Search Results (23)

Metabolic dysfunction-associated steatotic liver disease (MASLD) is a systemic disorder shaped by interorgan crosstalk: dynamic, bidirectional communication through which the liver and endocrine organs, gut, adipose tissue, brain, kidney, skeletal muscle, bone, and heart exchange signals to coordinate metabolism, immunity, and tissue homeostasis. Across these axes, neural circuits, hormones, cytokines, adipokines, hepatokines, myokines, osteokines, bile acids, microbial metabolites, lipids, extracellular vesicles, and microRNAs integrate nutrient handling, insulin action, immunity, mitochondrial function, and tissue remodeling. Perturbation of these networks converts physiological homeostasis into self-reinforcing loops of substrate overflow, endocrine dysregulation, dysbiosis, inflammation, and fibrogenesis, while hepatic dysfunction propagates renal, neurocognitive, cardiometabolic, and musculoskeletal complications. This framework helps explain why individuals with comparable steatosis show divergent trajectories of metabolic dysfunction-associated steatohepatitis (MASH), fibrosis, extrahepatic disease, and treatment response. It also highlights tractable points of intervention, including restoration of adipose buffering, modulation of gut microbial and bile-acid signaling, correction of endocrine drivers, preservation of muscle and bone, and integrated cardio–kidney–liver risk reduction across different disease stages and clinical phenotypes. We argue that precision hepatology should move beyond isolated assessment of liver fat and fibrosis towards multidimensional phenotyping of dominant crosstalk mechanisms. Longitudinal multi-omic studies and trials incorporating outcomes across organs are now required to distinguish causal signals from disease correlates, define clinically actionable endotypes, and test whether targeting one node can restore durable metabolic and functional resilience throughout the interconnected MASLD network, while improving patient-centered outcomes across the disease course. Full article

Prolonged skeletal muscle disuse, such as extended inactivity and mechanical unloading, typically elicits severe muscle atrophy and progressive bone loss, yet hibernating mammals evade this pathological cascade via poorly defined adaptive mechanisms. Using the Daurian ground squirrel (Spermophilus dauricus) as a unique natural model of prolonged torpor, we demonstrate that skeletal muscle-derived small extracellular vesicles (Mu-EVs) orchestrate protective muscle–bone crosstalk to maintain bone homeostasis during extended disuse. Morphological and microstructural analyses revealed no significant deficits in skeletal muscle and tibial bone between pre-hibernation (PRE) and torpor (TOR) states. Compared with PRE-Mu-EVs, TOR-Mu-EVs significantly enhanced osteogenic differentiation in MC3T3-E1 osteoblasts, markedly upregulating mRNA expression of the key osteogenic markers OCN and COL1A1 (p < 0.05, p < 0.01). Small RNA sequencing identified a novel unannotated miRNA (mature sequence: GCAGCAGCCCGGCTCTCCTAAT) sharply downregulated in TOR-Mu-EVs (p < 0.01); this miRNA exhibits binding potential toward the transcript of Bmp7, a pivotal regulator of osteogenesis. In vitro functional assays confirmed that this miRNA suppresses osteoblast maturation; in a mouse hindlimb unloading (HLU) disuse osteoporosis model, miRNA antagomir partially alleviated bone loss, boosting Masson staining area by 27.13% (p < 0.05) and bone volume fraction by 15.01% (n = 5, 0.05 < p < 0.1, Cohen’s d = 0.71, 95% CI [−0.16, 1.38]). Collectively, hibernating Mu-EVs mitigate this BMP7-inhibiting miRNA to sustain osteogenic activity, hinting at a conserved regulatory cascade that could offer tentative translational clues for managing disuse osteoporosis. Full article

