Search Results (14,686)

Background/Objectives: Pseudorabies virus (PRV) variant strains have caused widespread outbreaks in China since 2011, and currently available vaccines provide suboptimal protection. Glycoprotein D (gD), the principal target of virus-neutralizing antibodies, represents a promising antigen for subunit vaccine development. However, CHO cell-based production systems suitable for large-scale manufacturing remain insufficiently explored. This study aimed to develop a potentially scalable CHO cell-derived PRV gD subunit vaccine and evaluate its immunogenicity and protective efficacy in mice. Methods: A stable Chinese hamster ovary (CHO) suspension cell line secreting the extracellular domain of PRV gD was established through signal peptide optimization and stepwise serum-free adaptation. The recombinant gD protein was purified using Ni²⁺- Sepharose High-Performance affinity chromatography and subsequently formulated with MONTANIDE ISA 206 adjuvant. Immunogenicity and protective efficacy were assessed in BALB/c mice through serological analysis, neutralization assays, lethal challenge experiments, and quantitative PCR. Results: The gD subunit vaccine induced rapid seroconversion of gD-specific IgG antibodies as early as 7 days post immunization and exhibited a strong booster effect, maintaining high antibody levels. Neutralizing antibodies were first detected at 14 days and increased significantly after booster immunization, with titers markedly exceeding those induced by a commercial inactivated PRV vaccine at 42 days (p = 0.001). Following lethal challenge with 10⁴ TCID₅₀ of the highly virulent PRV-TJ variant strain, vaccinated mice achieved 100% survival without clinical signs. Viral genome copy numbers in the brain and spinal cord were reduced by approximately 3.3 to 4.4 log₁₀ relative to the PBS control group. Conclusions: The CHO cell-derived PRV gD subunit vaccine elicits robust humoral immune responses and provides complete protection against lethal PRV variant challenge in mice. These findings support its further evaluation in the natural swine host toward the development of a safe and scalable subunit vaccine for pseudorabies control. Full article

The growing volume of tourism in European mountain national parks has resulted in numerous conflicts between nature conservation and the expectations of various stakeholder groups. Exceeding ecological and social carrying capacities has led to an ongoing debate on implementing visitor limits and further restrictions, the effectiveness of which strongly depends on public understanding and acceptance. Therefore, the main aim of this study was to assess the level of knowledge regarding the general system of nature conservation, attitudes toward potential regulations, and their impact on conservation and tourism development across three stakeholder groups. A non-probability, purposive-convenience sampling strategy was utilized due to the specific characteristics of the surveyed stakeholder groups. The research was conducted using an online questionnaire distributed to tourists, mountain guides, and employees of the Babia Góra, Gorce, Pieniny, and Tatra National Parks, resulting in a total sample of 106 respondents. Statistical differences among the national parks employees (n = 24), mountain guides (n = 42) and tourists (n = 40) were analyzed using the Fisher–Freeman–Halton exact test due to violated Chi-square assumptions, supplemented by Cramér’s V for effect size. The study demonstrated that national park employees and mountain guides possessed significantly higher factual knowledge regarding biodiversity threats and zoning regulations compared to tourists. Significant differences among stakeholder groups were confirmed across multiple dimensions (p = 0.005 to 0.05), with Cramér’s V values indicating moderate relationships (V = 0.21 to 0.26). Conversely, national park employees and tourists expressed stronger support for expanding protected areas, whereas mountain guides more frequently associated new national parks with tourism restrictions. Moreover, the majority of respondents across all stakeholder groups agreed that: (i) nature protection is the main goal of national park establishment; (ii) educational activities are the most effective methods of protecting nature from tourism-related threats; (iii) leaving trails should be banned in all national parks, and (iv) seasonal limits on tourist entry should be obligatory in the most frequently visited parks. The lack of significant differences was confirmed by statistical test (p = 0.08–0.93). Considering the findings of this preliminary investigation, it is suggested that future research directions should include additional stakeholder groups and encompass a wider geographical area. Full article

