Molecular Epidemiology of Clinical Carbapenem-Resistant Acinetobacter baumannii-calcoaceticus complex Isolates in Tertiary Care Hospitals in Java and Sulawesi Islands, Indonesia
Abstract
1. Introduction
2. Materials and Methods
2.1. Setting and Study Design
2.2. Bacterial Isolates
2.3. DNA Extraction and Carbapenemase Genes’ Identification
2.4. Multi-Locus Variable-Number Tandem Repeat Analysis (MLVA)
2.5. Multilocus Sequence Typing (MLST)
2.6. Clonal Complex (CC) Analysis
2.7. Phylogenetic Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Howard, A.; O’Donoghue, M.; Feeney, A.; Sleator, R.D. Acinetobacter baumannii an emerging opportunistic pathogen. Virulence 2012, 3, 243–250. [Google Scholar] [CrossRef] [PubMed]
- Boucher, H.W.; Talbot, G.H.; Bradley, J.S.; Edwards, J.E.; Gilbert, D.; Rice, L.B.; Scheld, M.; Spellberg, B.; Bartlett, J. Bad bugs, no drugs: No ESKAPE! An update from the Infectious Diseases Society of America. Clin. Infect. Dis. 2009, 48, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Mulani, M.S.; Kamble, E.E.; Kumkar, S.N.; Tawre, M.S.; Pardesi, K.R. Emerging strategies to combat ESKAPE pathogens in the era of antimicrobial resistance: A review. Front. Microbiol. 2019, 10, 539. [Google Scholar] [CrossRef] [PubMed]
- De Vos, D.; Pirnay, J.P.; Bilocq, F.; Jennes, S.; Verbeken, G.; Rose, T.; Keersebilck, E.; Bosmans, P.; Pieters, T.; Hing, M.; et al. Molecular epidemiology and clinical impact of Acinetobacter calcoaceticus-baumannii complex in a belgian burn wound center. PLoS ONE 2016, 11, e0156237. [Google Scholar] [CrossRef]
- Alcántar-Curiel, M.D.; Rosales-Reyes, R.; Jarillo-Quijada, M.D.; Gayosso-Vázquez, C.; Fernández-Vázquez, J.L.; Toledano-Tableros, J.E.; Giono-Cerezo, S.; Garza-Villafuerte, P.; López-Huerta, A.; Vences-Vences, D.; et al. Carbapenem-Resistant Acinetobacter. baumannii in Three Tertiary Care Hospitals in Mexico: Virulence Profiles, Innate Immune Response and Clonal Dissemination. Front. Microbiol. 2019, 10, 2116. [Google Scholar] [CrossRef]
- Papp-Wallace, K.M.; Endimiani, A.; Taracila, M.A.; Bonomo, R.A. Carbapenems: Past, present, and future. Antimicrob. Agents Chemother. 2011, 55, 4943–4960. [Google Scholar] [CrossRef]
- Evans, B.A.; Hamouda, A.; Amyes, S.G.B. The Rise of Carbapenem-Resistant Acinetobacter baumannii. Curr. Pharm. Des. 2013, 19, 223–238. [Google Scholar] [CrossRef]
- Tacconelli, E.; Carrara, E.; Savoldi, A.; Harbarth, S.; Mendelson, M.; Monnet, D.L.; Pulcini, C.; Kahlmeter, G.; Kluytmans, J.; Carmeli, Y.; et al. Discovery, research, and development of new antibiotics: The WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis. 2018, 18, 318–327. [Google Scholar] [CrossRef]
- Kempf, M.; Rolain, J.M. Emergence of resistance to carbapenems in Acinetobacter. baumannii in Europe: Clinical impact and therapeutic options. Int. J. Antimicrob. Agents 2012, 39, 105–114. [Google Scholar] [CrossRef]
- Vardakas, K.Z.; Horianopoulou, M.; Falagas, M.E. Factors associated with treatment failure in patients with diabetic foot infections: An analysis of data from randomized controlled trials. Diabetes Res. Clin. Pract. 2008, 80, 344–351. [Google Scholar] [CrossRef]
