Search Results (910)

Impaired bone formation and extracellular matrix mineralization contribute to the progressive loss of bone quality associated with aging and skeletal disorders. In this context, the growing interest in sustainable bioactive ingredients for health-related and nutraceutical applications has drawn attention to grape pomace, a phenol-rich byproduct of winemaking. This study investigated the chemical composition and osteogenic potential of Nerello Mascalese pomace extract (NMPE), evaluating its effects on key processes involved in human osteoblast differentiation, extracellular matrix maturation, and mineralized matrix formation. NMPE was chemically characterized by means of liquid chromatographic techniques, revealing a phenolic-rich profile dominated by anthocyanins. The osteogenic effects of NMPE were evaluated by analyzing extracellular matrix mineralization through Alizarin Red S staining, alkaline phosphatase (ALP) enzymatic activity, and the expression of genes involved in osteoblast differentiation and matrix mineralization by quantitative real-time PCR. NMPE promoted osteoblast differentiation and extracellular matrix mineralization, together with coordinated changes in the expression of osteogenesis- and matrix-associated genes. These findings identify Nerello Mascalese pomace as a promising source of bioactive compounds capable of supporting bone-forming processes and strengthen its potential for sustainable valorization in bone-health applications. Full article

Background: Osteoporosis is a multifactorial skeletal disorder characterized by reduced bone mass, impaired bone remodeling, and an increased risk of fractures, particularly under estrogen-deficient conditions. Artocarpus integer (Thunb.) Merr. contains prenylated flavonoids and chalcone derivatives with diverse biological activities; however, its anti-osteoporotic potential remains largely unexplored. This study investigated the phytochemical composition, molecular mechanisms, and anti-osteoporotic effects of A. integer leaf extract in an ovariectomized (OVX) rat model. Methods: Phytochemical profiling was performed using liquid chromatography–high-resolution mass spectrometry (LC–HRMS). Network pharmacology was employed to identify potential osteoporosis-related targets and signaling pathways. The anti-osteoporotic activity of the extract was evaluated in OVX rats through physiological and biochemical assessments, including body weight gain, uterine weight, serum biomarkers, femoral calcium content, and RT-PCR analysis of genes associated with osteogenesis, osteoclastogenesis, and estrogen signaling. Results: LC–HRMS analysis identified several bioactive compounds, including isobavachalcone, artocarpesin, morachalcone A, genistein, apigenin, luteolin, naringenin, catechin derivatives, and mangiferin. Network pharmacology revealed 96 overlapping targets between A. integer phytochemicals and osteoporosis-related genes, highlighting pathways involved in estrogen signaling, PI3K–Akt signaling, osteoclast differentiation, inflammation, and metabolic regulation. In vivo, OVX rats exhibited increased body weight gain, uterine atrophy, elevated leptin levels, reduced adiponectin concentrations, and decreased femoral calcium content. Treatment with A. integer attenuated OVX-induced metabolic alterations, improved adipokine profiles, and increased femoral calcium content, particularly in the medium-dose group. RT-PCR analysis demonstrated the upregulation of the osteogenic markers Runx2 and Osx, together with the downregulation of the osteoclastogenic markers TRAP. Conclusions: Artocarpus integer leaf extract exhibited promising anti-osteoporotic activity through the coordinated regulation of osteogenesis, osteoclastogenesis, estrogen-related signaling, and bone mineral preservation. These findings support the potential development of A. integer as a nutraceutical candidate for the prevention or management of postmenopausal osteoporosis. Full article