Extracellular vesicles (EVs) have emerged as fundamental pillars of intercellular communication, acting as primary mediators of the bidirectional biochemical crosstalk within the integrated bone–muscle unit. This review provides a comprehensive synthesis of EV-mediated signaling across the bone–muscle axis, offering a side-by-side mapping of vesicular biogenesis, cargo composition, and functional roles in both tissues. Under physiological conditions, skeletal muscle- and bone-derived EVs orchestrate tissue homeostasis, adaptations to physical exercise, myogenesis, and bone remodeling by transferring unique molecular cargos of proteins and specific microRNAs. However, aging induces a profound remodeling of the EV secretome toward a senescent profile characterized by harmful vesicular factors. This dysfunctional vesicular signaling impairs both muscle regeneration and osteogenesis, directly contributing to the pathogenesis of interconnected age-related disorders like sarcopenia, osteoporosis, and osteosarcopenia. Concurrently, circulating EVs represent valuable, minimally invasive biomarkers for early diagnosis. On the therapeutic front, this review critically evaluates emerging EV-based approaches, utilizing mesenchymal stem cell-derived, bioengineered, or biomaterial-incorporated EVs, offering promising, low-immunogenic alternatives to cell transplantation to enhance musculoskeletal tissue repair and restore bone–muscle homeostasis. Despite persisting technical challenges regarding large-scale production and standardization, targeting or leveraging EV-mediated communication represents one of the most innovative and revolutionary strategies to counteract age-related musculoskeletal decline. By unifying physiological mechanisms, age-related molecular reprogramming, and therapeutic engineering across both muscle and bone into a single narrative, this review provides a comprehensive framework to guide future research and clinical translation in musculoskeletal health. Full article

Heterotopic ossification (HO), the pathological formation of mature bone in non-skeletal soft tissues (e.g., muscles, tendons), severely impairs patient mobility and quality of life. Despite decades of research, systematic analysis of signaling networks across HO subtypes (acquired traumatic HO, hereditary Fibrodysplasia Ossificans Progressiva (FOP), Progressive Osseous Heteroplasia (POH)) remains insufficient, and clinical therapies suffer from high recurrence and severe side effects. This review synthesizes recent advances in HO pathogenesis: FOP involves gain-of-function activin A receptor type I (ACVR1) mutations (mostly R206H), disrupting bone morphogenetic protein (BMP)/Activin A signaling; POH arises from paternal guanine nucleotide-binding protein, alpha-stimulating activity polypeptide (GNAS) loss-of-function mutations, derepressing Hedgehog signaling via reduced cyclic adenosine monophosphate (cAMP)/protein kinase A (PKA) activity; tHO features trauma-induced inflammation/hypoxia activating BMP/transforming growth factor–beta (TGF-β) pathways. Key signaling crosstalk (e.g., BMP-Yes-associated protein (YAP)-Indian hedgehog (IHH)) is integrated, and novel therapies (ACVR1 inhibitors, Activin A antibodies, retinoic acid receptor gamma (RARγ) agonists, adeno-associated virus (AAV)-mediated ACVR1 silencing) are highlighted, with emphasis on subtype-specific efficacy. A stratified, mechanism-based HO management framework is proposed, aiming to accelerate precision therapy development and advance understanding of aberrant tissue regeneration. Full article

Population aging and widespread sedentary lifestyles have increased the prevalence of chronic non-communicable diseases, many of which are linked to progressive disruptions of cellular homeostasis. Autophagy, a conserved cellular degradation and recycling pathway, plays a central role in maintaining metabolic flexibility, proteostasis, and organ function. However, aging and physical inactivity impair autophagic regulation, thereby contributing to the development of sarcopenia, cardiovascular diseases, metabolic disorders, and neurodegenerative diseases. Physical exercise is a non-pharmacological intervention that can restore autophagic activity and confer systemic health benefits in multiple preclinical and clinical contexts. Increasing evidence indicates that these benefits are mediated not only by local tissue adaptations but also by complex inter-organ communication. Central to this process are exercise-induced bioactive factors, collectively termed exerkines, including myokines, cardiokines, adipokines, hepatokines, osteokines, and circulating miRNAs. Rather than acting independently, exerkines form an integrated signaling network that fine-tunes autophagic flux across multiple tissues. Exerkine-mediated regulation of autophagy involves key pathways such as AMPK/mTOR, FoxO, SIRT1, ULK1, and TFEB, thereby coordinating energy metabolism, mitochondrial quality control, inflammation, and protein turnover in skeletal muscle, heart, liver, adipose tissue, bone, and the central nervous system. This review summarizes current evidence on representative exerkines and their roles in autophagy-dependent inter-organ crosstalk, highlighting the exercise–exerkine–autophagy axis as a promising target for preventing and managing chronic diseases. Full article