- Watkins, R.R.; Van Duin, D. Current trends in the treatment of pneumonia due to multidrug-resistant Gram-negative bacteria [version 2; referees: 2 approved]. F1000Research 2019, 8, 1–10. [Google Scholar] [CrossRef]
- Weber, S.; Hogardt, M.; Reinheimer, C.; Wichelhaus, T.A.; Kempf, V.A.J.; Kessel, J.; Wolf, S.; Serve, H.; Steffen, B.; Scheich, S. Bloodstream infections with vancomycin-resistant enterococci are associated with a decreased survival in patients with hematological diseases. Ann. Hematol. 2019, 98, 763–773. [Google Scholar] [CrossRef] [PubMed]
- US CDC. Antibiotic Resistance Threats in the United States, 2019; US CDC: Atlanta, GA, USA, 2019. [CrossRef]
- Queenan, A.M.; Pillar, C.M.; Deane, J.; Sahm, D.F.; Lynch, A.S.; Flamm, R.K.; Peterson, J.; Davies, T.A. Multidrug resistance among Acinetobacter spp. in the USA and activity profile of key agents: Results from CAPITAL Surveillance 2010. Diagn. Microbiol. Infect. Dis. 2012, 73, 267–270. [Google Scholar] [CrossRef] [PubMed]
- Kolpa, M.; Walaszek, M.; Gniadek, A.; Wolak, Z.; Dobroś, W. Incidence, microbiological profile and risk factors of healthcare-associated infections in intensive care units: A 10 years observation in a provincial hospital in southern Poland. Int. J. Environ. Res. Public Health 2018, 15, 112. [Google Scholar] [CrossRef]
- Medioli, F.; Bacca, E.; Faltoni, M.; Burastero, G.J.; Volpi, S.; Menozzi, M.; Orlando, G.; Bedini, A.; Franceschini, E.; Mussini, C.; et al. Is It Possible to Eradicate Carbapenem-Resistant Acinetobacter. baumannii (CRAB) from Endemic Hospitals ? Antibiotics 2022, 11, 1015. [Google Scholar] [CrossRef]
- Anggraini, D.; Santosaningsih, D.; Dwi Endraswari, P.; Moehario, L.; Riezke, C.V.; Enty, E.; Marindra, F.; Verbrugh, H.A. Epidemiology study of Acinetobacter spp. isolated from blood culture in Indonesia. Int. J. Infect. Dis. 2020, 101, 62–63. [Google Scholar] [CrossRef]
- Meschiari, M.; Lòpez-Lozano, J.M.; Di Pilato, V.; Gimenez-Esparza, C.; Vecchi, E.; Bacca, E.; Orlando, G.; Franceschini, E.; Sarti, M.; Pecorari, M.; et al. A five-component infection control bundle to permanently eliminate a carbapenem-resistant Acinetobacter. baumannii spreading in an intensive care unit. Antimicrob. Resist. Infect. Control 2021, 10, 123. [Google Scholar] [CrossRef]
- Saharman, Y.R.; Karuniawati, A.; Sedono, R.; Aditianingsih, D.; Sudarmono, P.; Goessens, W.H.F.; Klaassen, C.H.W.; Verbrugh, H.A.; Severin, J.A. Endemic carbapenem-nonsusceptible Acinetobacter baumannii-calcoaceticus complex in intensive care units of the national referral hospital in Jakarta, Indonesia. Antimicrob. Resist. Infect. Control 2018, 7, 5. [Google Scholar] [CrossRef]
- Maiden, M.C.J.; van Rensburg, M.J.J.; Bray, J.E.; Earle, S.G.; Ford, S.A.; Jolley, K.A.; McCarthy, N.D. Europe PMC Funders Group Europe PMC Funders Author Manuscripts MLST revisited: The gene-by-gene approach to bacterial genomics. Nat Rev Microbiol. 2014, 11, 728–736. [Google Scholar] [CrossRef]
