Search Results (2,798)

Adult hematopoietic stem cells (HSCs) and bone marrow (BM) mesenchymal stem/stromal cells (MSCs) are essential for lifelong hematopoiesis, skeletal homeostasis, immune competence, and tissue regeneration. The use of electronic cigarettes (E-cigs) among women of reproductive age continues to rise, raising concerns about potential adverse developmental effects; however, the long-term consequences of maternal E-cig vaping on offspring BM stem cell function and hematopoietic homeostasis remain incompletely understood. Here, using a rat model of maternal E-cig exposure (containing nicotine) during gestation, combined with longitudinal in vivo analyses and complementary ex vivo studies of human cells, we show that prenatal E-cig exposure is associated with persistent alterations in offspring BM stem cell function and lineage commitment. Gestational E-cig exposure was associated with expansion of the CD11b/c⁺ myeloid-enriched compartment, increased CD90⁺ stromal cells, and impaired osteogenic differentiation in rat offspring. Complementary experiments using primary human cells showed that nicotine exposure was associated with reduced T-cell proliferation and impaired cytotoxic activity in a proof-of-principle co-culture assay. Mechanistically, transcriptomic profiling followed by Gene Ontology and pathway enrichment analyses identified alterations in molecular programs associated with KLF4–Notch1 signaling, mitochondrial biogenesis, inflammation, and stem cell regulation in the BM of E-cig-exposed rat offspring. Changes in CCL11, FTO, and RUNX2 were additionally associated with an inflammatory and aging-related molecular phenotype that persisted from early life into adulthood, although these findings do not establish a causal CCL11–FTO–RUNX2 signaling axis or direct cellular senescence. Collectively, our study provides a phenotypic and mechanistic framework for understanding how maternal E-cig exposure may influence long-term offspring hematopoietic, skeletal, and immune health while highlighting the need for further studies to establish causal molecular mechanisms and determine their relevance to maternal E-cig use in humans. Full article

The perimenopausal phase represents a critical window for early intervention against accelerated bone loss, highlighting an urgent need for safe and accessible non-pharmacological strategies. Although mind–body exercises are widely recommended for healthy aging, their specific structural and metabolic impacts on the perimenopausal skeleton yield conflicting results and remain poorly understood. To address this gap, this systematic review and three-level meta-analysis evaluated the effects of mind–body modalities on bone health in perimenopausal women, utilizing this model to account for statistical dependencies among multiple effect sizes within individual studies. Quantitative synthesis suggested that mind–body exercise may offer modest structural benefits, indicated by positive effects on bone mineral density (SMD = 0.55, p < 0.01) and bone mineral content (SMD = 1.63, p < 0.01); however, these findings must be interpreted with caution as the accompanying certainty of evidence is low to very low. Conversely, these structural adaptations were not accompanied by stable alterations in bone turnover markers, which remained consistently unchanged (SMD = −0.10, p > 0.05). Furthermore, bone mineral metabolism was not statistically significant in the primary analysis, with a confidence interval that included the null (SMD = 0.90, p = 0.079) and demonstrated limited stability across robustness checks. Assessed via the GRADE framework, this overall very low certainty was primarily due to risk-of-bias concerns, inconsistency, imprecision, suspected publication bias, and clinical heterogeneity. Consequently, given the current evidence limitations, mind–body exercise is best conceptualized as a supportive lifestyle component of a healthy aging trajectory rather than a potent osteogenic therapy. It offers a holistic preventative approach that might support bone health while concurrently supporting overall musculoskeletal resilience, though firm clinical recommendations cannot yet be made. Future well-powered trials must adopt rigorous designs with precise endocrine staging to better clarify the underlying mechanisms of skeletal adaptation. Full article