Crustacean shell waste from the seafood industry represents an underutilized food waste with the potential to produce chitosan and chitosan oligosaccharides (COS), with promising applications in bone regeneration. However, the molecular mechanisms of COS during osteogenic differentiation remain uncharacterized. In this study, chitosan was extracted from mud crab (Scylla olivacea) shell waste and COS was prepared from chitosan by acid hydrolysis and then characterized by FT-IR and FESEM, confirming the chitosan backbone and a degree of deacetylation (DD) exceeding 80%. The COS treatment in the concentration range of 5–320 µg/mL significantly enhanced MC3T3-E1 pre-osteoblast proliferation without cytotoxicity, and it increased alkaline phosphatase (ALP) activity, extracellular matrix mineralization, and Runx2/osterix (OSX) expression. Transcriptomics of pre-osteoblasts treated with COS at 320 µg/mL for 21 days identified 19,643 differentially expressed genes, revealing coordinated activation of multiple osteogenesis-related signaling pathways, including ECM–integrin/focal adhesion, PI3K-Akt/MAPK, TGF-β/BMP, Wnt/β-catenin, and parathyroid hormone (PTH) synthesis. These findings demonstrate that marine-derived COS promotes osteoblast differentiation through the coordinated activation of multiple signaling pathways, providing the first comprehensive transcriptomic characterization of MC3T3-E1 pre-osteoblast directly treated with COS during osteogenic differentiation. Therefore, this study supports the use of COS as a promising bioactive oligosaccharide for bone regeneration and osteoporosis management, and further in vivo and clinical studies are recommended. Full article

Objectives: Critical-sized bone defects continue to represent a substantial challenge in orthopedic clinical practice. Decellularized bone matrix (DBM) possesses favorable osteoconductive properties due to its retention of native extracellular matrix architecture and collagen components. However, its limited osteogenic bioactivity restricts its application in complex bone defect repair. This study aimed to construct a dendritic mesoporous silica (DMSN)-modified DBM composite scaffold loaded with teriparatide (DBM-DMSN@TPTD) and to systematically evaluate its physicochemical properties, drug release behavior, biocompatibility, and osteogenic differentiation-promoting capacity. Methods: A DBM scaffold was prepared from bovine femoral cancellous bone via a combined freeze–thaw and chemical detergent decellularization method. DMSNs were synthesized through a sol–gel method, amine-functionalized with APTES, and covalently grafted onto the DBM surface via EDC/NHS crosslinking. Teriparatide was loaded onto the composite scaffolds at three concentrations (1, 10, and 100 nmol/L). The scaffolds were characterized via SEM, TEM, BET, EDS and XPS. Decellularization efficacy was assessed by DAPI staining and nucleic acid quantification. Drug release behavior was evaluated through in vitro release studies, while biocompatibility and osteogenic differentiation of rat BMSCs were examined using Live/Dead staining, phalloidin/DAPI cytoskeletal staining, CCK-8 assays, ALP staining, and RUNX2/OCN immunofluorescence. Results: DMSNs demonstrated a dendritic mesoporous architecture, featuring a specific surface area of 390.44 ± 1.78 m²/g and pore diameters within the range of 15–20 nm. DBM showed effective removal of immunogenicity, with well-preserved collagen architecture. Drug release displayed a biphasic pattern, with 56.03% released within the first 72 h and 83.23% by day 16. None of the tested scaffolds showed obvious cytotoxicity under the experimental conditions. The DBM-DMSN@TPTD-M group (10 nmol/L) produced the strongest effects on BMSC proliferation and osteogenic differentiation, as indicated by the highest ALP activity and elevated RUNX2 and OCN expression (p < 0.05). Conclusions: The DBM-DMSN@TPTD scaffold offers a native bone microenvironment, sustained drug release, and osteogenic activity in vitro. These features may support BMSC proliferation and osteogenic differentiation. Accordingly, this scaffold warrants further investigation as a potential strategy for bone defect repair. Full article

Adult hematopoietic stem cells (HSCs) and bone marrow (BM) mesenchymal stem/stromal cells (MSCs) are essential for lifelong hematopoiesis, skeletal homeostasis, immune competence, and tissue regeneration. The use of electronic cigarettes (E-cigs) among women of reproductive age continues to rise, raising concerns about potential adverse developmental effects; however, the long-term consequences of maternal E-cig vaping on offspring BM stem cell function and hematopoietic homeostasis remain incompletely understood. Here, using a rat model of maternal E-cig exposure (containing nicotine) during gestation, combined with longitudinal in vivo analyses and complementary ex vivo studies of human cells, we show that prenatal E-cig exposure is associated with persistent alterations in offspring BM stem cell function and lineage commitment. Gestational E-cig exposure was associated with expansion of the CD11b/c⁺ myeloid-enriched compartment, increased CD90⁺ stromal cells, and impaired osteogenic differentiation in rat offspring. Complementary experiments using primary human cells showed that nicotine exposure was associated with reduced T-cell proliferation and impaired cytotoxic activity in a proof-of-principle co-culture assay. Mechanistically, transcriptomic profiling followed by Gene Ontology and pathway enrichment analyses identified alterations in molecular programs associated with KLF4–Notch1 signaling, mitochondrial biogenesis, inflammation, and stem cell regulation in the BM of E-cig-exposed rat offspring. Changes in CCL11, FTO, and RUNX2 were additionally associated with an inflammatory and aging-related molecular phenotype that persisted from early life into adulthood, although these findings do not establish a causal CCL11–FTO–RUNX2 signaling axis or direct cellular senescence. Collectively, our study provides a phenotypic and mechanistic framework for understanding how maternal E-cig exposure may influence long-term offspring hematopoietic, skeletal, and immune health while highlighting the need for further studies to establish causal molecular mechanisms and determine their relevance to maternal E-cig use in humans. Full article

