Next Article in Journal
Effects of Dietary Chlorogenic Acid on the Growth, Lipid Metabolism, Antioxidant Capacity, and Non-Specific Immunity of Asian Swamp Eel (Monopterus albus)
Next Article in Special Issue
Dietary Alpha-Lipoic Acid Alleviated Hepatic Glycogen Deposition and Improved Inflammation Response of Largemouth Bass (Micropterus salmoides) Fed on High Dietary Carbohydrates
Previous Article in Journal
It’s Time for Dinner, a Particular and Seasonal Feeding Habit of a Threatened Troglobitic Catfish from Brazil, Rhamdiopsis krugi Bockmann & Castro 2010 (Ostaryophysi, Siluriformes)
Previous Article in Special Issue
Dietary β-1,3-Glucan Promotes Growth Performance and Enhances Non-Specific Immunity by Modulating Pattern Recognition Receptors in Juvenile Oriental River Prawn (Macrobrachium nipponense)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate

1
Department of Animal Biosciences, University of Guelph, Guelph, ON N1G 2W1, Canada
2
Department of Pathobiology, OVC, University of Guelph, Guelph, ON N1G 2W1, Canada
3
Ontario Agricultural College, University of Guelph, Guelph, ON N1G 2W1, Canada
*
Author to whom correspondence should be addressed.
Fishes 2024, 9(12), 495; https://doi.org/10.3390/fishes9120495
Submission received: 25 September 2024 / Revised: 29 November 2024 / Accepted: 29 November 2024 / Published: 2 December 2024

Abstract

As global fish consumption rises, improving fish health through immunomodulatory feed ingredients shows promise while also supporting growth performance. This study investigated the effects of yeast prebiotics, probiotics, a postbiotic (butyrate), and black soldier fly larvae (BSFL) meal on fish immune responses. Zebrafish were fed diets containing these ingredients for 63 days and then exposed to either Pseudomonas aeruginosa lipopolysaccharide (LPS) or live Flavobacterium psychrophilum to assess hepatic candidate gene expression and weight gain. No mortalities were observed post-immune challenges, and weight gains were not significantly different across treatments. Liver samples were collected for mRNA analysis, and real-time qPCR was used to evaluate the expression of immune-related genes such as TNF-α, IL-1β, hepcidin, and NF-κB/p65. NF-κB/p65 was upregulated in response to immune challenges, indicating a reaction to both LPS and pathogen exposure. Fish on the BSFL diet showed decreased NF-κB/p65 expression after the pathogen challenge, while probiotic-fed fish had reduced angiopoietin-like 4 (angptl4) levels following LPS exposure. Butyrate supplementation had the most significant impact, downregulating pro-inflammatory cytokines and other immune-related genes, suggesting a protective effect. These findings support the health benefits of BSFL and sodium butyrate during an immune challenge.
Key Contribution: Supplementation of yeast prebiotic, yeast probiotic, black soldier fly meal, and butyrate influenced the hepatic gene expression following an immune challenge. Butyrate appeared to exert the greatest anti-inflammatory response compared to the other experimental diets.

