Molecular Characterization and Antimicrobial Resistance of Salmonella from Chicken Meat and Water in Retail Markets of Chitwan, Nepal
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection and Preparation of Samples
2.2. Isolation and Identification of Salmonella spp.
2.3. Preservation of Salmonella Isolates
2.4. Antibiotic Sensitivity Test
2.5. DNA Extraction and Quantification
2.6. Detection of Antibiotic Resistance Genes by Multiplex PCR
2.7. Multiplex PCR Amplification and Thermal Cycling Conditions
2.8. Statistical Analysis
3. Results
3.1. Overall Prevalence of Salmonella
3.2. Antibiotic Susceptibility Profile of Salmonella Isolates
3.3. ARPs in Salmonella Isolates
3.4. PCR Detection of Antibiotic-Resistant Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Saud, B.; Paudel, G.; Khichaju, S.; Bajracharya, D.; Dhungana, G.; Awasthi, M.S.; Shrestha, V. Multidrug-Resistant Bacteria from Raw Meat of Buffalo and Chicken, Nepal. Vet. Med. Int. 2019, 2019, 7960268. [Google Scholar] [CrossRef] [PubMed]
- Maharjan, M.; Joshi, V.; Joshi, D.D.; Manandhar, P. Prevalence of Salmonella Species in Various Raw Meat Samples of a Local Market in Kathmandu. Ann. N. Y. Acad. Sci. 2006, 1081, 249–256. [Google Scholar] [CrossRef] [PubMed]
- Bhandari, R.; Singh, A.K.; Bhatt, P.R.; Timalsina, A.; Bhandari, R.; Thapa, P.; Baral, J.; Adhikari, S.; Poudel, P.; Chiluwal, S.; et al. Factors Associated with Meat Hygiene-Practices among Meat-Handlers in Metropolitan City of Kathmandu, Nepal. PLoS Glob. Public Health 2022, 2, e0001181. [Google Scholar] [CrossRef]
- Nichols, M.; Stevenson, L.; Whitlock, L.; Pabilonia, K.; Robyn, M.; Basler, C.; Gomez, T.; Behravesh, C.B. Preventing Human Salmonella Infections Resulting from Live Poultry Contact through Interventions at Retail Stores. J. Agric. Saf. Health 2018, 24, 155–166. [Google Scholar] [PubMed]
- Momtaz, H.; Dehkordi, F.S.; Rahimi, E.; Asgarifar, A. Detection of Escherichia Coli, Salmonella Species, and Vibrio Cholerae in Tap Water and Bottled Drinking Water in Isfahan, Iran. BMC Public Health 2013, 13, 556. [Google Scholar] [CrossRef]
- LeBoa, C.; Shrestha, S.; Shakya, J.; Naga, S.R.; Shrestha, S.; Shakya, M.; Yu, A.T.; Shrestha, R.; Vaidya, K.; Katuwal, N.; et al. Environmental Sampling for Typhoidal Salmonellas in Household and Surface Waters in Nepal Identifies Potential Transmission Pathways. PLoS Negl. Trop. Dis. 2023, 17, e0011341. [Google Scholar] [CrossRef]
- Karkey, A.; Jombart, T.; Walker, A.W.; Thompson, C.N.; Torres, A.; Dongol, S.; Tran Vu Thieu, N.; Pham Thanh, D.; Tran Thi Ngoc, D.; Voong Vinh, P.; et al. The Ecological Dynamics of Fecal Contamination and Salmonella Typhi and Salmonella Paratyphi A in Municipal Kathmandu Drinking Water. PLoS Negl. Trop. Dis. 2016, 10, e0004346. [Google Scholar] [CrossRef]
- Raut, R.; Maharjan, P.; Fouladkhah, A.C. Practical Preventive Considerations for Reducing the Public Health Burden of Poultry-Related Salmonellosis. Int. J. Environ. Res. Public Health 2023, 20, 6654. [Google Scholar] [CrossRef]