Skeletal muscle is increasingly recognized as a dynamic endocrine organ whose secretome—particularly myokines—serves as a central hub for the coordination of systemic metabolic health, inflammation, and tissue adaptation. This review integrates molecular, cellular, and physiological evidence to elucidate how myokine signaling translates mechanical and metabolic stimuli from exercise into biochemical pathways that regulate glucose homeostasis, lipid oxidation, mitochondrial function, and immune modulation. We detail the duality and context-dependence of cytokine and myokine actions, emphasizing the roles of key mediators such as IL-6, irisin, SPARC, FGF21, and BAIBA in orchestrating cross-talk between muscle, adipose tissue, pancreas, liver, bone, and brain. Distinctions between resistance and endurance training are explored, highlighting how each modality shapes the myokine milieu and downstream metabolic outcomes through differential activation of AMPK, mTOR, and PGC-1α axes. The review further addresses the hormetic role of reactive oxygen species, the importance of satellite cell dynamics, and the interplay between anabolic and catabolic signaling in muscle quality control and longevity. We discuss the clinical implications of these findings for metabolic syndrome, sarcopenia, and age-related disease, and propose that the remarkable plasticity of skeletal muscle and its secretome offers a powerful, multifaceted target for lifestyle interventions and future therapeutic strategies. An original infographic is presented to visually synthesize the complex network of myokine-mediated muscle–organ interactions underpinning exercise-induced metabolic health. Full article

Background/Objectives: Obesity and type 2 diabetes mellitus (T2DM) profoundly disrupt lipid metabolism within local microenvironments of skeletal muscle and its associated connective tissues, including adipose tissue, bone, and fascia. However, the role of local communication between skeletal muscle and its proximal connective tissues in propagating metabolic dysfunction is incompletely understood. This narrative review synthesizes current evidence on these local metabolic interactions, highlighting novel insights and existing gaps. Methods: We conducted a comprehensive literature analysis of primary research published in the last decade, sourced from PubMed, Web of Science, and ScienceDirect. Studies were selected for relevance to skeletal muscle, adipose tissue, fascia, and bone lipid metabolism in the context of obesity and T2DM, with emphasis on molecular, cellular, and paracrine mechanisms of local crosstalk. Findings were organized into thematic sections addressing physiological regulation, pathological remodeling, and inter-organ signaling pathways. Results: Our synthesis reveals that local lipid dysregulation in obesity and T2DM involves altered fatty acid transporter dynamics, mitochondrial overload, fibro-adipogenic remodeling, and compartment-specific adipose tissue dysfunction. Crosstalk via myokines, adipokines, osteokines, bioactive lipids, and exosomal miRNAs integrates metabolic responses across these tissues, amplifying insulin resistance and lipotoxic stress. Emerging evidence highlights the underappreciated roles of fascia and marrow adipocytes in regional lipid handling. Conclusions: Collectively, these insights underscore the pivotal role of inter-tissue crosstalk among skeletal muscle, adipose tissue, bone, and fascia in orchestrating lipid-induced insulin resistance, and highlight the need for integrative strategies that target this multicompartmental network to mitigate metabolic dysfunction in obesity and T2DM. Full article