Periodontal and alveolar bone regeneration requires coordinated angiogenic and osteogenic responses supported by biomimetic scaffolds. This study compared three-dimensional bioprinted hydroxyapatite–acrylated palm olein (3D-HA–APO) scaffold formulations containing 5%, 7% and 10% (w/v) hydroxyapatite (HA), designated F1, F2 and F3, respectively. Human umbilical vein endothelial cells were cultured on the scaffolds, and background-corrected soluble vascular endothelial growth factor (VEGF) concentrations in culture supernatants were quantified by enzyme-linked immunosorbent assay (ELISA). Angiogenic-related responses of human periodontal ligament stem cells were assessed by VEGF and cluster of differentiation 31 (CD31) immunofluorescence after endothelial induction, while alkaline phosphatase (ALP) activity in construct lysates was used as an indicator of early osteogenic activity. Soluble VEGF concentrations increased from F1 to F3, with significant differences between all formulations. VEGF-associated signal proportions differed among formulations, with F3 significantly higher than F1. CD31-associated signal proportions increased progressively from F1 to F3, with significant differences between all formulation pairs. ALP activity increased over time in all scaffold groups, and F3 generally showed the highest activity from Day 4 onwards. Overall, F3 showed the most favourable formulation-level profile across the selected angiogenic-related and early osteogenic outcomes. Full article

Polyphosphate (PolyP) is an inorganic polymer composed of orthophosphate units linked by high-energy phosphate anhydride bonds, widely found in various organisms from bacteria to mammals. In recent years, PolyP has attracted widespread attention in the field of bone tissue engineering due to its unique biological characteristics, possessing both osteoinductive activity and metabolic energy supply functions. This article systematically reviews the molecular structure, physicochemical properties, and multiple mechanisms by which PolyP promotes osteogenic differentiation, as well as biomaterial design strategies based on PolyP. PolyP can synergistically promote osteogenic differentiation through multiple mechanisms, including by acting as a phosphate donor, providing metabolic energy, regulating signaling pathways such as Wnt/β-catenin, and modulating the osteoprotegerin/receptor activator of nuclear factor κB ligand (OPG/RANKL) balance. In terms of material design, PolyP can form nano/microparticles with metal ions such as Ca²⁺, Sr²⁺, and Mg²⁺ and can also be compounded with polymers to construct various forms such as hydrogels, bone cement, and three-dimensional (3D)-printed scaffolds. Preclinical studies have shown that PolyP-incorporated materials exhibit excellent osteogenic performance and biocompatibility in bone defect repair, and preliminary clinical studies have also confirmed its feasibility. This article aims to provide a comprehensive overview of the current applications of PolyP-incorporated materials and delineate future directions, challenges, and necessary pathways for their clinical translation. Full article

Mesenchymal stem/stromal cells (MSCs) are promising candidates in regenerative medicine, but their effectiveness is significantly influenced by the surrounding metabolic and nutritional conditions. Increasing evidence suggests that lipids act not only as energy sources but also as regulators of MSC fate. This review explores how lipid metabolism influences the balance among stemness, immunomodulation, and differentiation into adipogenic or osteogenic lineages. It does so through mechanisms such as fatty acid uptake, β-oxidation, de novo lipogenesis, and membrane remodeling, all orchestrated by CD36, carnitine palmitoyltransferase 1A, PPARγ, AMP-activated protein kinase, and the PI3K/AKT/mTOR pathway. We then examine how diet reshapes the MSC lipidome: obesity and high-fat diets promote adipogenesis and senescence, while omega-3 fatty acids, caloric restriction, micronutrients, and a balanced microbiota help preserve regenerative capacity. Lastly, we discuss how combining lipidomics with multi-omics could uncover lipid-metabolic signatures and regulatory nodes that connect diet to MSC function. Overall, the diet–lipid–MSC axis emerges as a modifiable determinant of MSC function. Full article