- Chlebicz, A.; Śliżewska, K. Campylobacteriosis, Salmonellosis, Yersiniosis, and Listeriosis as Zoonotic Foodborne Diseases: A Review. Int. J. Environ. Res. Public Health 2018, 15, 863. [Google Scholar] [CrossRef]
- Eng, S.K.; Pusparajah, P.; Ab Mutalib, N.S.; Ser, H.L.; Chan, K.G.; Lee, L.H. Salmonella: A Review on Pathogenesis, Epidemiology and Antibiotic Resistance. Front. Life Sci. 2015, 8, 284–293. [Google Scholar] [CrossRef]
- Threlfall, E.J.; Ward, L.R.; Frost, J.A.; Willshaw, G.A. The Emergence and Spread of Antibiotic Resistance in Food-Borne Bacteria. Int. J. Food Microbiol. 2000, 62, 1–5. [Google Scholar] [CrossRef]
- Patel, S.J.; Wellington, M.; Shah, R.M.; Ferreira, M.J. Antibiotic Stewardship in Food-Producing Animals: Challenges, Progress, and Opportunities. Clin. Ther. 2020, 42, 1649–1658. [Google Scholar] [CrossRef] [PubMed]
- Acharya, K.P.; Wilson, R.T. Antimicrobial Resistance in Nepal. Front. Med. 2019, 6, 105. [Google Scholar] [CrossRef] [PubMed]
- Salam, M.A.; Al-Amin, M.Y.; Salam, M.T.; Pawar, J.S.; Akhter, N.; Rabaan, A.A.; Alqumber, M.A.A. Antimicrobial Resistance: A Growing Serious Threat for Global Public Health. Healthcare 2023, 11, 1946. [Google Scholar] [CrossRef]
- Swartz, M.N. Human Diseases Caused by Foodborne Pathogens of Animal Origin. Clin. Infect. Dis. 2002, 34, S111–S122. [Google Scholar] [CrossRef]
- Adeyanju, G.T.; Ishola, O. Salmonella and Escherichia Coli Contamination of Poultry Meat from a Processing Plant and Retail Markets in Ibadan, Oyo State, Nigeria. SpringerPlus 2014, 3, 139. [Google Scholar] [CrossRef]
- Vassiliadis, P.; Mavrommati, C.; Kalapothaki, V.; Chronas, G.; Efstratiou, M. Salmonella Isolation with Rappaport–Vassiliadis Enrichment Medium Seeded with Different Sized Inocula of Pre-Enrichment Cultures of Meat Products and Sewage Polluted Water. J. Hyg. 1985, 95, 139–147. [Google Scholar] [CrossRef]
- Makwana, P.P.; Nayak, J.B.; Brahmbhatt, M.N.; Chaudhary, J.H. Detection of Salmonella spp. from Chevon, Mutton and Its Environment in Retail Meat Shops in Anand City (Gujarat), India. Vet. World 2015, 8, 388–392. [Google Scholar] [CrossRef]
- Wikler, M.A. Performance Standards for Antimicrobial Susceptibility Testing: Sixteenth Informational Supplement; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2006; ISBN 978-1-56238-588-0. [Google Scholar]
- Upadhyaya, N.; Karki, S.; Rana, S.; Elsohaby, I.; Tiwari, R.; Oli, M.; Paudel, S. Trend of Antimicrobial Use in Food-Producing Animals from 2018 to 2020 in Nepal. Animals 2023, 13, 1377. [Google Scholar] [CrossRef] [PubMed]
- Abdi, R.D.; Mengstie, F.; Beyi, A.F.; Beyene, T.; Waktole, H.; Mammo, B.; Ayana, D.; Abunna, F. Determination of the Sources and Antimicrobial Resistance Patterns of Salmonella Isolated from the Poultry Industry in Southern Ethiopia. BMC Infect. Dis. 2017, 17, 352. [Google Scholar] [CrossRef]