Periodontal and alveolar bone regeneration requires coordinated angiogenic and osteogenic responses supported by biomimetic scaffolds. This study compared three-dimensional bioprinted hydroxyapatite–acrylated palm olein (3D-HA–APO) scaffold formulations containing 5%, 7% and 10% (w/v) hydroxyapatite (HA), designated F1, F2 and F3, respectively. Human umbilical vein endothelial cells were cultured on the scaffolds, and background-corrected soluble vascular endothelial growth factor (VEGF) concentrations in culture supernatants were quantified by enzyme-linked immunosorbent assay (ELISA). Angiogenic-related responses of human periodontal ligament stem cells were assessed by VEGF and cluster of differentiation 31 (CD31) immunofluorescence after endothelial induction, while alkaline phosphatase (ALP) activity in construct lysates was used as an indicator of early osteogenic activity. Soluble VEGF concentrations increased from F1 to F3, with significant differences between all formulations. VEGF-associated signal proportions differed among formulations, with F3 significantly higher than F1. CD31-associated signal proportions increased progressively from F1 to F3, with significant differences between all formulation pairs. ALP activity increased over time in all scaffold groups, and F3 generally showed the highest activity from Day 4 onwards. Overall, F3 showed the most favourable formulation-level profile across the selected angiogenic-related and early osteogenic outcomes. Full article

Polyphosphate (PolyP) is an inorganic polymer composed of orthophosphate units linked by high-energy phosphate anhydride bonds, widely found in various organisms from bacteria to mammals. In recent years, PolyP has attracted widespread attention in the field of bone tissue engineering due to its unique biological characteristics, possessing both osteoinductive activity and metabolic energy supply functions. This article systematically reviews the molecular structure, physicochemical properties, and multiple mechanisms by which PolyP promotes osteogenic differentiation, as well as biomaterial design strategies based on PolyP. PolyP can synergistically promote osteogenic differentiation through multiple mechanisms, including by acting as a phosphate donor, providing metabolic energy, regulating signaling pathways such as Wnt/β-catenin, and modulating the osteoprotegerin/receptor activator of nuclear factor κB ligand (OPG/RANKL) balance. In terms of material design, PolyP can form nano/microparticles with metal ions such as Ca²⁺, Sr²⁺, and Mg²⁺ and can also be compounded with polymers to construct various forms such as hydrogels, bone cement, and three-dimensional (3D)-printed scaffolds. Preclinical studies have shown that PolyP-incorporated materials exhibit excellent osteogenic performance and biocompatibility in bone defect repair, and preliminary clinical studies have also confirmed its feasibility. This article aims to provide a comprehensive overview of the current applications of PolyP-incorporated materials and delineate future directions, challenges, and necessary pathways for their clinical translation. Full article