Osteosarcopenia is a widespread geriatric condition resulting from the coexistence of osteoporosis and sarcopenia, where the connection between bone and muscle is, in part, driven by bone–muscle crosstalk. Given the close, reciprocal influence of muscle on nerve, and vice versa, it is not surprising that there are corresponding aging changes in the biochemistry and morphology of the neuromuscular junction (NMJ). Indeed, degeneration of motor neurons and progressive disruption of the neuromuscular connectivity were observed in old age. Extracellular vesicles (EVs) derived from human amniotic fluid stem cells (hAFSC), exhibiting antioxidant properties, which can also explain their anti-aging and cytoprotective effects, can be considered as potential treatment for age-related diseases. To study cell interactions under both healthy and pathological conditions occurring in musculo–skeletal apparatus, we developed a three-culture system exploiting the use of well-known transwell supports. This system allows both myotubes and neurons, eventually treated with EVs, and osteoblasts, induced to osteoporosis, to interact physically and biochemically. Collectively, this method allowed us to understand how the modifications induced in osteoblasts during bone disorders trigger a cascade of detrimental effects in the muscle and neuron parts. Moreover, we demonstrated the efficacy of hAFSC-EVs in preventing NMJ dysfunction, muscle atrophy, and osteoblast impairment. Full article

Skeletal muscles and bones maintain musculoskeletal system function through their collaborative interaction, whereby muscles regulate bone metabolism via mechanical coupling. An increasing number of studies have shown that various cytokines secreted by skeletal muscles during exercise closely regulate the balance of bone homeostasis. Interleukin-6 (IL-6), one of the first muscle-secreted factors to be discovered, not only plays an important role in regulating the function of the muscle itself but also regulates bone metabolic processes in a bidirectional manner through multiple complex signal transduction pathways, thereby affecting the balance between bone formation and bone resorption. The exact mechanism by which IL-6 regulates bone metabolism is not fully understood, and there are few summaries on how exercise affects bone metabolism through IL-6 from skeletal muscles. Accordingly, this study will take skeletal muscle-derived IL-6 as an entry point to explore how the cross-organ regulatory activities of the muscles targeting bones during exercise affect bone metabolic processes. This study also aims to improve the mechanism of muscle–bone crosstalk under the effect of exercise and provide a theoretical basis and clinical diagnosis and treatment ideas from multiple perspectives for exercise to improve bone health. Full article

Skeletal muscle plays a crucial role in movement, metabolism, and energy homeostasis. As the most metabolically active endocrine organ in the body, it has recently attracted widespread attention. Skeletal muscle possesses the ability to release adipocytokines, bioactive peptides, small molecular metabolites, nucleotides, and other myogenic cell factors; some of which have been shown to be encapsulated within small vesicles, particularly exosomes. These skeletal muscle exosomes (SKM-Exos) are released into the bloodstream and subsequently interact with receptor cell membranes to modulate the physiological and pathological characteristics of various tissues. Therefore, SKM-Exos may facilitate diverse interactions between skeletal muscle and other tissues while also serving as biomarkers that reflect the physiological and pathological states of muscle function. This review delves into the pivotal role and intricate molecular mechanisms of SKM-Exos and its derived miRNAs in the maturation and rejuvenation of skeletal muscle, along with their intercellular signaling dynamics and physiological significance in interfacing with other tissues. Full article

The interplay between skeletal muscle and bone is primarily mechanical; however, biochemical crosstalk by secreted mediators has recently gained increased attention. The aim of this study was to investigate metabolic effects of conditioned medium from osteoblasts (OB-CM) on myotubes and vice versa. Human skeletal muscle cells incubated with OB-CM showed increased glucose uptake and oxidation, and mRNA expression of the glucose transporter (GLUT) 1, while fatty acid uptake and oxidation, and mRNA expression of the fatty acid transporter CD36 were decreased. This was supported by proteomic analysis, where expression of proteins involved in glucose uptake, glycolytic pathways, and the TCA cycle were enhanced, and expression of several proteins involved in fatty acid metabolism were reduced. Similar effects on energy metabolism were observed in human bone marrow stromal cells differentiated to osteoblastic cells incubated with conditioned medium from myotubes (SKM-CM), with increased glucose uptake and reduced oleic acid uptake. Proteomic analyses of the two conditioned media revealed many common proteins. Thus, our data may indicate a shift in fuel preference from fatty acid to glucose metabolism in both cell types, induced by conditioned media from the opposite cell type, possibly indicating a more general pattern in communication between these tissues. Full article