- Matuszewska, M.; Murray, G.G.R.; Harrison, E.M.; Holmes, M.A.; Weinert, L.A. The Evolutionary Genomics of Host Specificity in Staphylococcus aureus. Trends Microbiol. 2020, 28, 465–477. [Google Scholar] [CrossRef]
- Anggraini, D.; Santosaningsih, D.; Saharman, Y.R.; Endraswari, P.D.; Cahyarini, C.; Saptawati, L.; Hayati, Z.; Farida, H.; Siregar, C.; Pasaribu, M.; et al. Distribution of Carbapenemase Genes among Carbapenem-Non-Susceptible Acinetobacter baumanii Blood Isolates in Indonesia: A Multicenter Study. Antibiotics 2020, 11, 366. [Google Scholar] [CrossRef] [PubMed]
- Homenta, H.; Julyadharma, J.; Saharman, Y.R.; Kuntaman, K.; Susianti, H.; Santosaningsih, D.; Noorhamdani, N. Molecular characterization of clinical carbapenem-resistant Acinetobacter baumannii isolates from two tertiary care hospitals in Indonesia. Res. J. Pharm. Technol. 2022, 15, 2917–2922. [Google Scholar] [CrossRef]
- MacPherson, D.W.; Gushulak, B.D.; Baine, W.B.; Bala, S.; Gubbins, P.O.; Holtom, P.; Segarra-Newnham, M. Population mobility, globalization, and antimicrobial drug resistance. Emerg. Infect. Dis. 2009, 15, 1727–1732. [Google Scholar] [CrossRef] [PubMed]
- Johnson, J.K.; Robinson, G.L.; Zhao, L.C.; Harris, A.D.; Stine, O.C.; Thom, K.A. Comparison of molecular typing methods for the analyses of Acinetobacter baumannii from ICU patients. Diagn. Microbiol. Infect. Dis. 2016, 86, 345–350. [Google Scholar] [CrossRef] [PubMed]
- Doi, Y.; Murray, G.L.; Peleg, A.Y. Acinetobacter baumannii: Evolution of antimicrobial resistance-treatment options. Semin. Respir. Crit. Care Med. 2015, 36, 85–98. [Google Scholar] [CrossRef] [PubMed]
- El-Shazly, S.; Dashti, A.; Vali, L.; Bolaris, M.; Ibrahim, A.S. Molecular epidemiology and characterization of multiple drug-resistant (MDR) clinical isolates of Acinetobacter baumannii. Int. J. Infect. Dis. 2015, 41, 42–49. [Google Scholar] [CrossRef]
- Kim, D.H.; Choi, J.Y.; Kim, H.W.; Kim, S.H.; Chung, D.R.; Peck, K.R.; Thamlikitkul, V.; So, T.M.K.; Yasin, R.M.D.; Hsueh, P.R.; et al. Spread of carbapenem-resistant Acinetobacter baumannii global clone 2 in Asia and AbaR-type resistance islands. Antimicrob. Agents Chemother. 2013, 57, 5239–5246. [Google Scholar] [CrossRef]
- Cieslinski, J.M.; Arend, L.; Tuon, F.F.; Silva, E.P.; Ekermann, R.G.S.; Dalla-Costa, L.M.; Higgins, P.G.; Seifert, H.; Pilonetto, M. Molecular epidemiology characterization of OXA-23 carbapenemase-producing Acinetobacter baumannii isolated from 8 Brazilian hospitals using repetitive sequence-based PCR. Diagn. Microbiol. Infect. Dis. 2013, 77, 337–340. [Google Scholar] [CrossRef]
- Brehony, C.; Jolley, K.A.; Maiden, M.C.J. Multilocus sequence typing for global surveillance of meningococcal disease. FEMS Microbiol. Rev. 2007, 31, 15–26. [Google Scholar] [CrossRef]
- Kuntaman, K.; Shigemura, K.; Osawa, K.; Kitagawa, K.; Sato, K.; Yamada, N.; Nishimoto, K.; Yamamichi, F.; Rahardjo, D.; Hadi, U.; et al. Occurrence and characterization of carbapenem-resistant Gram-negative bacilli: A collaborative study of antibiotic-resistant bacteria between Indonesia and Japan. Int. J. Urol. 2018, 25, 966–972. [Google Scholar] [CrossRef]