Mesenchymal stem/stromal cells (MSCs) are promising candidates in regenerative medicine, but their effectiveness is significantly influenced by the surrounding metabolic and nutritional conditions. Increasing evidence suggests that lipids act not only as energy sources but also as regulators of MSC fate. This review explores how lipid metabolism influences the balance among stemness, immunomodulation, and differentiation into adipogenic or osteogenic lineages. It does so through mechanisms such as fatty acid uptake, β-oxidation, de novo lipogenesis, and membrane remodeling, all orchestrated by CD36, carnitine palmitoyltransferase 1A, PPARγ, AMP-activated protein kinase, and the PI3K/AKT/mTOR pathway. We then examine how diet reshapes the MSC lipidome: obesity and high-fat diets promote adipogenesis and senescence, while omega-3 fatty acids, caloric restriction, micronutrients, and a balanced microbiota help preserve regenerative capacity. Lastly, we discuss how combining lipidomics with multi-omics could uncover lipid-metabolic signatures and regulatory nodes that connect diet to MSC function. Overall, the diet–lipid–MSC axis emerges as a modifiable determinant of MSC function. Full article

Titanium alloys are widely used for implants, yet corrosion, bacterial colonization and incomplete osseointegration remain important causes of interfacial failure. This review critically analyzes major biomedical functional coating fabrication techniques employed to enhance the surface properties of titanium alloys, including micro-arc oxidation, anodic oxidation, magnetron sputtering, electrochemical deposition, electrophoretic deposition, plasma spraying, physical vapor deposition, plasma immersion ion implantation, laser surface treatment, and hybrid (composite) approaches. For each method, key operational principles, structural and functional characteristics, performance advantages and limitations, and representative application domains are critically analyzed. Across these routes, biological performance depends on coating continuity, pore or nanotube geometry, interfacial bonding, phase composition and ion release. Calcium- and phosphorus-rich oxides and hydroxyapatite deposits generally promote cell adhesion, proliferation, alkaline phosphatase activity, mineralization and osteogenic differentiation. Dense oxide, nitride, tantalum and carbon-based films strengthen corrosion barriers, whereas Mn, Zn, Cu and Ag containing surfaces can inhibit bacterial adhesion and biofilm formation. Excessive ion release, however, may compromise cytocompatibility. Reported outcomes also vary with test medium, exposure time, bacterial strain and cell model. Standardized quantitative endpoints and longer-term corrosion, biofilm and osseointegration studies are required to guide clinically reliable multifunctional coatings. Full article

Extracellular vesicles (EVs) derived from osteoblasts are emerging as key regulators of bone formation, yet functional differences between vesicles from distinct extracellular compartments remain unclear. In this study, we compared media-derived extracellular vesicles (MEs) and matrix-bound extracellular vesicle-enriched fractions (MBEs) isolated from mineralized osteoblasts (MOBs) and evaluated their effects on human bone marrow-derived mesenchymal stromal cells (hBMSCs). Both preparations, characterized by nanoparticle tracking analysis and transmission electron microscopy, displayed similar size distributions (30–200 nm) and concentrations. Moreover, both preparations showed enrichment of the EV-associated marker CD63, with no detectable GAPDH and only minimal Grp94 signals in a subset of samples. mRNA profiling revealed that MBE-enriched fractions were selectively enriched in RUNX2, whereas other osteogenesis-related transcripts were comparable between them. Functional analyses demonstrated that both EV populations promoted osteogenic differentiation of hBMSCs, although with distinct biological profiles. MBE-enriched fractions were associated with higher alkaline phosphatase activity under control conditions, whereas MEs induced greater osteocalcin expression and showed a numerical tendency toward increased matrix mineralization, particularly under osteogenic conditions. These findings suggest that extracellular vesicles associated with different extracellular compartments exhibit distinct osteogenic activities rather than a uniform biological effect. Although the matrix-bound preparation likely contains extracellular matrix-associated components co-isolated during the extraction procedure, the present study highlights the importance of extracellular compartmentalization in shaping EV-associated bioactivity and provides a foundation for future studies aimed at optimizing EV-based strategies for bone regeneration. Full article