Pityogenes chalcographus was monitored using pheromone traps installed in different forest types across Bosnia and Herzegovina. The study was conducted within protected areas of Sarajevo Canton, including the Protected Landscapes of Bijambare and Trebević and the Skakavac Natural Monument. The investigated forest types comprised secondary fir–spruce stands and mixed beech–fir forests with spruce admixture. Data were collected between 2018 and 2021 to assess the effects of forest type and climatic factors on pheromone-trap catches of P. chalcographus. Mean trap catches in secondary fir–spruce forests ranged from 2317.6 to 6317.0 individuals per trap, whereas catches in mixed beech–fir forests with spruce ranged from 150.0 to 6840.0 individuals per trap. The highest mean catches were recorded in the Trebević Protected Landscape and the Skakavac Natural Monument. Overall, trap catches tended to be higher in secondary fir–spruce forests than in mixed beech–fir forests with spruce. Statistically significant differences in mean catches between forest types were detected only in 2021, while no significant differences were observed during 2018–2020. No statistically significant relationships were found between climatic variables and P. chalcographus trap catches during the study period. Full article

Type 2 diabetes mellitus (T2DM) is a chronic metabolic disorder characterized by insulin resistance, pancreatic β-cell dysfunction, and dysregulated glucose and lipid metabolism. Sustained hyperglycemia and hyperlipidemia promote excessive reactive oxygen species (ROS) production, antioxidant defense depletion, and chronic low-grade inflammation, thereby aggravating insulin signaling impairment, β-cell injury, and diabetes-related complications. Although current glucose-lowering therapies have improved glycemic control, weight management, and cardiorenal outcomes, oxidative stress and inflammation remain incompletely addressed in many individuals with T2DM. Curcumin, a natural polyphenol derived from Curcuma longa L., exhibits antioxidant, anti-inflammatory, lipid-regulating, insulin-sensitizing, and tissue-protective activities. Evidence suggests that curcumin may alleviate T2DM-associated oxidative stress by suppressing ROS generation, reducing nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activity, modulating the advanced glycation end-product/receptor for advanced glycation end-product (AGE/RAGE) axis, activating nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2/ARE) signaling, preserving mitochondrial homeostasis, and protecting β-cells. It may also inhibit nuclear factor-κB (NF-κB) and mitogen-activated protein kinase/c-Jun N-terminal kinase (MAPK/JNK) signaling, decrease pro-inflammatory cytokines and C-reactive protein (CRP), improve metabolic tissue inflammation, and attenuate gut-derived inflammation by regulating gut microbiota and intestinal barrier function. However, current clinical evidence mainly supports modest improvements in metabolic, inflammatory, oxidative stress-related, and selected complication-related biomarkers rather than definitive disease-modifying outcomes. Moreover, formulation heterogeneity, low bioavailability, limited pharmacokinetic reporting, and insufficient long-term endpoint data remain major translational barriers. This review summarizes the molecular mechanisms, clinical evidence, formulation-dependent interpretation, safety considerations, and translational limitations of curcumin as a candidate adjunctive intervention for T2DM, rather than as a replacement for evidence-based antidiabetic therapy. Full article