- Wang, C.H.; Li, J.F.; Huang, L.Y.; Lin, F.M.; Yang, Y.S.; Siu, L.K.; Chang, F.Y.; Lin, J.C. Outbreak of imipenem-resistant Acinetobacter baumannii in different wards at a regional hospital related to untrained bedside caregivers. Am. J. Infect. Control 2017, 45, 1086–1090. [Google Scholar] [CrossRef] [PubMed]
- Gressner, A.M.; Arndt, T. (Eds.) Clinical and Laboratory Standards Institute. In Lexikon der Medizinischen Laboratoriums Diagnostik; Springer: Berlin/Heidelberg, Germany, 2019. [Google Scholar] [CrossRef]
- Pourcel, C.; Minandri, F.; Hauck, Y.; D’Arezzo, S.; Imperi, F.; Vergnaud, G.; Visca, P. Identification of Variable-Number Tandem-Repeat (VNTR) sequences in Acinetobacter baumannii and interlaboratory validation of an optimized multiple-locus VNTR analysis typing scheme. J. Clin. Microbiol. 2011, 49, 539–548. [Google Scholar] [CrossRef] [PubMed]
- Feil, E.J.; Li, B.C.; Aanensen, D.M.; Hanage, W.P.; Spratt, B.G. eBURST: Inferring Patterns of Evolutionary Descent among Clusters of Related Bacterial Genotypes from Multilocus Sequence Typing Data. J. Bacteriol. 2004, 186, 1518–1530. [Google Scholar] [CrossRef] [PubMed]
- Pavlopoulos, G.A.; Soldatos, T.G.; Barbosa-Silva, A.; Schneider, R. A reference guide for tree analysis and visualization. BioData Min. 2010, 3, 1. [Google Scholar] [CrossRef]
- El Bannah, A.M.S.; Nawar, N.N.; Hassan, R.M.M.; Salem, S.T.B. Molecular Epidemiology of Carbapenem-Resistant Acinetobacter baumannii in a Tertiary Care Hospital in Egypt: Clonal Spread of bla OXA-23. Microb. Drug Resist. 2017, 24, 269–277. [Google Scholar] [CrossRef]
- Abdulzahra, A.T.; Khalil, M.A.F.; Elkhatib, W.F. First report of colistin resistance among carbapenem-resistant A. baumannii isolates recovered from hospitalized patients in Egypt. New Microbes New Infect. 2018, 26, 53–58. [Google Scholar] [CrossRef]
- Khurshid, M.; Rasool, M.H.; Ashfaq, U.A.; Aslam, B.; Waseem, M.; Xu, Q.; Zhang, X.; Guo, Q.; Wang, M. Dissemination of blaOXA-23-harbouring carbapenem-resistant Acinetobacter baumannii clones in Pakistan. J. Glob. Antimicrob. Resist. 2020, 21, 357–362. [Google Scholar] [CrossRef]
- Correa, A.; Del Campo, R.; Escandón-Vargas, K.; Perenguez, M.; Rodriquez-Banos, M.; Hernández-Gómez, C.; Pallares, C.; Perez, F.; Arias, C.A.; Cantón, R.; et al. Distinct Genetic Diversity of Carbapenem-Resistant Acinetobacter baumannii from Colombian Hospitals. Microb. Drug Resist. 2018, 24, 48–54. [Google Scholar] [CrossRef]
- Bi, D.; Xie, R.; Zheng, J.; Yang, H.; Zhu, X.; Ou, H.Y.; Wei, Q. Large-Scale Identification of AbaR-Type Genomic Islands in Acinetobacter baumannii Reveals Diverse Insertion Sites and Clonal Lineage-Specific Antimicrobial Resistance Gene Profiles Dexi. Antimicrob. Agents Chemother. 2019, 63, e02526-18. [Google Scholar] [CrossRef]
- Pub-MLST Database. Available online: http://pubmlst.org/abaumannii/ (accessed on 22 January 2019).