Graphical Abstract

1. Introduction

Aquaculture production has increased over the past three decades to meet the increasing demand for food fish, which has resulted in more intensive production systems, increased risk of infection and the spread of disease among fish [1]. Current disease management strategies frequently rely on antimicrobials or antibiotics, which can contribute to the development of antimicrobial resistance [2]. Recent reports have found antimicrobial resistance in several Gram-negative bacterial species, such as Pseudomonas aeruginosa and Flavobacterium psychrophilum, which significantly impact the production and cost of cultured fish species due to large mortality events caused by ulcerative syndrome and bacterial cold-water disease, respectively [3,4]. Developing strategies to reduce the dependence on antimicrobials is needed to improve fish disease resistance and produce more food for a growing human population.
Bacterial endotoxins, such as lipopolysaccharide (LPS), that make up the cell membrane of Gram-negative bacteria are often used in animal models to trigger an inflammatory response similar to an acute bacterial infection [5]. The LPS response and mechanism in zebrafish have been well documented, and hence, certain genes such as TNF-α and IL-1β are known to be induced [6]. However, LPS itself does not cause an infection, as it is not a living microbe. In contrast, the administration of live pathogens (e.g., F. psychrophilum) also imposes an immune challenge, and since they are viable, their ability to replicate and interact with the host immune system may better represent the complete pathogen–host interaction. For these reasons, studies can be conducted using LPS or live pathogen challenges at the end of a feeding trial with feed additives to assess their capacity to improve disease resistance [7].
Recent research has highlighted an important relationship between the gut microbiota and the immune system, indicating that supplementation, or alteration of the diet to support the gut environment, may also affect the immune system [5]. Hence, a search for immunomodulatory ingredients that can aid in stress resilience and disease prevention is underway, fueled by the need for innovative and affordable approaches to improve aquaculture production and animal welfare. A few common immunomodulatory ingredients that are suggested to improve the gut and immune health of fish include yeast prebiotics and probiotics, short-chain fatty acids (SCFAs) such as butyrate, and black soldier fly larvae (BSFL) meal [8,9,10,11]. In terms of BSFL, it includes several components such as chitin, antimicrobial peptides (AMPs), and lauric acid that modulate the immune system. Besides yeast prebiotics and probiotics, research on the effects of BSFL and butyrate is still limited, although they are currently being utilized in aquaculture, which further supports the need to investigate their effects on fish health [12].
The zebrafish (Danio rerio) is a freshwater fish species with a well-characterized genome that is widely recognized as a valuable model organism for studying human diseases and is increasingly being utilized in research to model aquaculture fish species, including salmonids [13]. The advantages of the zebrafish model include optical transparency during its early stages of life, rapid reproduction, a continuous and large amount of egg production, and fast development, which are not characteristics of cultured fish species such as salmonids [13,14].
This study aimed to investigate the immunomodulatory effects of diets containing yeast prebiotic, yeast probiotic, butyrate, or BSFL meal on the expression of hepatic immune and stress-relevant genes following an immune challenge with P. aeruginosa LPS or live F. psychrophilum. We hypothesized that supplementation of prebiotics, probiotics, butyrate, and BSFL meal would improve the survival of zebrafish following the immune challenges in comparison to the control by downregulating the expression of pro-inflammatory genes.

2. Materials and Methods

2.1. Diet Preparation

All 5 diets, including the control diet, were formulated to be isonitrogenous and isoenergetic, and all diets were prepared at the Department of Animal Biosciences, University of Guelph (Guelph, ON, Canada). Five dietary treatments, including fishmeal-based control, yeast prebiotic (Alltech; Nicholasville, KY, USA) and probiotic (Alltech; Nicholasville, KY, USA), sodium butyrate (Sigma-Aldrich, St. Louis, MO, USA), and defatted BSFL meal (Enterra Feed Corp., Langley, BC, Canada) diets, were tested in the present study. The diet formulations are presented in Table 1. Dry ingredients were mixed for 20 min, followed by an additional 20 min of mixing after adding in the wet ingredients (oils and water). They were then pelleted with a meat grinder with a diameter of 1 mm, oven-dried overnight, ground, and sieved to 1mm.

2.2. Zebrafish Culture

Zebrafish adults were housed in a Tecniplast system in the Hagen Aqualab at the University of Guelph at approximately 28 °C on a 12 h light/dark cycle in a recirculation system. Adult zebrafish were set up in 1.7 L Tecniplast Sloping Breeding Tanks with a barrier to separate the males and females at 3 p.m., and then they were allowed to interact at 9 a.m. the next day following the removal of the barrier. Viable eggs were subsequently collected between 2 and 3 p.m. and treated with 50 mg/mL Gentamicin reagent for 1 h at room temperature, then disinfected with 0.004% diluted bleach for 5 min and rinsed. Embryos were then maintained at a density of approximately 100 eggs per plate in egg water (60 mg/L Instant Ocean Sea Salts) at approximately 28.5 °C in an incubator. Once fish reached 5 d post fertilization (dpf), at which point yolk absorption was almost complete, the larvae were transferred to a larger tank where they were fed a diet of GEMMA Micro 75 (Skretting; Westbrook, ME, USA) three times daily. At 30 dpf, the diet was switched to GEMMA 300 (Skretting; Westbrook, ME, USA), where the fish were then fed twice daily.

2.3. Feeding Trial

Once the fish reached 3 to 4 months of age, they were transferred to a Level 2 biosecure facility within the Hagen Aqualab at the University of Guelph at approximately 27 °C on a 12 h light/dark cycle using a flow-through system. Each dietary treatment group comprised three tanks that were positioned into three water baths to ensure the tank temperatures within the room were maintained at 27 °C. Water quality was inspected daily, and ammonia levels were maintained at 0 ppm, pH levels between 7.4 to 7.8, and dissolved oxygen levels at 6 to 8 ppm. In total, 3 separate baths held 5 tanks, each representing a different dietary treatment, with 15 tanks in total. Thus, there were 3 replicate tanks per dietary treatment, containing 50 fish each (Figure 1). The fish were fed their respective diets twice a day for 63 d until satiation, and 10 weighings of different groups of five fish from each replicate tank were recorded on days 0, 10, 20, and 63 of the feeding trial.