Microalgae are a rich source of bioactive metabolites, including unsaturated fatty acids, chlorophylls, carotenoids, and phenolic compounds with antioxidant and nutraceutical potential. Salicylic acid (SA) and its volatile ester, methyl salicylate (MS), are well-known elicitors of secondary metabolism in higher plants, yet their mechanisms of action in green microalgae, particularly the effects of MS, remain poorly understood. Therefore, we evaluated how salicylates applied at concentrations of 0.1, 1, and 10 µM affect the growth and accumulation of bioactive compounds in a high-productivity clone of Planktochlorella nurekis, combining gas chromatography coupled mass spectrometry (GC-MS) fatty acid profiling with spectrophotometric determination of pigment levels, total phenols, and L-phenylalanine ammonia-lyase (PAL) activity. SA increased cell number and size, whereas 0.1 µM MS resulted in a six-fold gain in cell number. Accordingly, 10 µM MS raised chlorophyll b levels—nearly three-fold (from 76 to 211 µg per g D.W.)—and total carotenoids—roughly four-fold (129 to 520 µg per g D.W.)—while both elicitors significantly increased the monounsaturated fatty acid fraction (from 29% to about 40%). Notably, 10 µM SA lowered the levels of saturated fatty acids. Moreover, 10 µM MS doubled the PAL activity and increased the total phenols by 17% compared to the control. Thus, SA and MS act as effective elicitors of high-value metabolites in P. nurekis. Full article

Camellia oleifera leaf disease segmentation under natural field conditions is important for precision plant protection but remains challenging because lesions often show small target areas, blurred boundaries, uneven illumination, complex backgrounds, and coexisting symptoms. To address these problems, this paper proposes BFMambaNet, a Boundary-Frequency-guided Global Semantic Mamba Network for fine-grained disease segmentation. The model adopts an encoder-decoder framework and introduces a Global Semantic Mamba-based spatial selective feature modeling block to capture long-range lesion context and reduce semantic confusion. A gated wavelet spatial enhancement block is further designed to strengthen high-frequency boundary details while suppressing noisy responses. During training, boundary-frequency auxiliary supervision guides contour localization and pathological texture recovery without additional manual boundary labels. A reinforcement-learning-guided adaptive loss controller adjusts class-wise reweighting factors and loss-component weights according to the training state, improving optimization stability. A pixel-level dataset containing 1400 images and seven disease categories was constructed for evaluation. Experimental results show that BFMambaNet achieves 92.39% Precision, 91.43% Recall, 91.26% Dice, and 85.46% mIoU, outperforming representative CNN-based, Transformer-based, and Mamba-based models. Evaluations on environmental subsets confirm superior robustness, outperforming VMamba by 3.70% mIoU under uneven illumination, 3.55% mIoU under complex backgrounds, and 5.10% mIoU under coexisting symptoms. Cross-dataset validation on Apple leaf diseases further proves its generalization with 3.39% mIoU and 3.84% Dice improvements over U-Mamba, while maintaining a competitive inference speed of 30 FPS. Qualitative results also show clearer boundaries, fewer missed small lesions, and more stable predictions in complex field scenarios. Full article

Copper and its alloys are indispensable for electronics, communications, new energy systems, and aerospace engineering due to their exceptional electrical conductivity and mechanical properties. However, the thin cuprous oxide (Cu₂O) layer that naturally forms on copper and its alloys is prone to failure under elevated temperatures and high humidity, particularly in chloride-rich environments, leading to accelerated localized corrosion. While conventional chromate-based passivation has long been the industrial standard for preventing corrosion, its use has been increasingly restricted by global regulations (such as RoHS and REACH) due to its severe toxicity and health risks. To address the conflict between environmental compliance and protective performance, this review systematically evaluates recent advances in environmentally friendly, chromium-free anti-corrosion coatings in the present review. These alternative coatings are critically analyzed and categorized into four mechanistic groups: (i) inorganic conversion coatings (including molybdate, tungstate, rare earth, and phosphate systems); (ii) organic films formed via chemical or physical adsorption (such as organic inhibitors, thiol-based monolayers, and organosilane self-assembled films); (iii) conversion coatings engineered through covalent bonding, coordination chemistry, and microstructural tailoring; and (iv) multifunctional coatings that integrate self-healing capability with high electrical conductivity. Beyond providing a technical summary, this review explored how the swift progression of electronic information technology, new energy infrastructure, and robotics has imposed more exacting, multifunctional demands on copper components. This review provides a strategic roadmap for future research and prioritizes the creation of protection strategies that operate robustly in multi-physics coupling environments—integrating high conductivity, autonomous self-healing, and long-term chemical stability to ensure the reliability of next-generation infrastructure. Full article