- Jacopin, E.; Lehtinen, S.; Débarre, F.; Blanquart, F. Factors favouring the evolution of multidrug resistance in bacteria. J. R. Soc. Interface 2020, 17, 1–14. [Google Scholar] [CrossRef]
- Antunes, L.C.S.; Visca, P.; Towner, K.J. Acinetobacter baumannii: Evolution of a global pathogen. Pathog. Dis. 2014, 71, 292–301. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zhang, J.; Wang, Z.; Yin, Y.; Gao, H.; Wang, R.; Jin, L.; Wang, Q.; Zhao, C.; Wang, Z.; et al. Evolution of Acinetobacter baumannii in clinical bacteremia patients. Infect. Drug Resist. 2021, 14, 3553–3562. [Google Scholar] [CrossRef] [PubMed]
- Fournier, P.E.; Richet, H. The epidemiology and control of Acinetobacter baumannii in health care facilities. Clin. Infect. Dis. 2006, 42, 692–699. [Google Scholar] [CrossRef]
- Manchanda, V.; Sinha, S.; Singh, N. Multidrug resistant Acinetobacter. J. Glob. Infect. Dis. 2010, 2, 291–304. [Google Scholar] [CrossRef] [PubMed]
Targeted Gene | Primer Designation | Amplicon Size | Tm °C | Primer Sequence |
---|---|---|---|---|
blaKPC | blaKPC-F blaKPC-R | 798 bp | 58 | CGTCTAGTTCTGCTGTCTTG CTTGTCATCCTTGTTAGGCG |
blaNDM | blaNDM-F blaNDM-R | 621 bp | 65 | GGTTTGGCGATCTGGTTTTC CGGAATGGCTCATCACGATC |
blaOXA23 | blaOXA23-F blaOXA23-R | 501 bp | 52 | GATCGGATTGGAGAACCAGA ATTCTGACCGCATTTCCAT |
VNTR Marker | Primer Designation | Primer Sequence (5′→3′) | Annealing Temperature (°C) | Repeat Size (bp) | Size of Flanking Regions |
---|---|---|---|---|---|
Abaum-1988 | Abaum-1988-F | GGCAAGGCATGCTCAAGGGCC | 55 | 26 | 77 |
Abaum-1988-R | CAGTAGACTGCTGGTTAATGAG | 55 | |||
Abaum-3530 | Abaum-3530-F | TGCAACCGGTATTCTAGGAAC | 55 | 60 | 121 |
Abaum-3530-R | CCTTGAACAACATCGATTACTGGA | 55 | |||
Abaum-3002 | Abaum-3002-F | GACTGAAGCAAGACTAAAACGT | 55 | 57 | 121 |
Abaum-3002-R | TCTGGGCAGCTTCTTCTTGAGC | 55 | |||
Abaum-2240 | Abaum-2240-F | CCCGCAGTACATCATGGTTC | 55 | 99 | 494 |
Abaum-2240-R | AGAACATGTATACGCAACTG | 55 | |||
Abaum-0826 | Abaum-0826-F | TGACTACTGAAACAGTTTTTG | 50 | 9 | 208 |
Abaum-0826-R | ATGATTGTACCGAGTAAAAGA | 50 | |||
Abaum-2396 | Abaum-2396-F | CAAGTCCAATCAACTCATGATG | 55 | 6 | 105 |
Abaum-2396-R | CTCCTGTAAGTGCTGTTCAGCC | 55 | |||
Abaum-3468 | Abaum-3468-F | CAGAAGTCACTGCATCTGCAAC | 55 | 6 | 147 |
Abaum-3468-R | CGGTTGAAATTTTTTATAATGAAG | 55 | |||
Abaum-0845 | Abaum-0845-F | AATTTTAATTCCAAATTGCTCC | 50 | 7 | 105 |
Abaum-0845-R | ACTTAAAATCGCATTTTTATCA | 50 |
Gene | Primer Suquence | Amplicon Size |
---|---|---|
cpn60-F | ACTGTACTTGCTCAAGC | 405 bp |
cpn60-R | TTCAGCGATGATAAGAAGTGG | |
fusA-F | ATCGGTATTTCTGCKCACATYGAT | 633 bp |
fusA-R | CCAACATACKYTGWACACCTTTGTT | |
gltA-F | AATTTACAGTGGCACATTAGGTCCC | 483 bp |
gltA-R | GCAGAGATACCAGCAGAGATACACG | |
pyrG-F | GGTGTTGTTTCATCACTAGGWAAAGG | 297 bp |
pyrG-R | ATAAATGGTAAAGAYTCGATRTCACCMA | |
recA-F | CCTGAATCTTCYGGTAAAAC | 372 bp |
recA-R | GTTTCTGGGCTGCCAAACATTAC | |
rplB-F | GTAGAGCGTATTGAATACGATCCTAACC | 330 bp |
rplB-R | CACCACCACCRTGYGGGTGATC | |
rpoB-F | GGTCCTGGTGGTTTAACACG | 456 bp |
rpoB-R | CGAATAACGATACGAGAAGCA |
