Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction
Abstract
:1. Introduction
2. Results
2.1. CD Spectroscopy
2.2. Catalytic Properties of HT21 Analogues
3. Materials and Methods
3.1. Oligonucleotides’ Synthesis and Purification
3.2. Chemicals
3.3. CD Spectroscopy
3.4. Oxidation Procedure
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Roelfes, G.; Feringa, B.L. DNA-based asymmetric catalysis. Angew. Chem.—Int. Ed. 2005, 44, 3230–3232. [Google Scholar] [CrossRef]
- Coquière, D.; Feringa, B.L.; Roelfes, G. DNA-based catalytic enantioselective Michael reactions in water. Angew. Chem.—Int. Ed. 2007, 46, 9308–9311. [Google Scholar] [CrossRef] [PubMed]
- Boersma, A.J.; Feringa, B.L.; Roelfes, G. Enantioselective friedel-crafts reactions in water using a DNA*based catalyst. Angew. Chem.—Int. Ed. 2009, 48, 3346–3348. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Ikehata, K.; Watabe, R.; Hidaka, Y.; Rajendran, A.; Sugiyama, H. Deciphering DNA-based asymmetric catalysis through intramolecular friedel–crafts alkylations. Chem. Commun. 2012, 48, 10398–10400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duchemin, N.; Heath-Apostolopoulos, I.; Smietana, M.; Arseniyadis, S. A decade of DNA-hybrid catalysis: From innovation to comprehension. Org. Biomol. Chem. 2017, 15, 7072–7087. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Benedetti, E.; Bethge, L.; Vonhoff, S.; Klussmann, S.; Vasseur, J.J.; Cossy, J.; Smietana, M.; Arseniyadis, S. DNA vs. mirror-image DNA: A universal approach to tune the absolute configuration in DNA-based asymmetric catalysis. Angew. Chem.—Int. Ed. 2013, 52, 11546–11549. [Google Scholar] [CrossRef] [PubMed]
- Roe, S.; Ritson, D.J.; Garner, T.; Searle, M.; Moses, J.E. Tuneable DNA-based asymmetric catalysis using a G-quadruplex supramolecular assembly. Chem. Commun. 2010, 46, 4309–4311. [Google Scholar] [CrossRef]
- Wang, C.; Jia, G.; Zhou, J.; Li, Y.; Liu, Y.; Lu, S.; Li, C. Enantioselective diels-alder reactions with G-quadruplex DNA-based catalysts. Angew. Chem.—Int. Ed. 2012, 51, 9352–9355. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Li, Y.; Jia, G.; Liu, Y.; Lu, S.; Li, C. Enantioselective friedel-crafts reactions in water catalyzed by a human telomeric G-quadruplex DNA metalloenzyme. Chem. Commun. 2012, 48, 6232–6234. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Gonçalves, D.P.N.; Wieland, M.; Marx, A.; Hartig, J.S. Novel DNA catalysts based on G-quadruplex recognition. ChemBioChem 2008, 9, 1061–1064. [Google Scholar] [CrossRef] [Green Version]
- Cheng, M.; Li, Y.; Zhou, J.; Jia, G.; Lu, S.M.; Yang, Y.; Li, C. Enantioselective sulfoxidation reaction catalyzed by a G-quadruplex DNA metalloenzyme. Chem. Commun. 2016, 52, 9644–9647. [Google Scholar] [CrossRef] [PubMed]
- Burge, S.; Parkinson, G.N.; Hazel, P.; Todd, A.K.; Neidle, S. Quadruplex DNA: Sequence, topology and structure. Nucleic Acids Res. 2006, 34, 5402–5415. [Google Scholar] [CrossRef] [Green Version]
- Hoogsteen, K. The crystal and molecular structure of a hydrogen-bonded complex between 1-methylthymine and 9-methyladenine. Acta Crystallogr. 1963, 16, 907–916. [Google Scholar] [CrossRef]
- Dai, J.; Carver, M.; Yang, D. Polymorphism of human telomeric quadruplex structures. Biochimie 2008, 90, 1172–1183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Phan, A.T. Human telomeric G-quadruplex: Structures of DNA and RNA sequences. FEBS J. 2010, 277, 1107–1117. [Google Scholar] [CrossRef]
- Dey, S.; Jäschke, A. Tuning the Stereoselectivity of a DNA-Catalyzed Michael Addition through Covalent Modification. Angew. Chem.—Int. Ed. 2015, 54, 11279–11282. [Google Scholar] [CrossRef] [PubMed]
- Dey, S.; Jäschke, A. Covalently functionalized DNA duplexes and quadruplexes as hybrid catalysts in an enantioselective friedel-crafts reaction. Molecules 2020, 25, 3121. [Google Scholar] [CrossRef]
- Wang, C.; Jia, G.; Li, Y.; Zhang, S.; Li, C. Na+/K+ switch of enantioselectivity in G-quadruplex DNA-based catalysis. Chem. Commun. 2013, 49, 11161–11163. [Google Scholar] [CrossRef]
- Li, Y.; Cheng, M.; Hao, J.; Wang, C.; Jia, G.; Li, C. Terpyridine-Cu(II) targeting human telomeric DNA to produce highly stereospecific G-quadruplex DNA metalloenzyme. Chem. Sci. 2015, 6, 5578–5585. [Google Scholar] [CrossRef] [Green Version]
- Cheng, M.; Hao, J.; Li, Y.; Cheng, Y.; Jia, G.; Zhou, J.; Li, C. Probing the interaction of copper cofactor and azachalcone substrate with G-quadruplex of DNA based Diels-Alderase by site-specific fluorescence quenching titration. Biochimie 2018, 146, 20–27. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Cheng, M.; Hao, J.; Jia, G.; Li, C. Fluorescence Spectroscopic Insight into the Supramolecular Interactions in DNA-Based Enantioselective Sulfoxidation. ChemBioChem 2018, 19, 2233–2240. [Google Scholar] [CrossRef]
- Borlinghaus, J.; Albrecht, F.; Gruhlke, M.C.H.; Nwachukwu, I.D.; Slusarenko, A.J. Allicin: Chemistry and biological properties. Molecules 2014, 19, 12591–12618. [Google Scholar] [CrossRef] [Green Version]
- Otocka, S.; Kwiatkowska, M.; Madalińska, L.; Kiełbasiński, P. Chiral Organosulfur Ligands/Catalysts with a Stereogenic Sulfur Atom: Applications in Asymmetric Synthesis. Chem. Rev. 2017, 117, 4147–4181. [Google Scholar] [CrossRef]
- Mahy, J.P.; Maréchal, J.D.; Ricoux, R. From “hemoabzymes” to “hemozymes”: Towards new biocatalysts for selective oxidations. Chem. Commun. 2015, 51, 2476–2494. [Google Scholar] [CrossRef]
- Masiero, S.; Trotta, R.; Pieraccini, S.; De Tito, S.; Perone, R.; Randazzo, A.; Spada, G.P. A non-empirical chromophoric interpretation of CD spectra of DNA G-quadruplex structures. Org. Biomol. Chem. 2010, 8, 2683–2692. [Google Scholar] [CrossRef]
- Vorlíčková, M.; Kejnovská, I.; Sagi, J.; Renčiuk, D.; Bednářová, K.; Motlová, J.; Kypr, J. Circular dichroism and guanine quadruplexes. Methods 2012, 57, 64–75. [Google Scholar] [CrossRef]
- Ambrus, A.; Chen, D.; Dai, J.; Bialis, T.; Jones, R.A.; Yang, D. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 2006, 34, 2723–2735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Wang, C.; Jia, G.; Lu, S.; Li, C. Enantioselective Michael addition reactions in water using a DNA-based catalyst. Tetrahedron 2013, 69, 6585–6590. [Google Scholar] [CrossRef]




