Search Results (139)

Maedi-visna virus (MVV), a small ruminant lentivirus causing chronic multisystemic disease in sheep, poses significant economic burdens due to reduced productivity and a lack of effective treatments. Despite its worldwide prevalence, epidemiological data from Algeria remain absent. This first national seroprevalence study aimed to elucidate MVV distribution, risk factors, and transmission dynamics in Algerian sheep herds. A cross-sectional survey of 1400 sheep across four regions (East, Center, West, South) was conducted, with sera analyzed via indirect ELISA (IDvet). Risk factors (geography, age, sex, breed, farming system) were evaluated using chi-square tests and Cramer’s V. Overall seroprevalence was 9.07% (95% CI: 7.57–10.57), with significant variation by sex (females: 20.44% vs. males: 3.68%; p < 0.05), age (1–5 years: 6.86% vs. <1 year: 0.29%; p = 0.01), and region (Central: 3.36% vs. Eastern: 0.86%; p < 0.05). Notably, no association was found with breed or farming system (p ≥ 0.08), contrasting prior studies and suggesting region-specific transmission dynamics. Females exhibited heightened seropositivity, implicating prolonged herd retention and vertical transmission risks. Geographic disparities highlighted industrialized farming in central Algeria as a potential transmission amplifier. Strikingly, seronegative animals in high-prevalence herds hinted at genetic resistance, warranting further investigation. This study provides foundational insights into MVV epidemiology in North Africa, underscoring the need for targeted surveillance, ewe-focused control measures, and genetic research to mitigate transmission. The absence of prior national data elevates its significance, offering actionable frameworks for resource-limited settings and enriching the global understanding of SRLV heterogeneity. Full article

Small ruminant lentiviruses (SRLVs) are widespread and have a long co-evolutionary history with their hosts, namely sheep and goats. These viruses induce insidious pathologies, causing significant financial losses and animal welfare issues for the affected flocks. In Switzerland, in the 1980s, an eradication campaign was launched targeting these viruses, exclusively in goats, eliminating the virulent SRLV-B strains from the goat population, in which SRLV-B-induced arthritis was prevalent. Nevertheless, although they do not seem to induce clinical diseases, SRLV-A strains continue to circulate in Swiss goats. For this study, we contacted farmers who had animals testing positive for these strains during the census from 2011 to 2012 and visited six of these flocks, conducting serological, virological, and clinical analyses of the animals. We confirmed the absence of SRLV-B; however, we have detected SRLV-A in these flocks. Positive and negative animals lived in close contact for ten years and, except for a small flock of 13 animals, 7 of which tested positive, the transmission of these viruses proved inefficient. None of the positive animals showed any pathology attributable to SRLV infection. These encouraging results allowed us to formulate recommendations for the continued surveillance of these viruses in the Swiss goat population. Full article

Vaccination plays a pivotal role in the control and prevention of animal infectious diseases. However, no efficient and safe universal vaccines are currently registered for major pathogens such as influenza A virus, foot-and-mouth disease virus (FMDV), simian immunodeficiency virus (SIV), and small ruminant lentiviruses (SRLV). Here, we review the development of Sendai virus (SeV) vectors as a promising vaccine platform for animal diseases. Recombinant SeV vectors (rSeVv) possess several key features that make them highly suitable for developing vaccination strategies: (1) SeV has exclusively cytoplasmic replication cycle, therefore incapable of transforming host cells by integrating into the cellular genome, (2) rSeVv can accommodate large foreign gene/s inserts (~5 kb) with strong but adjustable transgene expression, (3) can be propagated to high titers in both embryonated chicken eggs and mammalian cell lines, (4) exhibits potent infectivity across a broad range of mammalian cells from different animals species, (5) undergo transient replication in the upper and lower respiratory tracts of non-natural hosts, (6) has not been associated with disease in pigs, non-humans primates, and small ruminants, ensuring a favorable safety profile, and (7) induce a robust innate and cellular immune responses. Preclinical and clinical studies using rSeVv-based vaccines against influenza A virus, FMDV, SIV, and SRLV have yielded promising results. Therefore, this review highlights the potential of rSeVv-based vaccine platforms as a valuable strategy for combating animal viruses. Full article