No. | MT | MLVA Loci | Number of Isolates (%) | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Abaum-1988 | Abaum-3530 | Abaum-3002 | Abaum-2240 | Abaum-0826 | Abaum-2396 | Abaum-3468 | Abaum-0845 | Dr. Saiful Anwar Hospital, Malang | Prof. Dr. R. D. Kandou Hospital, Manado | ||
1. | MT1 | 5 | 6 | 7 | 3 | 15 | 17 | 12 | 20 | 4 (9.3%) | |
2. | MT2 | 9 | 7 | 7 | 4 | 17 | 12 | 12 | 20 | 18 (41.9%) | 17 (56.6%) |
3. | MT3 | 5 | 6 | 8 | 3 | 17 | 22 | 12 | 22 | 21 (48.8%) | 4 (13.3%) |
3. | MT4 | 5 | 1 | 7 | 3 | 17 | 12 | 12 | 22 | 5 (16.7%) | |
5. | MT5 | 8 | 6 | 8 | 3 | - | 17 | 13 | 20 | 2 (6.7%) | |
6. | MT6 | 9 | 1 | - | - | - | 17 | 9 | 20 | 2 (6.7%) |
No. | MT | Sample Code | Locus Sequence and Allele Number | ST | CC | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|
cpn60 | fusA | gltA | pyrG | recA | rpIB | rpoB | |||||
1. | MT1 | MLG-42 | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 642 | 1 |
2. | MT2 MT2 MT2 MT2 | MLG-30 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 |
3. | MLG-41 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | |
4. | MDO-18 | 2 | 125 | 2 | 2 | 2 | 2 | 2 | 823 | 2 | |
5. | MDO-26 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | |
6. | MT3 MT3 MT3 | MLG-8 | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 642 | 1 |
7. | MLG-31 | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 642 | 1 | |
8. | MLG-32 | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 642 | 1 | |
9. | MT4 | MDO-6 | 382 | 267 | 14 | 188 | 9 | 17 | 1 | 642 | 1 |
10. | MT5 | MDO-2 | 192 | 26 | 91 | 14 | 192 | 16 | 47 | 1276 | singleton |
11. | MT6 | MDO-9 | 2 | 1 | 1 | 2 | 68 | 2 | 201 | 641 | 2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Homenta, H.; Julyadharma, J.; Susianti, H.; Noorhamdani, N.; Santosaningsih, D. Molecular Epidemiology of Clinical Carbapenem-Resistant Acinetobacter baumannii-calcoaceticus complex Isolates in Tertiary Care Hospitals in Java and Sulawesi Islands, Indonesia. Trop. Med. Infect. Dis. 2022, 7, 277. https://doi.org/10.3390/tropicalmed7100277
Homenta H, Julyadharma J, Susianti H, Noorhamdani N, Santosaningsih D. Molecular Epidemiology of Clinical Carbapenem-Resistant Acinetobacter baumannii-calcoaceticus complex Isolates in Tertiary Care Hospitals in Java and Sulawesi Islands, Indonesia. Tropical Medicine and Infectious Disease. 2022; 7(10):277. https://doi.org/10.3390/tropicalmed7100277
Chicago/Turabian StyleHomenta, Heriyannis, Julyadharma Julyadharma, Hani Susianti, Noorhamdani Noorhamdani, and Dewi Santosaningsih. 2022. "Molecular Epidemiology of Clinical Carbapenem-Resistant Acinetobacter baumannii-calcoaceticus complex Isolates in Tertiary Care Hospitals in Java and Sulawesi Islands, Indonesia" Tropical Medicine and Infectious Disease 7, no. 10: 277. https://doi.org/10.3390/tropicalmed7100277
APA StyleHomenta, H., Julyadharma, J., Susianti, H., Noorhamdani, N., & Santosaningsih, D. (2022). Molecular Epidemiology of Clinical Carbapenem-Resistant Acinetobacter baumannii-calcoaceticus complex Isolates in Tertiary Care Hospitals in Java and Sulawesi Islands, Indonesia. Tropical Medicine and Infectious Disease, 7(10), 277. https://doi.org/10.3390/tropicalmed7100277