2.4. Immune Challenge with Either P. aeruginosa Lipopolysaccharide (LPS) Endotoxin or F. psychrophilum

The LPS from P. aeruginosa was purchased from Sigma-Aldrich. A stock solution of 100 mg/mL of LPS was prepared in sterile PBS and diluted to working concentrations of 1 and 25 mg/mL with PBS. The F. psychophilum was generously provided by Dr. John Lumsden (Department of Pathobiology, University of Guelph) and cultured on Petri dishes with Cytophaga broth made from Cytophaga Broth Base (Criterion, cat. No. C7790). The pathogen challenge level was prepared by adding F. psychophilum bacterial colonies until the suspension reached a turbidity of a 0.5 McFarland standard, which is approximately 1.5 × 108 CFU/mL [15]. The challenge dose was chosen based on a previous research study that experimentally infected rainbow trout with F. psychophilum [16].
Before the immune challenges, fish were fasted for 24 h and then anesthetized by immersion with 70 mg/L tricaine methanesulfonate (MS-222) until there was a loss of equilibrium and gill movements ceased. The fish were then placed in a partially cut soft sponge soaked in water to stabilize the body during injections. Fish were intraperitoneally injected with either 10 µL of 25 mg/mL P. aeruginosa LPS, 1.5 × 108 CFU/mL F. psychrophilum, or an equivalent volume of PBS (pH 7.4) using a Hamilton Model 701 RN Syringe (0.375 in, point style 4 at 12°, 6/PK; Part-#: 207434-10 from Hamilton Company, Reno, NV, USA). After injection, the fish were placed in individually labeled plastic containers containing tank water and equipped with an air stone for 24 h to maintain dissolved oxygen levels, at which time they were then euthanized with 200 mg/L of MS-222. Livers were extracted under a dissection scope, immediately placed in a 3 L tank containing liquid nitrogen, then stored in a −80 °C freezer until RNA extraction could be performed.

2.5. RNA Extraction and cDNA Synthesis

Tissue homogenization was carried out on each sample with 1 mL of TRIzol added in 2.0 mL autoclaved tubes after the tissue samples were thawed using a PowerGen 500 Homogenizer (Fisher Scientific; Waltham, MA, USA). Total RNA was extracted from Trizol cell lysate using an RNeasy Mini Kit (Qiagen; Hilden, Germany) as per the manufacturer’s instructions. The RNA concentration was measured using a Cytation 5 spectrophotometer (BioTek; Shoreline, WA, USA). From each sample, 500 ng of total RNA was reverse-transcribed to cDNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Waltham, MA, USA).

2.6. Proximate Composition Analysis

The proximate composition of the diets was analyzed using standard methods at the Department of Animal Biosciences of the University of Guelph (Guelph, ON, Canada), and the data are presented in Table 2. Diets were ground to <1 mm. Crude lipids were determined using petroleum ether and the ANKOM XT15 Extraction System (ANKOM Technology, Macedon, NY, USA) according to the manufacturer’s instructions. Nitrogen content was determined using the LECO FP828 System (LECO Corporation, Saint Joseph, MI, USA) and then multiplied by the protein factor of 6.25 to calculate the % crude protein. Gross energy was determined using the IKA C 6000 Isoperibol oxygen bomb calorimeter (IKA Works, Inc, Wilmington, NC, USA). Ash content was determined by placing samples in a muffle furnace at 550 °C for 10 h. Moisture and dry matter were determined by placing samples in a drying oven at 105 °C for 20–24 h.

2.7. Real-Time Quantitative PCR (qPCR)

The primer sequences used for gene expression analysis were selected from previously published studies [9,17]. A list of primer sequences is provided in Table 3. Relative quantitative expression of 10 target genes, namely TNF-α, IL-1β, hepcidin, MyD88, caspase-b, PGRP, serum amyloid A (SAA), angptl4, NF-κB (p65 subunit), and cxcl8, were determined using the StepOnePlus™ Real-Time PCR System (Applied Biosystems, Burlington, ON, Canada). All qPCR reactions contained a total reaction volume of 10 μL containing 5 μL SYBR Green qPCR SuperMix, 0.5 μL of forward primer, 0.5 μL of reverse primer, 2 μL of nuclease-free water, and 2 μL of cDNA template. The PCR thermal conditions consisted of 50 °C for 2 min, 95 °C for 2 min, 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. Dissociation curves were generated at the end of PCR amplification to ensure the presence of single amplified products. The qPCR cycle threshold (Ct) values for each sample were obtained using StepOne Plus software (v2.3). 18s rRNA was used as a housekeeping gene to normalize the target genes because it was the most stable in comparison to the other tested housekeeping gene, β-actin. The fold changes were determined with the comparative CT method.

