic cycle. Herein, the immobilization support Al₂O₃ was able to facilitate the strong adsorption of thioanisole, thereby boosting the photocatalytic activity. This work provides a new insight that the immobilization of organic molecular photocatalysts on those supports with proper adsorption sites could furnish highly efficient, stable, and recyclable molecular-based heterogeneous photocatalysts. Full article

Previous biomimetic studies clearly proved that equatorial ligands significantly influence the redox potential and thus the stability/reactivity of biologically important oxoiron intermediates; however, no such studies were performed on Fe^IIIOIPh species. In this study, the influence of substituted pyridine co-ligands on the reactivity of iron(III)-iodosylbenzene adduct has been investigated in sulfoxidation and epoxidation reactions. Selective oxidation of thioanisole, cis-cyclooctene, and cis- and trans-stilbene in the presence of a catalytic amount of [Fe^II(PBI)₃](OTf)₂ with PhI(OAc)₂ provide products in good to excellent yields through an Fe^IIIOIPh intermediate depending on the co-ligand (4R-Py) used. Several mechanistic studies were performed to gain more insight into the mechanism of oxygen atom transfer (OAT) reactions to support the reactive intermediate and investigate the effect of the equatorial co-ligands. Based on competitive experiments, including a linear free-energy relationship between the relative reaction rates (logk_rel) and the σ_p (4R-Py) parameters, strong evidence has been observed for the electrophilic character of the reactive species. The presence of the [(PBI)₂(4R-Py)Fe^IIIOIPh]³⁺ intermediates and the effect of the co-ligands was also supported by UV-visible measurements, including the color change from red to green and the hypsochromic shifts in the presence of co-ligands. This is another indication that the title iron(III)-iodosylbenzene adduct is able to oxygenate sulfides and alkenes before it is transformed into the oxoiron form by cleavage of the O−I bond. Full article

The mechanisms of sulfoxidation and epoxidation mediated by previously synthesized and characterized iron(III)-iodosylbenzene adduct, Fe^III(OIPh) were investigated using para-substituted thioanisole and styrene derivatives as model substrates. Based on detailed kinetic reaction experiments, including the linear free-energy relationships between the relative reaction rates (logk_rel) and the σ_p (4R-PhSMe) with ρ = −0.65 (catalytic) and ρ = −1.13 (stoichiometric), we obtained strong evidence that the stoichiometric and catalytic oxidation of thioanisoles mediated by Fe^III(OIPh) species involves direct oxygen transfer. The small negative slope −2.18 from log k_obs versus E_ox for 4R-PhSMe gives further clear evidence for the direct oxygen atom transfer mechanism. On the contrary, with the linear free-energy relationships between the relative reaction rates (logk_rel) and total substituent effect (TE, 4R-PhCHCH₂) parameters with slope = 0.33 (catalytic) and 2.02 (stoichiometric), the stoichiometric and catalytic epoxidation of styrenes takes place through a nonconcerted electron transfer (ET) mechanism, including the formation of the radicaloid benzylic radical intermediate in the rate-determining step. On the basis of mechanistic studies, we came to the conclusion that the title iron(III)-iodosylbenzene complex is able to oxygenate sulfides and alkenes before it is transformed into the oxo-iron form by cleavage of the O−I bond. Full article

A challenge in mimicking tyrosinase activity using model compounds is to reproduce its enantioselectivity. Good enantioselection requires rigidity and a chiral center close to the active site. In this study, the synthesis of a new chiral copper complex, [Cu₂(mXPhI)]^4+/2+, based on an m-xylyl-bis(imidazole)-bis(benzimidazole) ligand containing a stereocenter with a benzyl residue directly bound on the copper chelating ring, is reported. Binding experiments show that the cooperation between the two metal centers is weak, probably due to steric hindrance given by the benzyl group. The dicopper(II) complex [Cu₂(mXPhI)]⁴⁺ has catalytic activity in the oxidations of enantiomeric couples of chiral catechols, with an excellent discrimination capability for Dopa-OMe enantiomers and a different substrate dependence, hyperbolic or with substrate inhibition, for the L- or D- enantiomers, respectively. [Cu₂(mXPhI)]⁴⁺ is active in a tyrosinase-like sulfoxidation of organic sulfides. The monooxygenase reaction requires a reducing co-substrate (NH₂OH) and yields sulfoxide with significant enantiomeric excess (e.e.). Experiments with ¹⁸O₂ and thioanisole yielded sulfoxide with 77% incorporation of ¹⁸O, indicating a reaction occurring mostly through direct oxygen transfer from the copper active intermediate to the sulfide. This mechanism and the presence of the chiral center of the ligand in the immediate copper coordination sphere are responsible for the good enantioselectivity observed. Full article