Prolonged skeletal muscle disuse, such as extended inactivity and mechanical unloading, typically elicits severe muscle atrophy and progressive bone loss, yet hibernating mammals evade this pathological cascade via poorly defined adaptive mechanisms. Using the Daurian ground squirrel (Spermophilus dauricus) as a unique natural model of prolonged torpor, we demonstrate that skeletal muscle-derived small extracellular vesicles (Mu-EVs) orchestrate protective muscle–bone crosstalk to maintain bone homeostasis during extended disuse. Morphological and microstructural analyses revealed no significant deficits in skeletal muscle and tibial bone between pre-hibernation (PRE) and torpor (TOR) states. Compared with PRE-Mu-EVs, TOR-Mu-EVs significantly enhanced osteogenic differentiation in MC3T3-E1 osteoblasts, markedly upregulating mRNA expression of the key osteogenic markers OCN and COL1A1 (p < 0.05, p < 0.01). Small RNA sequencing identified a novel unannotated miRNA (mature sequence: GCAGCAGCCCGGCTCTCCTAAT) sharply downregulated in TOR-Mu-EVs (p < 0.01); this miRNA exhibits binding potential toward the transcript of Bmp7, a pivotal regulator of osteogenesis. In vitro functional assays confirmed that this miRNA suppresses osteoblast maturation; in a mouse hindlimb unloading (HLU) disuse osteoporosis model, miRNA antagomir partially alleviated bone loss, boosting Masson staining area by 27.13% (p < 0.05) and bone volume fraction by 15.01% (n = 5, 0.05 < p < 0.1, Cohen’s d = 0.71, 95% CI [−0.16, 1.38]). Collectively, hibernating Mu-EVs mitigate this BMP7-inhibiting miRNA to sustain osteogenic activity, hinting at a conserved regulatory cascade that could offer tentative translational clues for managing disuse osteoporosis. Full article

Fracture healing depends on coordinated osteogenesis and restoration of the vascular microenvironment. Endothelial cells support skeletal repair through angiogenesis, tissue perfusion and angiocrine signaling that regulates osteoprogenitor recruitment and differentiation. This narrative review examines endothelial dysfunction (ED) as a potential systemic contributor to impaired fracture healing by integrating evidence from vascular biology, experimental models and clinical studies. ED is characterized by reduced nitric oxide (NO) bioavailability, oxidative stress, inflammation and impaired vascular repair. These changes may disrupt angiogenic–osteogenic coupling through altered hypoxia-inducible factor 1-alpha subunit (HIF-1α)/vascular endothelial growth factor (VEGF) signaling, endothelial Notch activity, platelet-derived growth factor (PDGF)-mediated vascular remodeling and endothelial progenitor cell (EPC) mobilization. Conditions associated with endothelial dysfunction, including diabetes, aging, chronic kidney disease (CKD), smoking, obesity and chronic inflammatory disease, are also linked to delayed union, nonunion and poorer orthopedic outcomes. Cardiovascular disease and perioperative cardiovascular instability may further impair perfusion and physiological reserve during repair. However, the available evidence is predominantly experimental or observational, and direct causal evidence in fracture patients remains limited. Prospective studies combining standardized endothelial assessments with fracture-healing outcomes are needed to clarify clinical relevance and identify potential therapeutic targets. Full article

The BMP2-Smad signaling pathway serves as a central regulator of osteoblast differentiation and bone formation, rendering it a promising target for the discovery of osteogenic agents from natural sources. Nonetheless, direct BMP2-binding ligands derived from complex herbal extracts remain poorly characterized. In the present study, surface plasmon resonance (SPR)-based target fishing against BMP2, in conjunction with UPLC-Q-TOF-MS identification, was employed to screen for bioactive ligands from Periploca forrestii, a traditional Miao medicinal plant used for bone-related conditions. Six caffeoylquinic acid derivatives, namely neochlorogenic acid (NCA), 3-O-caffeoyl-4-O-sinapoylquinic acid, chlorogenic acid (CA), cryptochlorogenic acid (CCA), isochlorogenic acid B (IB), and isochlorogenic acid C (IC), were captured as direct BMP2-binding ligands. All six compounds promoted osteoblast differentiation and mineralization in MC3T3-E1 Subclone 14 cells, with IB displaying the strongest binding affinity and bioactivity. Mechanistically, IB failed to rescue the osteogenic suppression induced by the BMP type I receptor inhibitor LDN-193189, indicating its dependence on BMP signaling. In an LPS-induced inflammatory model, IB significantly reversed the downregulation of key proteins in the BMP2-Smad pathway (p-Smad1, Smad4, and Runx2) and osteogenic marker genes (Osterix, COL1A1, and OCN), demonstrating its capacity to restore osteogenic function under compromised conditions. Collectively, these findings establish that caffeoylquinic acid derivatives, particularly IB, function as BMP2-targeting osteogenic constituents of P. forrestii that activate BMP2-Smad signaling to promote osteoblast differentiation, thereby offering a pharmacological basis for the development of natural product-derived osteogenic agents. Full article