Titanium alloys are widely used for implants, yet corrosion, bacterial colonization and incomplete osseointegration remain important causes of interfacial failure. This review critically analyzes major biomedical functional coating fabrication techniques employed to enhance the surface properties of titanium alloys, including micro-arc oxidation, anodic oxidation, magnetron sputtering, electrochemical deposition, electrophoretic deposition, plasma spraying, physical vapor deposition, plasma immersion ion implantation, laser surface treatment, and hybrid (composite) approaches. For each method, key operational principles, structural and functional characteristics, performance advantages and limitations, and representative application domains are critically analyzed. Across these routes, biological performance depends on coating continuity, pore or nanotube geometry, interfacial bonding, phase composition and ion release. Calcium- and phosphorus-rich oxides and hydroxyapatite deposits generally promote cell adhesion, proliferation, alkaline phosphatase activity, mineralization and osteogenic differentiation. Dense oxide, nitride, tantalum and carbon-based films strengthen corrosion barriers, whereas Mn, Zn, Cu and Ag containing surfaces can inhibit bacterial adhesion and biofilm formation. Excessive ion release, however, may compromise cytocompatibility. Reported outcomes also vary with test medium, exposure time, bacterial strain and cell model. Standardized quantitative endpoints and longer-term corrosion, biofilm and osseointegration studies are required to guide clinically reliable multifunctional coatings. Full article

Ischemic heart disease is currently diagnosed mainly through cardiac computed tomography (CT) angiography and functional testing, both of which detect only advanced arterial macrocalcification, at a stage when treatment can merely slow disease progression rather than reverse it. Yet, macrocalcification represents the end product of a much earlier molecular process, which is microcalcification. This process is driven by smooth muscle cell and macrophage apoptosis, matrix vesicle release, and osteogenic phenotypic transitions within the arterial intima, occurring years to decades before mineral deposits become visible on CT. [¹⁸F]Sodium fluoride (NaF) positron emission tomography (PET) exploits fluoride binding at accessible hydroxyapatite surfaces to detect increased tracer uptake associated with active mineral deposition, including mineralization occurring at a microscopic scale below the direct spatial resolution of clinical PET. Studies demonstrate that anti-atherosclerotic interventions, including statins, and tissue-nonspecific alkaline phosphatase inhibition can suppress NaF uptake even when CT-based calcium scores remain unchanged or continue to rise, a dissociation now also observed in human trials of statins and PCSK9 inhibitors. This review traces the cellular and histological basis of arterial calcification, outlines the principles and limitations of NaF-PET imaging, and evaluates its emerging role—supported by artificial intelligence-based quantification—as a tool for monitoring targeted anti-atherosclerotic treatment. Full article

Extracellular vesicles (EVs) derived from osteoblasts are emerging as key regulators of bone formation, yet functional differences between vesicles from distinct extracellular compartments remain unclear. In this study, we compared media-derived extracellular vesicles (MEs) and matrix-bound extracellular vesicle-enriched fractions (MBEs) isolated from mineralized osteoblasts (MOBs) and evaluated their effects on human bone marrow-derived mesenchymal stromal cells (hBMSCs). Both preparations, characterized by nanoparticle tracking analysis and transmission electron microscopy, displayed similar size distributions (30–200 nm) and concentrations. Moreover, both preparations showed enrichment of the EV-associated marker CD63, with no detectable GAPDH and only minimal Grp94 signals in a subset of samples. mRNA profiling revealed that MBE-enriched fractions were selectively enriched in RUNX2, whereas other osteogenesis-related transcripts were comparable between them. Functional analyses demonstrated that both EV populations promoted osteogenic differentiation of hBMSCs, although with distinct biological profiles. MBE-enriched fractions were associated with higher alkaline phosphatase activity under control conditions, whereas MEs induced greater osteocalcin expression and showed a numerical tendency toward increased matrix mineralization, particularly under osteogenic conditions. These findings suggest that extracellular vesicles associated with different extracellular compartments exhibit distinct osteogenic activities rather than a uniform biological effect. Although the matrix-bound preparation likely contains extracellular matrix-associated components co-isolated during the extraction procedure, the present study highlights the importance of extracellular compartmentalization in shaping EV-associated bioactivity and provides a foundation for future studies aimed at optimizing EV-based strategies for bone regeneration. Full article