- De Medici, D.; Croci, L.; Delibato, E.; Di Pasquale, S.; Filetici, E.; Toti, L. Evaluation of DNA Extraction Methods for Use in Combination with SYBR Green I Real-Time PCR To Detect Salmonella Enterica Serotype Enteritidis in Poultry. Appl. Environ. Microbiol. 2003, 69, 3456–3461. [Google Scholar] [CrossRef]
- Olson, N.D.; Morrow, J.B. DNA Extract Characterization Process for Microbial Detection Methods Development and Validation. BMC Res. Notes 2012, 5, 668. [Google Scholar] [CrossRef]
- Van, T.T.H.; Chin, J.; Chapman, T.; Tran, L.T.; Coloe, P.J. Safety of Raw Meat and Shellfish in Vietnam: An Analysis of Escherichia Coli Isolations for Antibiotic Resistance and Virulence Genes. Int. J. Food Microbiol. 2008, 124, 217–223. [Google Scholar] [CrossRef] [PubMed]
- Randall, L.P.; Cooles, S.W.; Osborn, M.K.; Piddock, L.J.V.; Woodward, M.J. Antibiotic Resistance Genes, Integrons and Multiple Antibiotic Resistance in Thirty-Five Serotypes of Salmonella Enterica Isolated from Humans and Animals in the UK. J. Antimicrob. Chemother. 2004, 53, 208–216. [Google Scholar] [CrossRef]
- Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of Plasmid-Mediated Colistin Resistance Mechanism MCR-1 in Animals and Human Beings in China: A Microbiological and Molecular Biological Study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef] [PubMed]
- Mustedanagic, A.; Matt, M.; Weyermair, K.; Schrattenecker, A.; Kubitza, I.; Firth, C.L.; Loncaric, I.; Wagner, M.; Stessl, B. Assessment of Microbial Quality in Poultry Drinking Water on Farms in Austria. Front. Vet. Sci. 2023, 10, 1254442. [Google Scholar] [CrossRef]
- Dhakal, L.; Dhakal, I.; Yadav, S.; Ahaduzzaman, M.; Islam, M.Z. Prevalence and Antibiotic Resistance Profile of Salmonella from Livestock and Poultry Raw Meat, Nepal. Int. J. Mol. Vet. Res. 2016, 6, 1–27. [Google Scholar] [CrossRef]
- Xu, Z.; Wang, M.; Zhou, C.; Gu, G.; Liang, J.; Hou, X.; Wang, M.; Wei, P. Prevalence and Antimicrobial Resistance of Retail-Meat-Borne Salmonella in Southern China during the Years 2009–2016: The Diversity of Contamination and the Resistance Evolution of Multidrug-Resistant Isolates. Int. J. Food Microbiol. 2020, 333, 108790. [Google Scholar] [CrossRef]
- Waghamare, R.N.; Paturkar, A.M.; Zende, R.J.; Vaidya, V.M.; Gandage, R.S.; Aswar, N.B.; Khilari, R.S. Studies on Occurrence of Invasive Salmonella spp. from Unorganised Poultry Farm to Retail Chicken Meat Shops in Mumbai City, India. Int. J. Curr. Microbiol. Appl. Sci. 2017, 6, 630–641. [Google Scholar] [CrossRef][Green Version]
- Garedew, L.; Hagos, Z.; Addis, Z.; Tesfaye, R.; Zegeye, B. Prevalence and Antimicrobial Susceptibility Patterns of Salmonella Isolates in Association with Hygienic Status from Butcher Shops in Gondar Town, Ethiopia. Antimicrob. Resist. Infect. Control 2015, 4, 21. [Google Scholar] [CrossRef] [PubMed]
- Buncic, S.; Sofos, J. Interventions to Control Salmonella Contamination during Poultry, Cattle and Pig Slaughter. Food Res. Int. 2012, 45, 641–655. [Google Scholar] [CrossRef]