Cloud-integrated sensor and Internet of Things (IoT) systems enable scalable data storage, processing, and intelligent monitoring, but their distributed nature exposes network-flow and host-level data to unauthorized access, tampering, and cyberattacks. This study proposes a Weighted Symmetric Hashed Blockchain (WSHB) framework that integrates mutual-information-based feature weighting, deep-learning-based attack classification, AES-256-GCM authenticated encryption, cryptographic hashing, and permissioned-ledger logging. The framework was evaluated independently using HIKARI-2021 for network-based intrusion detection and ADFA-LD for host-based intrusion detection. A transparent comparative evaluation was conducted against LSTM and CNN–RNN baselines using identical data splits, preprocessing settings, input representations, hyperparameter-search budget, and repeated initialization seeds. The proposed WSHB-DNN classifier achieved macro-F1 scores of $0.6837$ on HIKARI-2021 and $0.7914$ on ADFA-LD, showing the strongest overall classification performance among the evaluated models. The cryptographic and permissioned-ledger components provide confidentiality protection, record-level authentication, integrity verification, and tamper-evident logging for confirmed attack-event records. These results demonstrate the potential of WSHB as a reproducible framework for attack classification and secure event logging in cloud-integrated sensor environments. Full article

In the kinship-based social structure of traditional China, traditional villages often exhibit strong clan organizational characteristics, which are reflected in their spatial layouts and settlement forms. However, existing studies on traditional villages have paid limited systematic attention to clan culture as an endogenous form of social organization. Taking traditional villages in southern Shanxi as the research object, this study classifies traditional villages from the perspective of clan culture based on clan-related characteristics and analyzes the typical spatial structural features of different village types. On this basis, GIS techniques are used to examine their spatial distribution patterns and to compare the spatial differentiation of different village types in terms of elevation, slope, road accessibility, and proximity to water systems. The results show that, from the perspective of clan culture, traditional villages in southern Shanxi generally present an “east-dense and west-sparse” spatial distribution pattern. Different types of traditional villages show certain differences in spatial distribution and natural-locational conditions. The distribution pattern of Clan-Space-Dominated Villages is relatively consistent with the overall distribution of traditional villages in southern Shanxi; these villages are mostly located in areas with higher elevation, greater terrain relief, and relatively weaker road accessibility. Multi-Clan-Partitioned Villages show a multi-scale and multi-node clustering pattern and are more often distributed in areas with relatively better road connections and gentler terrain. Family–Courtyard-Dominated Villages present a pattern of “overall dispersion with local clustering” and are mostly distributed in hilly and gully-developed areas. All three types of villages show a certain degree of proximity to water systems. This study provides a macro-scale analytical perspective for understanding the spatial distribution of traditional villages in the context of clan culture. The findings may offer a theoretical reference for the protection and renewal of traditional villages and contribute to their integrated conservation and living inheritance. Full article

Climate change and rapid urbanisation increasingly threaten urban water security and grey infrastructure, calling for adaptive stormwater strategies to mitigate hydroclimatic extremes. This study evaluates the hydrologic performance of decentralised infiltration ponds functioning as natural/small water retention measures in the regional recharge zone of the Nyírség region, Debrecen, Hungary. Using a sensor-calibrated Hydrus-1D model, we simulated a no-intervention baseline against three pond sizes across historical and mid-century regional climate model projections. While the baseline scenario yielded negligible deep percolation across all scenarios, the smallest infiltration pond resulted in increased vertical moisture flux. The infiltration pond simulation improved ET/PET ratios and increased root zone saturation, improving urban vegetation health and evaporative cooling. All the pond designs attenuated and stored runoff without overspilling. Emission pathway sensitivity showed different responses driven by regional climate scenarios; temperature-driven evaporative offsets dominated under moderate warming, whereas extreme precipitation intensity increased infiltration gains under higher emissions. These findings support infiltration ponds as resilient, dual-purpose measures for mitigating regional water table decline while providing local flood protection under changing climate futures. Full article