Bone loss represents a significant clinical burden that has driven the development of improved orthopedic graft substitutes. Although current grafting options, including autografts, allografts, and xenografts, have demonstrated considerable therapeutic potential, their widespread application is constrained by limitations such as donor scarcity, limited availability, and associated clinical risks. Consequently, biologically derived materials, including avian eggshells and marine bivalve shells, have emerged as promising alternative sources to produce bone precursor materials and next-generation bone graft substitutes. This review summarizes recent advances in avian eggshell- and marine shell-derived calcium carbonate (CaCO₃) materials for bone regeneration and examines their preclinical evaluation in diverse animal models, including critical-size defects in calvarial, femoral, radial and mandibular bone. Relevant studies published over the past ten years were systematically analyzed, focusing on natural calcium carbonate systems derived from avian eggshell and marine shells, including oyster, mussel, clam, scallop, cockle, and sea urchins. A structured literature search was conducted using PubMed, Scopus, and Google Scholar to identify studies published between 2015 and 2025 investigating eggshell- and aquatic-derived biomaterials for bone repair and regeneration. Eligible studies were screened, and data were comparatively analyzed with respect to biomaterial source, scaffold fabrication, physicochemical characteristics, mechanical performance, biocompatibility, osteogenic potential, and the use of preclinical animal studies. Eggshell-derived biomaterials currently show the strongest translational evidence, while aquatic shell-derived biomaterials remain promising but underexplored for bone regeneration. Furthermore, this review critically examines the scientific, manufacturing, and regulatory challenges that must be addressed before clinical implementation. Full article

Bone-resident macrophages are increasingly recognized as regulators of bone metabolism, yet their contribution to primary human osteoblast cultures remains poorly understood. We investigated the functional relevance of CD14-positive cells in primary human osteoblast cultures obtained using two isolation methods. CD14-positive cells were depleted by magnetic-activated cell sorting, and non-depleted and depleted cultures were compared regarding cell viability, matrix mineralization, osteogenic and macrophage-associated marker expression, and responses to IL-1β, IL-6, and TNF-α. CD14 depletion reduced cell viability under growth conditions and significantly impaired matrix mineralization in cultures obtained with both isolation protocols. Depletion markedly decreased CD14 and other monocyte/macrophage-associated markers, while the osteogenic cell population was largely preserved, although marker-specific changes suggested altered osteoblast maturation. Despite reduced basal mineralization, IL-1β and TNF-α significantly enhanced mineralization in both non-depleted and CD14-depleted cultures, whereas IL-6 had no significant effect. These findings indicate that CD14-positive cells support basal osteoblast viability, maturation, and mineralization but are not required for the mineralization-promoting effects of IL-1β and TNF-α. Primary human osteoblast cultures should therefore be considered multicellular systems in which macrophage-like cells contribute substantially to basal osteogenic function. Full article

The addition of hydroxyapatite (HAP) to electrospun poly-L-lactide (PLLA) scaffolds promotes cell adhesion and differentiation but generally leads to a significant deterioration in mechanical properties due to particle agglomeration. Moreover, the encapsulation of HAP particles within a polymer layer makes them inaccessible to body fluids and cells, thereby limiting the bioactivity of the resulting composite scaffold. In this work, HAP microparticles with median size of 26.3 µm were used to obtain exposed HAP particles on the surface of electrospun PLLA fibers. SEM images and EDX maps revealed that individual particles, particularly the larger ones, were exposed from the polymer scaffold surface. The addition of HAP particles significantly altered the scaffold morphology and structure, increasing the fiber diameter and surface roughness by 2.8–4.1-fold, promoting the formation of fused fiber junctions, and inducing the appearance of semicrystalline PLLA domains. These structural changes significantly improved the mechanical properties of the scaffolds. Specifically, the tensile strength and Young’s modulus of the prepared scaffolds are increased by 2.3–3.8-fold following HAP incorporation. Compared with neat PLLA scaffolds, HAP-containing scaffolds exhibited 1.2–1.4-fold higher osteocalcin and osteopontin expression by human adipose-derived mesenchymal stromal cells (hADSCs). Compared to tissue culture plastic, the expressions of osteocalcin and osteopontin on the composite scaffolds were 7.1–7.9-fold and 2.8–3.0-fold higher, respectively. Full article