Microcephaly with pontine and cerebellar hypoplasia (MICPCH) syndrome is a severe neurodevelopmental disorder caused by a deficiency in the X-linked gene calcium/calmodulin-dependent serine protein kinase (CASK). A better understanding of the role of CASK in the pathophysiology of neurodevelopmental disorders may provide insights into novel therapeutic and diagnostic strategies for MICPCH syndrome and other neurodegenerative diseases. To investigate this, we generated CASK knockout (KO) cerebellar granule (CG) cell culture from CASK floxed (CASK^flox/flox) mice by infecting lentiviruses expressing codon-improved Cre recombinase (iCre). We performed RNA-sequencing (RNA-seq) on these cells and found that CASK-KO CG cells underwent apoptosis by activating intracellular Jun N-terminal kinase (JNK) signaling and upregulating reactive oxygen species (ROS)-related gene expression. We also performed mouse gait analysis and limb clasping behavior experiments on trans-heterozygous CASK-KO and Hprt-eGFP (CASK^+/- Hprt^eGFP/+) mice. The CASK^+/- Hprt^eGFP/+ mice exhibited cerebellar ataxic phenotypes as judged by the scores of these experiments compared to the CASK wild-type control (CASK^+/+ Hprt^eGFP/+) mice. Interestingly, the administration of the JNK inhibitor, JNK-IN-8, in CASK-KO CG cell cultures increased CG cell survival by reducing ROS generation. Moreover, injection of JNK-IN-8 into the cerebellum of CASK^+/- Hprt^eGFP/+ mice suppressed CG cell death and alleviated cerebellar ataxic phenotypes in vivo. In conclusion, JNK-IN-8 suppresses the cell death and activation of the ROS pathway in CASK-KO CG cells in both in vitro and in vivo models, suggesting its potential as a therapeutic strategy for cerebellar neurodegeneration in MICPCH syndrome. Full article

Adaptor protein (AP) complexes are critical components of the cellular membrane transport machinery. They mediate cargo selection during endocytosis and intracellular vesicular trafficking. Five AP complexes have been characterized (AP1-5), and together their roles extend to diverse cellular processes including the homeostasis of membranous organelles, membrane protein turnover, and immune responses. Human Immunodeficiency Virus type 1 (HIV-1) and other lentiviruses co-opt these complexes to support immune evasion and the assembly of maximally infectious particles. HIV-1 Nef interacts with AP1 and AP2 to manipulate intracellular trafficking and downregulate immune-related proteins such as CD4 and MHC-I. Vpu also co-opts AP1 and AP2, modulating the innate defense protein BST2 (Tetherin) and facilitating the release of virions from infected cells. The envelope glycoprotein (Env) hijacks AP complexes to reduce its expression at the cell surface and potentially support incorporation into virus particles. Some data suggest that Gag co-opts AP3 to drive assembly at intracellular compartments. In principle, targeting the molecular interfaces between HIV-1 proteins and AP complexes is a promising therapeutic approach. Blocking these interactions should impair HIV-1’s ability to produce infectious particles and evade immune defenses, leading to novel antivirals and facilitating a cure. Full article

Based on observations that HIV-1 envelope (Env) proteins on the surfaces of cells have the capacity to fuse with neighboring cells or enveloped viruses that express CD4 receptors and CXCR4 co-receptors, we tested factors that affect the capacities of lentiviral vectors pseudotyped with CD4 and CXCR4 variants to infect Env-expressing cells. The process, which we refer to as fusion in reverse, involves the binding and activation of cellular Env proteins to fuse membranes with lentiviruses carrying CD4 and CXCR4 proteins. We have found that infection via fusion in reverse depends on cell surface Env levels, is inhibitable by an HIV-1-specific fusion inhibitor, and preferentially requires lentiviral pseudotyping with a glycosylphosphatidylinositol (GPI)-anchored CD4 variant and a cytoplasmic tail-truncated CXCR4 protein. We have demonstrated that latently HIV-1-infected cells can be specifically infected using this mechanism, and that activation of latently infected cells increases infection efficiency. The fusion in reverse approach allowed us to characterize how alteration of CD4 plus CXCR4 lipid membranes affected Env protein activities. In particular, we found that perturbation of membrane cholesterol levels did not affect Env activity. In contrast, viruses assembled in cells deficient for long-chain sphingolipids showed increased infectivities, while viruses that incorporated a lipid scramblase were non-infectious. Our results yield new insights into factors that influence envelope protein functions. Full article

In 2011–2013, we isolated and characterized small ruminant lentiviruses (SRLVs) from two flocks, one of goats and the other of sheep, that had never been in direct contact. Phylogenetic analysis of these viruses indicated a common origin, which led us to hypothesize indirect transmission of these viruses between the two flocks. Since, to our knowledge, there are no published data on the tenacity of these viruses, we started this work. In the first part, we monitored the loss of infectivity of two prototypic SRLV strains, MVV 1514 and CAEV-CO, over time, in liquid suspension. As expected, the suspensions stored at 4 °C better preserved the infectivity of the viruses. Additionally, viruses resuspended in milk, the medium mirroring the in vivo situation, proved more tenacious than those maintained in a cell culture medium. These viruses, subjected to harsh treatments such as drying and resuspending, partially maintained their replication capacity. After an immediate loss of nearly 1 log₁₀ TCID₅₀ immediately after desiccation, the viruses maintained their replication capacity for at least three weeks when desiccated in milk. These results suggest that fomites, clothing, or pastures contaminated with secretions or milk from infected animals might mediate the infection of animals independently of direct contact. Full article