2.8. Statistical Analysis

All control diets and their respective qPCR data were analyzed using a fixed-effect model. Initially, a one-way Analysis of Variance (ANOVA) was performed to assess the effects of the immune challenges (LPS or pathogen controls versus PBS control) in terms of the fold change in gene expression. Next, a one-way ANOVA was performed to assess the effects of the dietary treatments by comparing the fold changes in gene expression between the experimental diets and control diet within the immune challenge group. Residual analysis was performed to evaluate the assumptions of normality, homogeneity of variances, and independence. Appropriate transformations such as the log transformation were used when necessary to normalize the distribution of residual error. Differences among all treatments with adjustment for multiple comparisons were determined using Tukey’s post hoc test. For the survival analysis, a Shapiro–Wilk test was performed to determine the normal distribution of the residuals, and a Levene test was used to determine normal homogeneity of the variance. Log transformations were performed on non-normal data, while ANOVA was performed to determine the significance of survival. Following this, TukeyHSD was performed to determine the differences between treatments. The qPCR data analysis was conducted using RStudio (version 2023.03.0+386), and the survival analysis was conducted using RStudio (version 2023.12.1+402). The qPCR data are presented as the least squares means +/− standard error of the mean (SEM), and the statistical sample size was n = 3. The threshold for significant differences was set at a p-value < 0.05, and trends are noted between p-values 0.10 and 0.05.

3. Results

The survival of the zebrafish ranged from 77 to 91%, but was not significant among the diets (p = 0.355). The individual survival rates for the control, BSFL meal, probiotic, yeast prebiotic, and butyrate diets were 85.3, 91, 89.3, 77.0, and 83.3%, respectively. There were no significant changes in weight observed over the 63-day feeding period amongst the diets; however, fish receiving the BSFL diet presented slightly higher final weight gain in comparison to the control diet (Figure 2). As the male and female zebrafish were not separated, and females tend to weigh more than their male counterparts, this may have contributed to the non-significance in the weight data.

3.1. Effect of Immune Challenge Between Control Groups

Nuclear factor-κB (NF-κB/p65) was significantly upregulated in the control diet within the LPS and pathogen challenge groups in comparison to the PBS-injected group (p = 0.017), indicating that fish responded to the immune challenges (Figure 3). None of the other target genes, including TNF-α, IL-1β, hepcidin, MyD88, caspase-b, PGRP, serum amyloid A (SAA), angptl4, and cxcl8, were significantly impacted at this sampling time point.

3.2. Effect of Dietary Treatments Within the PBS Subgroup

Of all the target genes, only a trend for NF-κB/p65 was noted (Figure 3). This gene was slightly upregulated in the BSFL group in comparison to the control diet (p = 0.063). The gene expression changes of TNF-α, IL-1β, hepcidin, MyD88, caspase-b, PGRP, serum amyloid A (SAA), angptl4, NF-κB (p65 subunit), and cxcl8 did not statistically differ between the yeast prebiotic, probiotic, and butyrate diet and the control diet groups within the PBS subgroup.

3.3. Effect of Dietary Treatments Within the LPS Challenge Subgroup

Of all the target genes, only a trend for angptl4 was observed (Figure 3), whereby angptl4 was slightly downregulated in the probiotic group in comparison to the LPS control (p = 0.070). The gene expression changes of TNF-α, IL-1β, hepcidin, MyD88, caspase-b, PGRP, serum amyloid A (SAA), angptl4, NF-κB (p65 subunit), and cxcl8 did not statistically differ between the yeast probiotic, BSFL meal, and butyrate diets and the control diet within the LPS subgroup.

3.4. Effect of Dietary Treatments Within the Pathogen Challenge Subgroup

In comparison to the pathogen control, the butyrate group displayed significant downregulation of TNF-α, caspase-b, IL-1b, hepcidin, NF-κB/p65, and PGRP (p < 0.050), and the BSFL group displayed significant downregulation of NF-κB/p65 (p < 0.001) (Figure 3). The gene expression changes of TNF-α, IL-1β, hepcidin, MyD88, caspase-b, PGRP, serum amyloid A (SAA), angptl4, NF-κB (p65 subunit), and cxcl8 from the yeast prebiotic and probiotic diet groups were not statistically different from the control diet within the pathogen group.