Background: Dental follicle cells (DFCs) are promising candidates for regenerative medicine due to their osteogenic potential. While the protein kinase C (PKC) inhibitor Gö6976 is known to enhance DFC differentiation, the underlying molecular mechanisms remain partially understood. Methods: A phosphoproteomic analysis of DFCs after 14 days of osteogenic induction was performed. Cells treated with osteogenic differentiation medium (ODM) were compared to those in control medium and ODM supplemented with Gö6976. Reactome pathway analysis identified the RhoGTPase signaling pathway as significantly regulated. This pathway was further validated using PCR arrays, Western blotting, and functional assays (ALP activity, Alizarin Red staining). The impact of RhoGTPase signaling was tested using inhibitors (NSC23766, Y27632, Rhosin) and the activator Geranylgeranyl pyrophosphate (GGPP). Results: Phosphoproteomic data highlighted RhoGTPase signaling as a regulatory node. While protein expression of RhoGTPases remained relatively stable, RhoA PCR arrays revealed significant transcriptional regulation after induction of osteogenic differentiation. However, functional inhibition via NSC, Y27632, or Rhosin did not significantly impair basal ODM-induced differentiation; however, Y27632 notably induced SOST expression. Conversely, activation of RhoGTPases via GGPP increased ALP activity and downregulated SOST, suggesting a supportive role of active Rho signaling during differentiation. Crucially, we demonstrated that Gö6976-enhanced mineralization is linked to the activation of RhoA and RhoB. This was confirmed by simvastatin-mediated regulation of Rho expression, which was fully reversed by simultaneous treatment with Gö6976. Furthermore, Rhosin effectively counteracted the pro-osteogenic effects of Gö6976 by inhibiting ALP activity and mineralization while inducing SOST, which is normally suppressed by Gö6976. Conclusions: These findings indicate that RhoGTPase signaling, particularly RhoA, is a critical downstream mediator required specifically for the Gö6976-enhanced osteogenic effect in DFCs. We conclude that Gö6976 exerts its stimulatory effect on mineralization by activating RhoGTPases and suppressing the osteogenesis inhibitor SOST, providing a context-dependent mechanism for accelerated differentiation rather than driving basal osteogenesis. Full article

Coronary artery calcification (CAC) is a hallmark of advanced atherosclerosis and a major determinant of procedural complexity during percutaneous coronary intervention (PCI). Once considered a passive consequence of vascular degeneration, CAC is now recognized as an active, highly regulated process driven by inflammation, oxidative stress, extracellular vesicle release, osteogenic differentiation of vascular smooth muscle cells, and biomechanical remodeling. These mechanisms generate a spectrum of calcific phenotypes, ranging from microcalcifications and sheet calcium to nodular calcium and calcified nodules. Calcified nodules represent an advanced fibrocalcific plaque phenotype characterized by fractured calcific plates, luminal calcium protrusion, surface disruption, and variable thrombus formation. They can be characterized using intravascular ultrasound (IVUS), optical coherence tomography (OCT), and hybrid near-infrared spectroscopy–IVUS imaging, and are associated with coronary thrombosis, stent underexpansion, restenosis, target lesion failure, and the need for advanced calcium-modification strategies. A structured literature search of PubMed/MEDLINE, Web of Science Core Collection, and Scopus identified 83 publications published between 2020 and 2026 for inclusion in the narrative synthesis. This narrative review summarizes the biological and biomechaniclam mechanisms of coronary calcification and calcified nodule formation, compares multimodality intravascular imaging criteria, and discusses contemporary imaging-guided PCI strategies, including balloon-based modification, rotational and orbital atherectomy, excimer laser coronary atherectomy, intravascular lithotripsy, and hybrid approaches. By integrating pathobiology, intravascular imaging criteria, and lesion-specific PCI strategies, this review provides a clinically oriented framework for the assessment and management of calcified nodules. Future directions include standardized imaging definitions, prospectively validated morphology-guided treatment algorithms, and computational and artificial intelligence-assisted plaque characterization. Full article