The evolutionary arms race between host restriction factors and viral antagonists provides crucial insights into immune system evolution and viral adaptation. This study investigates the structural and evolutionary dynamics of the double-domain restriction factors A3F and A3G and their viral inhibitor, Vif, across diverse primate species. By constructing 3D structural homology models and integrating ancestral sequence reconstruction (ASR), we identified patterns of sequence diversity, structural conservation, and functional adaptation. Inactive CD1 (Catalytic Domain 1) domains displayed greater sequence diversity and more positive surface charges than active CD2 domains, aiding nucleotide chain binding and intersegmental transfer. Despite variability, the CD2 DNA-binding grooves remained structurally consistent with conserved residues maintaining critical functions. A3F and A3G diverged in loop 7’ interaction strategies, utilising distinct molecular interactions to facilitate their roles. Vif exhibited charge variation linked to host species, reflecting its coevolution with A3 proteins. These findings illuminate how structural adaptations and charge dynamics enable both restriction factors and their viral antagonists to adapt to selective pressures. Our results emphasize the importance of studying structural evolution in host–virus interactions, with implications for understanding immune defense mechanisms, zoonotic risks, and viral evolution. This work establishes a foundation for further exploration of restriction factor diversity and coevolution across species. Full article

Small ruminant lentiviruses (SRLVs) cause a persistent, chronic degenerative, multisystem disease in goats and sheep. This study was performed to assess the genetic distribution of SRLV in Mexico and the risk factors that favor its presence in sheep and goats across different production units. In total, 890 goats and sheep (383 and 507, respectively) from 52 mixed-species and single-species flocks in the northern, central, and southern regions of Mexico were analyzed. Serological and molecular diagnoses were conducted. PCR-positive samples were further analyzed via real-time PCR to identify genotypes A and B. The survey data were evaluated to determine the relationship between virus presence, seropositivity, and associated factors in the flocks. Of the 890 animals sampled (507 sheep and 383 goats), 40% (354/890) tested positive for antibodies specific for SRLV (229 goats and 125 sheep), while 78% (697/890) were positive for the viral genome (340 goats and 357 sheep). The results confirmed that genotype A circulated in 15% of infected animals, genotype B circulated in 66%, and 19% were co-infected with both genotypes. This study highlights the circulation and spread of SRLV genotypes A and B in goat and sheep flocks in Mexico. The risk factors that showed a significant association with seropositivity were age, flock size, and veterinary assistance. For molecular positivity detection, production with mixed flocks was added as a variable in the central region cluster, in addition to the variable knowledge of SRLV diseases and contact with other flocks in the sheep cluster. Other factors such as species cohabitation, cleanliness, and preventive measures were associated with the presence of clinical signs. Full article

As the blood–brain barrier (BBB) prevents molecules from accessing the central nervous system (CNS), the traditional systemic delivery of chemical drugs limits the development of neurological drugs. However, in recent years, innovative therapeutic strategies have tried to bypass the restriction of traditional drug delivery methods. In vivo gene therapy refers to emerging biopharma vectors that carry the specific genes and target and infect specific tissues; these infected cells and tissues then undergo fundamental changes at the genetic level and produce therapeutic proteins or substances, thus providing therapeutic benefits. Clinical and preclinical trials mainly utilize adeno-associated viruses (AAVs), lentiviruses (LVs), and other viruses as gene vectors for disease investigation. Although LVs have a higher gene-carrying capacity, the vector of choice for many neurological diseases is the AAV vector due to its safety and long-term transgene expression in neurons. Here, we review the basic biology of AAVs and summarize some key issues in recombinant AAV (rAAV) engineering in gene therapy research; then, we summarize recent clinical trials using rAAV treatment for neurological diseases and provide translational perspectives and future challenges on target selection. Full article