Prolonged skeletal muscle disuse, such as extended inactivity and mechanical unloading, typically elicits severe muscle atrophy and progressive bone loss, yet hibernating mammals evade this pathological cascade via poorly defined adaptive mechanisms. Using the Daurian ground squirrel (Spermophilus dauricus) as a unique natural model of prolonged torpor, we demonstrate that skeletal muscle-derived small extracellular vesicles (Mu-EVs) orchestrate protective muscle–bone crosstalk to maintain bone homeostasis during extended disuse. Morphological and microstructural analyses revealed no significant deficits in skeletal muscle and tibial bone between pre-hibernation (PRE) and torpor (TOR) states. Compared with PRE-Mu-EVs, TOR-Mu-EVs significantly enhanced osteogenic differentiation in MC3T3-E1 osteoblasts, markedly upregulating mRNA expression of the key osteogenic markers OCN and COL1A1 (P < 0.05, P< 0.01). Small RNA sequencing identified a novel unannotated miRNA (mature sequence: GCAGCAGCCCGGCTCTCCTAAT) sharply downregulated in TOR-Mu-EVs (P < 0.01); this miRNA exhibits binding potential toward the transcript of Bmp7, a pivotal regulator of osteogenesis. In vitro functional assays confirmed that this miRNA suppresses osteoblast maturation; in a mouse hindlimb unloading (HLU) disuse osteoporosis model, miRNA antagomir partially alleviated bone loss, boosting Masson staining area by 27.13% (P < 0.05) and bone volume fraction by 15.01% (n=5, 0.05 < P < 0.1, Cohen’s d = 0.71, 95% CI [-0.16, 1.38]). Collectively, hibernating Mu-EVs mitigate this BMP7-inhibiting miRNA to sustain osteogenic activity, hinting at a conserved regulatory cascade that could offer tentative translational clues for managing disuse osteoporosis. Full article

This study investigates the efficacy of Reserpine (RZ), a natural indole alkaloid, that serves as a sustainable inhibitor of corrosion for OLC52 and aluminum in a 0.5/0.25 mol L⁻¹ acetic acid/potassium acetate solution, relevant to de-icing applications. The electrochemical methods used in this study included cyclic (CV) and linear sweep voltammetry (LSV), chronoamperometry (CA) and electrochemical impedance spectroscopy analysis (EIS), and allowed for the determination of the necessary parameters for the evaluation of the adsorption behavior. In addition to electrochemical studies, theoretical molecular modeling calculations were also carried out. The results indicate that RZ reduces the corrosion rate at the highest tested concentration of 10⁻³ M RZ, reaching inhibitory efficiencies of 90% for OLC52 and 94% for Al. The adsorption aspects have been described by the Langmuir and Freundlich isotherms, whose $∆G_{ads}^o$ resulting values suggest a physicochemical adsorption by forming a compact and protective layer. Molecular modeling demonstrates RZ’s ability to interact with metal surfaces taken into action through both donor–acceptor and electrostatic interactions, highlighting the potential of RZ as a green corrosion inhibitor in similar environments, usable in de-icing solution formulations. Full article