Prolonged skeletal muscle disuse, such as extended inactivity and mechanical unloading, typically elicits severe muscle atrophy and progressive bone loss, yet hibernating mammals evade this pathological cascade via poorly defined adaptive mechanisms. Using the Daurian ground squirrel (Spermophilus dauricus) as a unique natural model of prolonged torpor, we demonstrate that skeletal muscle-derived small extracellular vesicles (Mu-EVs) orchestrate protective muscle–bone crosstalk to maintain bone homeostasis during extended disuse. Morphological and microstructural analyses revealed no significant deficits in skeletal muscle and tibial bone between pre-hibernation (PRE) and torpor (TOR) states. Compared with PRE-Mu-EVs, TOR-Mu-EVs significantly enhanced osteogenic differentiation in MC3T3-E1 osteoblasts, markedly upregulating mRNA expression of the key osteogenic markers OCN and COL1A1 (p < 0.05, p < 0.01). Small RNA sequencing identified a novel unannotated miRNA (mature sequence: GCAGCAGCCCGGCTCTCCTAAT) sharply downregulated in TOR-Mu-EVs (p < 0.01); this miRNA exhibits binding potential toward the transcript of Bmp7, a pivotal regulator of osteogenesis. In vitro functional assays confirmed that this miRNA suppresses osteoblast maturation; in a mouse hindlimb unloading (HLU) disuse osteoporosis model, miRNA antagomir partially alleviated bone loss, boosting Masson staining area by 27.13% (p < 0.05) and bone volume fraction by 15.01% (n = 5, 0.05 < p < 0.1, Cohen’s d = 0.71, 95% CI [−0.16, 1.38]). Collectively, hibernating Mu-EVs mitigate this BMP7-inhibiting miRNA to sustain osteogenic activity, hinting at a conserved regulatory cascade that could offer tentative translational clues for managing disuse osteoporosis. Full article

Vascular calcification (VC) is a major complication of chronic kidney disease (CKD) that is strongly associated with cardiovascular mortality. While indoxyl sulfate (IS), a protein-bound uremic toxin, has been implicated in the progression of VC, the underlying molecular mechanisms remain unclear. We investigated the procalcific effects of IS using a two-step nephrectomy-induced CKD mouse model and cultured vascular smooth muscle cells. In vivo, progressive renal impairment was associated with elevated circulating IS levels and enhanced VC. In vitro, IS dose- and time-dependently induced calcium deposition, increased reactive oxygen species (ROS) production, and upregulated osteogenic markers, including runt-related transcription factor 2 (RUNX2), bone morphogenetic protein 2 (BMP2), and osteocalcin (OCN), whereas N-acetyl-L-cysteine (NAC) partially attenuated IS-induced ROS accumulation and cell injury. Mechanistically, IS exposure activated extracellular signal-regulated kinase (ERK) and Wnt/β-catenin signaling while suppressing nuclear factor erythroid 2-related factor 2 (Nrf2)-related antioxidant responses, as reflected by reductions in the phosphorylated Nrf2 (pNrf2) to total Nrf2 and heme oxygenase-1 (HO-1) expression. Pharmacological inhibition of ERK and Wnt/β-catenin signaling attenuated IS-induced osteogenic responses. These findings indicate that IS promotes VC in association with increased oxidative stress, activation of ERK and Wnt/β-catenin signaling, and impaired Nrf2-related antioxidant defense. These integrated findings provide mechanistic insight into IS-associated VC and highlight oxidative stress-related signaling networks as potential therapeutic targets in CKD. Full article