Biocatalyzed oxidations are an important target in sustainable synthesis since chemical oxidations often require harsh conditions and metal-based catalysts. A raw peroxygenase-containing enzymatic preparation from oat flour was tested as a biocatalyst for the enantioselective oxidation of sulfides to sulfoxides and the variations of some reaction parameters were evaluated. Under optimal conditions, thioanisole was fully converted into the corresponding (R)-sulfoxide with high optical purity (80% ee) and the same stereopreference was maintained in the oxidation of some other sulfides. Changes in the substituent on the sulfur atom affected the selectivity of the enzyme and the best results were obtained with phenyl methoxymethyl sulfide, which gave the corresponding sulfoxide in 92% ee as exclusive product. The over-oxidation of sulfides to sulfones was instead detected in all the other cases and preferential oxidation of the (S)-enantiomer of the sulfoxide intermediate was observed, albeit with low selectivity. Carrying out the oxidation of thioanisole up to the 29% formation of sulfone led to enhancement of the sulfoxide optical purity (89% ee). The activity in sulfoxidation reactions, in addition to that reported in the epoxidation of different substrates, makes this plant peroxygenase a promising and useful tool in organic synthesis. Full article

Heterogenized metalloporphyrin catalysts for oxidation reactions are extensively explored to improve chemical production. In this work, manganese meso-tetraarylporphyrins were immobilized on hydrated mesoporous titanium dioxide (S_BET = 705 m² g⁻¹) through carboxylate or phosphonate anchoring groups separated from the macrocycle by the 2-arylimidazole linker fused across one of the pyrrolic rings of the macrocycle. The element composition of two mesoporous hybrid materials thus obtained were investigated and the integrity of the immobilized complexes was shown by different physicochemical methods. Finally, the catalytic efficiency of the more stable material Mn(TMPIP)/TiO₂ with the phosphonate anchor was evaluated in the selective oxidation of sulfides to sulfoxides by molecular oxygen in the presence of isobutyraldehyde (IBA). The heterogenized complex has shown excellent catalytic activity exhibiting a turnover (TON) of ~1100 in a single catalytic run of the sulfoxidation of thioanisole. The catalyst was successfully reused in seven consecutive catalytic cycles. Full article

Cytochrome P450 monooxygenases (P450s) are promising versatile oxidative biocatalysts. However, the practical use of P450s in vitro is limited by their dependence on the co-enzyme NAD(P)H and the complex electron transport system. Using H₂O₂ simplifies the catalytic cycle of P450s; however, most P450s are inactive in the presence of H₂O₂. By mimicking the molecular structure and catalytic mechanism of natural peroxygenases and peroxidases, an artificial P450 peroxygenase system has been designed with the assistance of a dual-functional small molecule (DFSM). DFSMs, such as N-(ω-imidazolyl fatty acyl)-l-amino acids, use an acyl amino acid as an anchoring group to bind the enzyme, and the imidazolyl group at the other end functions as a general acid-base catalyst in the activation of H₂O₂. In combination with protein engineering, the DFSM-facilitated P450 peroxygenase system has been used in various oxidation reactions of non-native substrates, such as alkene epoxidation, thioanisole sulfoxidation, and alkanes and aromatic hydroxylation, which showed unique activities and selectivity. Moreover, the DFSM-facilitated P450 peroxygenase system can switch to the peroxidase mode by mechanism-guided protein engineering. In this short review, the design, mechanism, evolution, application, and perspective of these novel non-natural P450 peroxygenases for the oxidation of non-native substrates are discussed. Full article

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (A^Br), 8-oxo-2′-deoxyadenosine (A^oxo) or β-L-2′-deoxyadenosine (A^L) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an A^L residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date. Full article

Baeyer-Villiger monooxygenases (BVMOs) are flavin-dependent enzymes that primarily convert ketones to esters, but can also catalyze heteroatom oxidation. Several structural studies have highlighted the importance of the ‘control loop’ in BVMOs, which adopts different conformations during catalysis. Central to the ‘control loop’ is a conserved tryptophan that has been implicated in NADP(H) binding. BVMO_AFL210 from Aspergillus flavus, however, contains a threonine in the equivalent position. Here, we report the structure of BVMO_AFL210 in complex with NADP⁺ in both the ‘open’ and ‘closed’ conformations. In neither conformation does Thr513 contact the NADP⁺. Although mutagenesis of Thr513 did not significantly alter the substrate scope, changes in peroxyflavin stability and reaction rates were observed. Mutation of this position also brought about changes in the regio- and enantioselectivity of the enzyme. Moreover, lower rates of overoxidation during sulfoxidation of thioanisole were also observed. Full article

A set of dual functional small molecules (DFSMs) containing different amino acids has been synthesized and employed together with three different variants of the cytochrome P450 monooxygenase P450BM3 from Bacillus megaterium in H₂O₂-dependent oxidation reactions. These DFSMs enhance P450BM3 activity with hydrogen peroxide as an oxidant, converting these enzymes into formal peroxygenases. This system has been employed for the catalytic epoxidation of styrene and in the sulfoxidation of thioanisole. Various P450BM3 variants have been evaluated in terms of activity and selectivity of the peroxygenase reactions. Full article