Hafnium oxide (HfO₂) has emerged as a promising charge trap layer (CTL) for nonvolatile memory devices; however, its long-term reliability remains challenging due to leakage current through grain boundary pathways and interface defect formation. Within plasma-enhanced atomic layer deposition (PEALD), direct plasma ALD (DPALD) forms crystalline HfO₂ with deeper trap sites, while its ion-assisted nature may contribute to interface damage, resulting in a lower net trap density than remote plasma ALD (RPALD), which better preserves interfacial quality. We propose an interface–bulk–interface (RP/DP/RP) process design that places RPALD at the interfaces and DPALD in the bulk, aiming to combine bulk trap sites with interfacial protection. Charge trap memory (CTM) devices were fabricated across RP/DP/RP thickness combinations. Within the tested range, the optimized structure exhibited the widest memory window and the highest effective trapped charge density among the measured devices, improving upon DPALD and comparable to RPALD, together with the lowest near-interface trap density at the Si/Al₂O₃ interface. The device also maintained a stable memory window up to 10⁴ program/erase cycles, and short-term retention data suggest potentially stable program and erase states, requiring longer-term validation. These results indicate that spatial modulation of plasma modes offers a process-level strategy for improving HfO₂-based CTM devices. Full article

Rapid growth in photovoltaic (PV) development has intensified competition between renewable energy expansion and land resources, highlighting the importance of integrating PV growth with spatial planning toward carbon neutrality. This study addresses the lack of township-level evidence by integrating spatio-temporal analysis, the Optimal Parameter Geodetector (OPGD), and the Patch-generating Land Use Simulation (PLUS) model to investigate the evolution, driving mechanisms, and future spatial patterns of PV development. Taking Xintai City as a case study, this research examines PV development from 2010 to 2022 and simulates future spatial patterns under natural development (ND) and carbon neutrality (CN) scenarios. Results show that PV development entered a rapid expansion stage after 2015, characterized by leapfrog growth and increasing spatial agglomeration. The centroid of PV patches shifted eastward, whereas the centroid of PV area migrated westward, indicating differentiated spatial evolution between the number and scale of PV facilities. PV development was jointly shaped by climatic conditions, socioeconomic factors, and land availability, with interactions among multiple factors substantially enhancing spatial heterogeneity. Scenario simulations revealed that PV development continued under both scenarios, while the CN scenario promoted more concentrated expansion in coal subsidence areas and inefficient industrial and mining lands, thereby helping alleviate potential conflicts with cultivated land protection. These findings highlight the importance of prioritizing low-conflict land resources and strengthening spatial coordination between renewable energy development and land management to support sustainable low-carbon development in resource-based cities. Full article

Lead (Pb) is a widespread environmental pollutant that induces systemic toxicity in aquatic organisms primarily through oxidative stress, hematological disruption, and immune dysfunction. This study investigated the protective effects of ellagic acid (EA) against Pb-induced toxicity in common carp (Cyprinus carpio) using a multi-biomarker approach and molecular docking. Fish were assigned to six experimental groups: control, EA-treated, Pb-I, Pb-I + EA, Pb-II, and Pb-II + EA. Fish in the Pb-I and Pb-II groups were exposed to 2.5 and 5 mg/L Pb, respectively, while EA was administered via diet at 100 mg/kg for 14 days. At the end of the exposure period, hematological indices, innate immune parameters, and oxidative stress biomarkers were assessed in blood, liver, kidney, and gill tissues. Pb exposure caused marked hematological impairment, suppressed immune responses, increased malondialdehyde levels, and disrupted antioxidant defense by reducing SOD, CAT, GSH-Px, and GSH levels while increasing GST activity. In contrast, dietary EA supplementation significantly mitigated Pb-induced alterations, improved hematological and immunological responses, reduced lipid peroxidation, restored antioxidant capacity, and normalized GST activity to control levels. Molecular docking analyses further showed that EA interacts with hemoglobin and immunoglobulin M, supporting its potential role in preserving oxygen transport and immune functions under Pb-induced stress. Overall, the findings demonstrate that Pb-induced toxicity involves coordinated disruption of redox homeostasis and immune function, whereas EA exerts a multi-target protective effect through biochemical and molecular mechanisms. This study provides mechanistic insight into chemical–biological interactions and supports the potential application of natural bioactive compounds in mitigating heavy metal-induced toxicity. Full article