Biodegradable magnesium (Mg)-based implants represent a paradigm shift in orthopedic biomaterials, offering temporary mechanical support, inherent osteogenic bioactivity, and elimination of hardware removal surgery. These properties are particularly attractive for sports orthopedic applications, including anterior cruciate ligament (ACL) reconstruction, rotator cuff repair, meniscal fixation, and osteochondral fragment refixation, where young, active patients demand rapid return to function and where permanent metallic hardware poses long-term risks of stress shielding, imaging artifact, and reoperation. Despite extensive preclinical evidence demonstrating that Mg-based interference screws promote fibrocartilaginous enthesis regeneration, attenuate peri-tunnel bone loss, and achieve biomechanical fixation comparable to titanium, no human clinical trial has yet evaluated Mg fixation devices for soft-tissue reconstruction in sports medicine. Meanwhile, clinical fracture fixation data from over 468 patients across multiple trials and a meta-analysis confirm complication rates equivalent to those of titanium. This narrative review synthesizes the current evidence on Mg alloy design, surface engineering strategies, preclinical sports medicine applications, clinical translation in fracture fixation, imaging compatibility, and the remaining barriers to clinical adoption in sports orthopedic surgery. By mapping the translational gap between promising animal data and the absence of clinical sports medicine trials, this review aims to guide future research priorities and accelerate the pathway toward clinical application of Mg-based devices in sports orthopedics. Full article

Bacterial colonization and biofilm formation on orthopedic and dental implants remain major clinical complications, while conventional systemic antibiotics are often limited by poor penetration into biofilms and infected bone. These limitations have motivated the development of biomaterials with intrinsic antibacterial activity. Hydroxyapatite (HA), a major inorganic component of bone and teeth, possesses excellent biocompatibility, osteoconductivity, and bone-bonding ability but exhibits limited inherent antibacterial activity. Incorporation of therapeutic metal ions, including Ag⁺, Cu²⁺, Zn²⁺, Ti⁴⁺, Co²⁺, Ga³⁺, Sr²⁺, and Ce³⁺, has therefore emerged as a promising strategy for developing multifunctional HA-based biomaterials. This review critically examines the crystal-chemical basis of metal-ion incorporation into HA and discusses how ionic radius, oxidation state, charge-compensation mechanisms, dopant concentration, and synthesis conditions influence lattice occupancy, physicochemical properties, and biological performance. The antibacterial activity of metal-substituted and metal-modified HA systems generally involves interconnected mechanisms, including bacterial membrane damage, intracellular metabolic disruption, interference with enzymes and nucleic acids, reactive oxygen species (ROS)-mediated oxidative stress, and inhibition of bacterial adhesion and biofilm formation. Ag-, Cu-, Zn-, and Ga-containing HA systems show the most consistently reported antibacterial effects, although their efficacy and cytocompatibility depend strongly on dopant concentration and ion-release kinetics. Co-substituted HA may combine antibacterial activity with angiogenic and osteogenic stimulation, whereas Sr-substituted HA is primarily osteogenic and anti-resorptive, with variable antibacterial performance. Ti-modified HA and TiO₂/HA composites exhibit predominantly photoactive antibacterial behavior, while Ce-substituted HA shows concentration-, oxidation-state-, and synthesis-dependent biological effects. The review also evaluates protein adsorption, osteogenic and angiogenic signaling, macrophage-mediated immunomodulation, biological safety, and representative commercial and translational applications. Overall, metal-substituted HA represents a versatile platform for infection-resistant and regenerative hard-tissue biomaterials, provided that composition, phase structure, ion release, antibacterial efficacy, and cytocompatibility are systematically co-optimized before clinical translation. Full article