Herein we describe the first representative of an E2-type two-component styrene monooxygenase of proteobacteria. It comprises a single epoxidase protein (VpStyA1) and a two domain protein (VpStyA2B) harboring an epoxidase (A2) and a FAD-reductase (B) domain. It was annotated as VpStyA1/VpStyA2B of Variovorax paradoxus EPS. VpStyA2B serves mainly as NADH:FAD-oxidoreductase. A K_m of 33.6 ± 4.0 µM for FAD and a k_cat of 22.3 ± 1.1 s⁻¹ were determined and resulted in a catalytic efficiency (k_cat K_m⁻¹) of 0.64 s⁻¹ μM⁻¹. To investigate its NADH:FAD-oxidoreductase function the linker between A2- and B-domain (AREAV) was mutated. One mutant (AAAAA) showed 18.7-fold higher affinity for FAD (k_cat K_m⁻¹ of 5.21 s⁻¹ μM⁻¹) while keeping wildtype NADH-affinity and -oxidation activity. Both components, VpStyA2B and VpStyA1, showed monooxygenase activity on styrene of 0.14 U mg⁻¹ and 0.46 U mg⁻¹, as well as on benzyl methyl sulfide of 1.62 U mg⁻¹ and 3.11 U mg⁻¹, respectively. The high sulfoxidase activity was the reason to test several thioanisole-like substrates in biotransformations. VpStyA1 showed high substrate conversions (up to 95% in 2 h) and produced dominantly (S)-enantiomeric sulfoxides of all tested substrates. The AAAAA-mutant showed a 1.6-fold increased monooxygenase activity. In comparison, the GQWCSQY-mutant did neither show monooxygenase nor efficient FAD-reductase activity. Hence, the linker between the two domains of VpStyA2B has effects on the reductase as well as on the monooxygenase performance. Overall, this monooxygenase represents a promising candidate for biocatalyst development and studying natural fusion proteins. Full article

Two sandwich-type polyoxomolybdates Na₈[MO₂{Mo₂O₅(O₃PCH₃C(O)PO₃)}₂] (M = Ni²⁺ (1); Co²⁺ (2)) were synthesized by one-pot reaction of Na₂HPMo₁₂O₄₀·14H₂O, 1-hydroxy ethidene diphosphonic acid (HEDP=HOC(CH₃)(PO₃H₂)₂), and (1) NiCl₂/CoCl₂ (2). Compounds 1 and 2 were characterized by single crystal X-ray analysis, X-ray powder diffraction (XRPD), IR spectroscopy, ³¹P NMR spectra, UV-vis spectroscopy, and thermogravimetric analyses (TGA). Structural analysis reveals that 1 and 2 exhibit similar centrosymmetric structure, which consists of one transition metal (TM) ion sandwiched by two same subunits {Mo₂O₅(O₃PCH₃C(O)PO₃)}. The clusters 1 and 2 show efficient catalytic activities for oxidation of thioanisole. Moreover, they are catalytically selective for oxidizing thioanisole. Both resuable polyoxomolybdates 1 and 2 catalysts show good thermo- and hydrolytic stability. It is noted that compound 1 shows outstanding catalytic activity for oxidation of various sulfides to corresponding sulfones with 93–100% selectivity at 97–100% conversion in one hour under mild conditions, which is potentially valuable to the removal of organic sulfides. Full article

The transformation of three types of polyoxovanadates, {(n-C₄H₉)₄N}₃[H₃V₁₀O₂₈], {(n-C₄H₉)₄N}₄[V₁₂O₃₂] and {(n-C₄H₉)₄N}₃[V₁₃O₃₄] have been investigated according to the rational chemical equations, and the best transformation conditions were reported. By the reaction of [H₃V₁₀O₂₈]³⁻ with 0.33 equivalents of {(n-C₄H₉)₄N}OH in acetonitrile at 80 °C, [V₁₂O₃₂]⁴⁻ was formed with 92% yield. The reaction in nitroethane with 0.69 equivalents of p-toluenesulfonic acid gave [V₁₃O₃₄]³⁻ with 91% yield. The ⁵¹V NMR observation of each reaction suggests the complete transformations of [H₃V₁₀O₂₈]³⁻ to [V₁₂O₃₂]⁴⁻ and to [V₁₃O₃₄]³⁻ proceeded without the formation of any byproducts and it provides the reliable synthetic route. Decavanadates were produced by the hydrolysis of [V₁₂O₃₂]⁴⁻ or [V₁₃O₃₄]³⁻. While the direct transformation of [V₁₃O₃₄]³⁻ to [V₁₂O₃₂]⁴⁻ partly proceeded, the reverse one could not be observed. For the thioanisole oxidation, [V₁₃O₃₄]³⁻ showed the highest activity of the three. Full article