Bone–muscle crosstalk is enabled thanks to the integration of different molecular signals, and it is essential for maintaining the homeostasis of skeletal and muscle tissue. Both the skeletal system and the muscular system perform endocrine activity by producing osteokines and myokines, respectively. These cytokines play a pivotal role in facilitating bone–muscle crosstalk. Moreover, recent studies have highlighted the role of non-coding RNAs in promoting crosstalk between bone and muscle in physiological or pathological conditions. Therefore, positive stimuli or pathologies that target one of the two systems can affect the other system as well, emphasizing the reciprocal influence of bone and muscle. Lifestyle and in particular physical activity influence both the bone and the muscular apparatus by acting on the single system but also by enhancing its crosstalk. Several studies have in fact demonstrated the modulation of circulating molecular factors during physical activity. These molecules are often produced by bone or muscle and are capable of activating signaling pathways involved in bone–muscle crosstalk but also of modulating the response of other cell types. Therefore, in this review we will discuss the effects of physical activity on bone and muscle cells, with particular reference to the biomolecular mechanisms that regulate their cellular interactions. Full article

Skeletal muscle has a high capacity to repair and remodel in response to damage, largely through the action of resident muscle stem cells, termed satellite cells. Satellite cells are required for the proper repair of skeletal muscle through a process known as myogenesis. Recent investigations have observed relationships between satellite cells and other cell types and structures within the muscle microenvironment. These findings suggest that the crosstalk between inflammatory cells, fibrogenic cells, bone-marrow-derived cells, satellite cells, and the vasculature is essential for the restoration of muscle homeostasis. This review will discuss the influence of the cells and structures within the muscle microenvironment on satellite cell function and muscle repair. Full article

Depression is a common mental disorder in which patients often experience feelings of sadness, fatigue, loss of interest, and pleasure. Exercise is a widely used intervention for managing depression, but the specific molecular mechanisms underlying its antidepressant effect are unclear. In this narrative review, we aim to synthesize current knowledge on the molecular, neural, and physiological mechanisms through which exercise exerts its antidepressant effect and discuss the various exercise interventions used for managing depression. We conducted a narrative review of the literature on the topic of exercise and depression. Our review suggests that exercise impacts peripheral tryptophan metabolism, central inflammation, and brain-derived neurotrophic factors through the peroxisome proliferator-activated receptor γ activating factor 1α (PGC-1α) in skeletal muscles. The uncarboxylated osteocalcin facilitates “bone-brain crosstalk”, and exercise corrects atypical expression of brain-gut peptides, modulates cytokine production and neurotransmitter release, and regulates inflammatory pathways and microRNA expression. Aerobic exercise is recommended at frequencies of 3 to 5 times per week with medium to high intensity. Here we highlight the significant potential of exercise therapy in managing depression, supported by the molecular, neural, and physiological mechanisms underlying its antidepressant effect. Understanding the molecular pathways and neural mechanisms involved in exercise’s antidepressant effect opens new avenues for developing novel therapies for managing depression. Full article

Calcitonin gene-related peptide (CGRP) has 37 amino acids. Initially, CGRP had vasodilatory and nociceptive effects. As research progressed, evidence revealed that the peripheral nervous system is closely associated with bone metabolism, osteogenesis, and bone remodeling. Thus, CGRP is the bridge between the nervous system and the skeletal muscle system. CGRP can promote osteogenesis, inhibit bone resorption, promote vascular growth, and regulate the immune microenvironment. The G protein-coupled pathway is vital for its effects, while MAPK, Hippo, NF-κB, and other pathways have signal crosstalk, affecting cell proliferation and differentiation. The current review provides a detailed description of the bone repair effects of CGRP, subjected to several therapeutic studies, such as drug injection, gene editing, and novel bone repair materials. Full article