- Alum, E.A.; Urom, S.M.O.C.; Ben, C.M.A. Microbiological Contamination of Food: The Mechanisms, Impacts and Prevention. Int. J. Sci. Technol. Res. 2016, 5, 65–78. [Google Scholar]
- Srikantiah, P.; Vafokulov, S.; Luby, S.P.; Ishmail, T.; Earhart, K.; Khodjaev, N.; Jennings, G.; Crump, J.A.; Mahoney, F.J. Epidemiology and Risk Factors for Endemic Typhoid Fever in Uzbekistan. Trop. Med. Int. Health 2007, 12, 838–847. [Google Scholar] [CrossRef]
- Fuzihara, T.O.; Fernandes, S.A.; Franco, B.D.G.M. Prevalence and Dissemination of Salmonella Serotypes along the Slaughtering Process in Brazilian Small Poultry Slaughterhouses. J. Food Prot. 2000, 63, 1749–1753. [Google Scholar] [CrossRef]
- Bhandari, N.; Nepali, D.; Paudyal, S. Assessment of Bacterial Load in Broiler Chicken Meat from the Retail Meat Shops in Chitwan, Nepal. Int. J. Infect. Microbiol. 2013, 2, 99–104. [Google Scholar] [CrossRef]
- Nelson, A.; Manandhar, S.; Ruzante, J.; Gywali, A.; Dhakal, B.; Dulal, S.; Chaulagai, R.; Dixit, S.M. Antimicrobial Drug Resistant Non-Typhoidal Salmonella Enterica in Commercial Poultry Value Chain in Chitwan, Nepal. One Health Outlook 2020, 2, 18. [Google Scholar] [CrossRef]
- Abd-Elghany, S.M.; Sallam, K.I.; Abd-Elkhalek, A.; Tamura, T. Occurrence, Genetic Characterization and Antimicrobial Resistance of Salmonella Isolated from Chicken Meat and Giblets. Epidemiol. Infect. 2015, 143, 997–1003. [Google Scholar] [CrossRef]
- Yildirim, Y.; Gonulalan, Z.; Pamuk, S.; Ertas, N. Incidence and Antibiotic Resistance of Salmonella spp. on Raw Chicken Carcasses. Food Res. Int. 2011, 44, 725–728. [Google Scholar] [CrossRef]
- Fallah, S.H.; Asgharpour, F.; Naderian, Z.; Moulana, Z. Isolation and Determination of Antibiotic Resistance Patterns in Nontyphoid Salmonella spp. Isolated From Chicken. Int. J. of Enteric Pathog. 2013, 1, 17–21. [Google Scholar] [CrossRef]
- White, D.G.; Zhao, S.; Sudler, R.; Ayers, S.; Friedman, S.; Chen, S.; McDermott, P.F.; McDermott, S.; Wagner, D.D.; Meng, J. The Isolation of Antibiotic-Resistant Salmonella from Retail Ground Meats. N. Engl. J. Med. 2001, 345, 1147–1154. [Google Scholar] [CrossRef]
- Li, R.; Lai, J.; Wang, Y.; Liu, S.; Li, Y.; Liu, K.; Shen, J.; Wu, C. Prevalence and Characterization of Salmonella Species Isolated from Pigs, Ducks and Chickens in Sichuan Province, China. Int. J. Food Microbiol. 2013, 163, 14–18. [Google Scholar] [CrossRef] [PubMed]
- Balakrishnan, S.; Sangeetha, A.; Dhanalakshmi, M. Prevalence of Salmonella in Chicken Meat and Its Slaughtering Place from Local Markets in Orathanadu, Thanjavur District, Tamil Nadu. J. Entomol. Zool. Stud. 2018, 6, 2468–2471. [Google Scholar]
- Lutful Kabir, S.M. Avian Colibacillosis and Salmonellosis: A Closer Look at Epidemiology, Pathogenesis, Diagnosis, Control and Public Health Concerns. Int. J. Environ. Res. Public Health 2010, 7, 89–114. [Google Scholar] [CrossRef]