| Name | Sequence (5′-3′) | Tm °C (±1) | 
|---|---|---|
| HT21 | GGGTTAGGGTTAGGGTTAGGG | 69 | 
| HT21-ABr1 | GGGTTABrGGGTTAGGGTTAGGG | 70 | 
| HT21-ABr2 | GGGTTAGGGTTABrGGGTTAGGG | 72 | 
| HT21-ABr3 | GGGTTAGGGTTAGGGTTABrGGG | 71 | 
| HT21-AL1 | GGGTTALGGGTTAGGGTTAGGG | 73 | 
| HT21-AL2 | GGGTTAGGGTTALGGGTTAGGG | 74 | 
| HT21-AL3 | GGGTTAGGGTTAGGGTTALGGG | 68 | 
| HT21-Aoxo1 | GGGTTAoxoGGGTTAGGGTTAGGG | 68 | 
| HT21-Aoxo2 | GGGTTAGGGTTAoxoGGGTTAGGG | 68 | 
| HT21-Aoxo3 | GGGTTAGGGTTAGGGTTAoxoGGG | 68 | 
| G4-DNA | %Conversion ab | ee b % | 
|---|---|---|
| HT21 | 99 * | 56 * | 
| HT21-AL1 | 98 | 84 | 
| HT21-AL2 | 99 | 54 | 
| HT21-AL3 | 98 | 36 | 
| HT21-Aoxo1 | 99 | 37 | 
| HT21-Aoxo2 | 99 | 14 | 
| HT21-Aoxo3 | 99 | 21 | 
| HT21-ABr1 | 93 | 34 | 
| HT21-ABr2 | 98 | 23 | 
| HT21-ABr3 | 99 | 28 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Festa, C.; Esposito, V.; Benigno, D.; De Marino, S.; Zampella, A.; Virgilio, A.; Galeone, A. Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction. Int. J. Mol. Sci. 2022, 23, 1092. https://doi.org/10.3390/ijms23031092
Festa C, Esposito V, Benigno D, De Marino S, Zampella A, Virgilio A, Galeone A. Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction. International Journal of Molecular Sciences. 2022; 23(3):1092. https://doi.org/10.3390/ijms23031092
Chicago/Turabian StyleFesta, Carmen, Veronica Esposito, Daniela Benigno, Simona De Marino, Angela Zampella, Antonella Virgilio, and Aldo Galeone. 2022. "Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction" International Journal of Molecular Sciences 23, no. 3: 1092. https://doi.org/10.3390/ijms23031092
APA StyleFesta, C., Esposito, V., Benigno, D., De Marino, S., Zampella, A., Virgilio, A., & Galeone, A. (2022). Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction. International Journal of Molecular Sciences, 23(3), 1092. https://doi.org/10.3390/ijms23031092
 
         
                                                






 
       