Background/Objectives: Bladder urothelial carcinoma is a frequent malignant tumor of the urinary system, characterized by its high rates of recurrence and resistance to chemotherapy. This study explored the beneficial effects of overexpressing WW domain-containing oxidoreductase (WWOX) in AY-27 cells encapsulated in an injectable gelatin hydrogel for potential therapeutic applications in bladder cancer. Methods: AY-27 cells were genetically transduced with lentiviruses (LV) to overexpress WWOX (LV-WWOX) and subsequently encapsulated in a gelatin hydrogel. The mechanical properties and morphology of the hydrogels were assessed using transmission electron microscopy (TEM) and scanning electron microscopy (SEM). The therapeutic efficacy of this approach was evaluated using an F344/AY-27 rat orthotopic bladder cancer model, in which the LV-WWOX-hydrogel (H-LV-WWOX) was administered via intravesical instillation. Results: The gelatin hydrogel formulation demonstrated excellent biocompatibility, stability, and controlled release. In a rat orthotopic model, intravesical instillation of H-LV-WWOX significantly enhanced local immune responses, resulting in notable tumor regression. Compared to the sham-treated group, this approach reduced systemic toxicity and improved overall treatment outcomes. The anticancer effect of WWOX can be attributed to its ability to amplify TNF-α-induced reactive oxygen species (ROS) generation. This ROS-mediated pathway leads to enhanced apoptosis and DNA damage in cancer cells, highlighting the potential mechanism through which WWOX exhibits tumor-suppressive activities. Conclusions: These findings support the therapeutic potential of WWOX overexpression in gelatin hydrogels for bladder cancer treatment and warrant further clinical investigation. Full article

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1. Full article

Small ruminant lentiviruses (SRLVs) infect sheep, causing a multiorganic disease called maedi-visna or ovine progressive pneumonia, which significantly affects the production and welfare of sheep, generating serious economic losses. Although not all infected animals develop fully symptomatic disease, they constantly spread the virus in the flock. Since the infection is incurable and no vaccine is available, another approach is necessary to control SRLV infections. In recent years, an alternative for culling infected animals has become the approach based on identifying genetic markers for selecting SRLV-resistant individuals. Recent reports revealed several candidates, including gene encoding transmembrane protein 154 (TMEM154). Several single nucleotide polymorphisms (SNPs) are found within this gene in sheep of different breeds, but only some can be considered as resistant markers. This study aimed to investigate the presence of single polymorphic sites in TMEM154 gene in sheep of selected Polish flocks and assess their association with the infection and proviral load in the context of susceptibility to SRLV infection. In total 107 sheep, representing three breeds, were screened for their SRLV infection status by serological and PCR testing. All these animals were also genotyped to characterize the presence of SNPs in TMEM154 gene and estimate their potential of being the SRLV-resistance marker. The frequency of identified alleles differed among breeds. Moreover, the positive association between TMEM154 genotype and SRLV status was found for E35K polymorphism and two polymorphic sites in 5′UTR in one of analyzed breed. However, when the relationship between SNPs and SRLV proviral load was analyzed, five had a strong association, considering the whole population of tested sheep. Presented data, for the first time, identified the presence of SNPs in TMEM154 gene in sheep housed in Polish flocks and suggested that selecting SRLV-resistant animals based on this analysis might be possible, but further validation in a larger group of sheep is required. Full article

Small ruminant lentiviruses (SRLVs) are responsible for chronic and progressive multisystemic clinical forms, which significantly reduce flocks’ productivity and have a considerable economic impact on the small ruminant industry. Due to the increase in genetic analysis studies and the potential for misclassification of certain strains, owing to the high genetic variability of these viruses, a systematic review was deemed necessary. This review explores the types of matrices used for molecular detection and phylogenetic studies, the genomic regions selected as targets, and the software utilized for phylogenetic analysis, assessing the geographical distribution of identified genotypes and subgenotypes over time. A thorough comparison of the diagnostic approaches highlights the strengths and limitations of each method, identifying gaps that need to be addressed. Additionally, recombination events and compartmentalization are examined to provide an updated, detailed, and comprehensive overview of SRLV phylogenesis. Full article

Proteasomes are barrel-like cellular protein complexes responsible for the degradation of most intracellular proteins. Earlier, it has been shown that during assembly, hundreds of different cellular proteins are incorporated into retro-and herpes viruses. Among detected cellular proteins, there were different proteasome subunits (PS). Previous reports postulated the incorporation of 20S proteasome subunits and subunits of proteasome regulator complexes inside retroviruses. Here, we demonstrated the association of functional 20S proteasome with gammaretroviruses, betaretroviruses, and lentiviruses. Cleaved proteasome subunits β1, β2 and β5 were detected in tested viruses. Using fluorescent peptides and a cell-permeable proteasome activity probe, proteasome activity was detected in endogenous and exogenous retroviruses, including recombinant HIV-1. Taken together, our data favors the insertion of functional proteasomes into the retroviruses during assembly. The possible role of proteasomes in retroviruses is discussed. Full article