- Thapa, R.; Thapa, D.B.; Chapagain, A. Prevalence of Escherichia Coli and Salmonella spp. from Chicken Meat Samples of Bharatpur, Chitwan. J. Inst. Agric. Anim. Sci. 2020, 36, 257–267. [Google Scholar] [CrossRef]
- Dhakal, A.; Devkota, S.; Jethara, S.B.; Yadav, R.K.; Phuyal, P. Assessment of Biosecurity in Poultry Farms in Chitwan, Nepal. Vet. Med. Sci. 2025, 11, e70232. [Google Scholar] [CrossRef]
- Sharma, J.; Kumar, D.; Hussain, S.; Pathak, A.; Shukla, M.; Prasanna Kumar, V.; Anisha, P.N.; Rautela, R.; Upadhyay, A.K.; Singh, S.P. Prevalence, Antimicrobial Resistance and Virulence Genes Characterization of Nontyphoidal Salmonella Isolated from Retail Chicken Meat Shops in Northern India. Food Control 2019, 102, 104–111. [Google Scholar] [CrossRef]
- Berghaus, R.D.; Thayer, S.G.; Law, B.F.; Mild, R.M.; Hofacre, C.L.; Singer, R.S. Enumeration of Salmonella and Campylobacter spp. in Environmental Farm Samples and Processing Plant Carcass Rinses from Commercial Broiler Chicken Flocks. Appl. Environ. Microbiol. 2013, 79, 4106–4114. [Google Scholar] [CrossRef]
- Volkova, V.V.; Wills, R.W.; Hubbard, S.A.; Magee, D.L.; Byrd, J.A.; Bailey, R.H. Risk Factors Associated with Detection of Salmonella in Broiler Litter at the Time of New Flock Placement. Zoonoses Public Health 2011, 58, 158–168. [Google Scholar] [CrossRef]
- Franz, E.; van der Fels-Klerx, H.J.; Thissen, J.; van Asselt, E.D. Farm and Slaughterhouse Characteristics Affecting the Occurrence of Salmonella and Campylobacter in the Broiler Supply Chain. Poult. Sci. 2012, 91, 2376–2381. [Google Scholar] [CrossRef]
- Bolder, N.M. Microbial Challenges of Poultry Meat Production. World’s Poult. Sci. J. 2007, 63, 401–411. [Google Scholar] [CrossRef]
- Wessels, K.; Rip, D.; Gouws, P. Salmonella in Chicken Meat: Consumption, Outbreaks, Characteristics, Current Control Methods and the Potential of Bacteriophage Use. Foods 2021, 10, 1742. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, M.O.; Ribeiro, A.R.; Santos, L.R.D.; Pilotto, F.; de Moraes, H.L.; Salle, C.T.P.; Rocha, S.L.D.S.; Nascimento, V.P.D. Antibiotic Resistance in Salmonella Enteritidis Isolated from Broiler Carcasses. Braz. J. Microbiol. 2006, 37, 368–371. [Google Scholar] [CrossRef]
- Naik, V.K.; Shakya, S.; Patyal, A.; Gade, N.E.; Bhoomika. Isolation and Molecular Characterization of Salmonella spp. from Chevon and Chicken Meat Collected from Different Districts of Chhattisgarh, India. Vet. World 2015, 8, 702–706. [Google Scholar] [CrossRef] [PubMed]
- Cui, S.; Li, J.; Sun, Z.; Hu, C.; Jin, S.; Guo, Y.; Ran, L.; Ma, Y. Ciprofloxacin-Resistant Salmonella Enterica Serotype Typhimurium, China. Emerg. Infect. Dis. 2008, 14, 493–495. [Google Scholar] [CrossRef] [PubMed]
- Hedman, H.D.; Vasco, K.A.; Zhang, L. A Review of Antimicrobial Resistance in Poultry Farming within Low-Resource Settings. Animals 2020, 10, 1264. [Google Scholar] [CrossRef]
- Diarrassouba, F.; Diarra, M.S.; Bach, S.; Delaquis, P.; Pritchard, J.; Topp, E.; Skura, B.J. Antibiotic Resistance and Virulence Genes in Commensal Escherichia coli and Salmonella Isolates from Commercial Broiler Chicken Farms†. J. Food Prot. 2007, 70, 1316–1327. [Google Scholar] [CrossRef]
- Petracci, M.; Bianchi, M.; Cavani, C. Pre-Slaughter Handling and Slaughtering Factors Influencing Poultry Product Quality. World’s Poult. Sci. J. 2010, 66, 17–26. [Google Scholar] [CrossRef]




| Antimicrobial Agent | Target Gene | Amplicon Size (bp) | Primer Sequence | Reference |
|---|---|---|---|---|
| Beta-lactams | blaTEM | 857 | F: GAGTATTCAACATTTTCGT | [24] |
| R: ACCAATGCTTAATCAGTGA | ||||
| Tetracycline | tetB | 670 | F: CCTCAGCTTCTCAACGCGTG | [25] |
| R: GCACCTTGCTGATGACTCTT | ||||
| Chloramphenicol | catA1 | 547 | F: AGTTGCTCAATGTACCTATAACC | [24] |
| R: TTGTAATTCATTAAGCATTCTGCC | ||||
| Erythromycin | ere(A) | 419 | F: GCCGGTGCTCATGAACTTGAG | [24] |
| R: CGACTCTATTCGATCAGAGGC | ||||
| Polymyxin | mcr1 | 309 | F: CGGTCAGTCCGTTTGTTC | [26] |
| R: CTTGGTCGGTCTGTAGGG |
| Number of Antibiotic-Resistant Pattern | Antibiotic-Resistant Pattern (ARP) | ARP Frequency |
|---|---|---|
| 0 | - | 0 |
| 1 | DO | 1 |
| 2 | DO-ER | 1 |
| DO-GEN | 1 | |
| 3 | A/S-DO-T | 3 |
| A/S-ER-GEN | 1 | |
| A/S-ER-T | 2 | |
| CTR-ER-T | 1 | |
| A/S-DO-ER | 1 | |
| 4 | A/S-DO-ER-T | 8 |
| CTR-DO-ER-T | 3 | |
| A/S-DO-LE-T | 2 | |
| A/S-DO-GEN-T | 1 | |
| C-DO-ER-T | 1 | |
| DO-ER-GEN-T | 1 | |
| 5 | A/S-DO-ER-L-T | 1 |
| A/S-DO-ER-GEN-T | 1 | |
| A/S-CTR-DO-ER-T | 1 | |
| A/S-DO-ER-LE-T | 1 | |
| 6 | AK-A/S-C-D0-ER-T | 1 |
| AK-A/S-DO-ER-LE-T | 1 | |
| A/S-CTR-DO-ER-LE-T | 1 | |
| A/S-C-DO-ER-LE-T | 1 | |
| 7 | AK-A/S-CTR-DO-ER-GEN-T | 1 |
| A/S-C-CTR-DO-ER-GEN-T | 1 | |
| AK-A/S-C-DO-ER-GEN-LE | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Parajuli, S.; Basnet, H.B.; Raut, R.; Bhattarai, R.K. Molecular Characterization and Antimicrobial Resistance of Salmonella from Chicken Meat and Water in Retail Markets of Chitwan, Nepal. Appl. Microbiol. 2025, 5, 81. https://doi.org/10.3390/applmicrobiol5030081
Parajuli S, Basnet HB, Raut R, Bhattarai RK. Molecular Characterization and Antimicrobial Resistance of Salmonella from Chicken Meat and Water in Retail Markets of Chitwan, Nepal. Applied Microbiology. 2025; 5(3):81. https://doi.org/10.3390/applmicrobiol5030081
Chicago/Turabian StyleParajuli, Saroj, Hom Bahadur Basnet, Rabin Raut, and Rebanta Kumar Bhattarai. 2025. "Molecular Characterization and Antimicrobial Resistance of Salmonella from Chicken Meat and Water in Retail Markets of Chitwan, Nepal" Applied Microbiology 5, no. 3: 81. https://doi.org/10.3390/applmicrobiol5030081
APA StyleParajuli, S., Basnet, H. B., Raut, R., & Bhattarai, R. K. (2025). Molecular Characterization and Antimicrobial Resistance of Salmonella from Chicken Meat and Water in Retail Markets of Chitwan, Nepal. Applied Microbiology, 5(3), 81. https://doi.org/10.3390/applmicrobiol5030081