4. Discussion

This study aimed to investigate the effects of supplementary yeast prebiotic, yeast probiotic, BSFL meal, and butyrate on the hepatic immune responses of zebrafish by identifying the changes in immune- and stress-related genes following immune challenges with P. aeruginosa LPS and live F. psychrophilum pathogen.
Nutrition and diet can considerably influence health by modulating the immune system and the intimately associated gut microbiome [18]. In aquaculture and fish nutrition research, the search for fishmeal alternatives is constantly being pursued due to its unsustainability and high cost. This feeding shift is leading many researchers to explore promising ingredients such as BSFL that can be grown on organic waste and do not directly compete with human food, unlike fishmeal [19]. Additionally, as an effort to limit the acceleration of antimicrobial resistance, in recent years, there has been increasing interest in providing nutrients to production species that support optimal immune function. For example, enriching the gut microbiome with favorable yeast species such as Saccharomyces cerevisiae via probiotic and postbiotic supplementation has been shown to increase the immune response and disease resistance of fish species [8]. Sodium butyrate has also shown promising results in reducing LPS-induced zebrafish endotoxemia [9]. This study investigated the immunomodulatory properties of prebiotic yeast, probiotic yeast, butyrate, and BSFL meal in response to immune challenges using P. aeruginosa-sourced LPS and live F. psychrophilum. This study aimed to assess the host response within each dietary group by comparing the hepatic expression of immune genes to their corresponding positive control groups using qPCR, which included TNF-α, IL-1β, hepcidin, MyD88, caspase-b, PGRP, SAA, angptl4, NF-κB (p65 subunit), and cxcl8 (IL-8). The functional feed additives used in our study, including yeast prebiotic, probiotic yeast, and butyrate, were applied post-pelleting via lipid coating to preserve their stability and efficacy, a widely accepted practice in the aquaculture and animal feed industries [20]. Minor differences in total diet weight were due to the addition of small amounts of these additives, which constituted less than 1% of the diet and had negligible effects on proximate composition and nutrient balance [21]. Top-coating sensitive additives is a recommended approach for maintaining their functional integrity, as supported by product guidelines and previous studies [22]. This methodology aligns with industry standards and ensures that the observed functional effects are attributable to the presence of the additives rather than minor variations in inclusion levels.

4.1. LPS and F. psychrophilum Cause a Significant Immune Response

The control diet was compared between PBS and LPS and pathogen-challenged fish to assess whether these immune challenges were effective in eliciting an immune response. As expected, NF-κB (p65 subunit) transcription factor, which mediates inflammatory signaling, was significantly upregulated within the LPS and pathogen challenge groups (Figure 3E) [23]. This study focused on the expression of NF-κB/p65 subunit (also known as RelA), which is involved in the canonical NF-kB signaling pathway [24,25]. The canonical NF-kB pathway is receptive to a large variety of immune-related receptors, including pattern recognition receptors (PRRs) such as TLRs and PGRP, but is also known to be involved in chronic inflammatory diseases such as rheumatoid arthritis and inflammatory bowel disease through overproduction of pro-inflammatory cytokines and chemokines [5,24,25]. Although downstream inflammatory genes were not induced in this study by either immune challenge, possibly because of the chosen sampling time point or tissue, induction of NF-κB (p65 subunit) demonstrated that fish responded to the immune challenges.
The results from the LPS and pathogen challenges within the present study are in partial agreement with previous fish studies. Previous research, for example, has shown that a P. aeruginosa LPS challenge elicited the upregulation of NF-κB/p65 and PGRP in larval zebrafish and the upregulation of complement genes in adult zebrafish according to whole-body tissue analysis [9,26,27,28].
In zebrafish, the liver has been found to play an important role in the immune response, especially regarding NF-κB activity [29]. Previous studies have demonstrated NF-κB activation of zebrafish liver cells after in vitro infection with snakehead rhabdovirus (SHRV), or Edwardsiella tarda [30]. However, the expression of the other inflammatory genes, such as TNF-α, IL-1β, MyD88, PGRP, SAA, and caspase-b, did not show upregulation in this study, differing from other research results (Figure 3) [9,26,31]. These differences may be attributed to variations in bacterial strains, tissues interrogated, sampling time points, and antigen forms. Although the sample size (n = 3) may have contributed to this study’s observed variability, we took great effort to control for this by pooling 3 to 4 livers from individual fish for each sample.

4.2. BSFL Upregulated Immune Genes Following PBS Injection

In the PBS-injected fish, there was a slight upregulation of NF-κB/p65 in the BSFL meal group compared to the control group, which can be possibly attributed to the chitin in insect-derived ingredients (Figure 3E) [11,32]. A recent meta-analysis revealed that BSFL meal products significantly influenced immune response parameters such as lysozyme activity and TNF-α and IL-10 expression in some fish species, including rainbow trout and zebrafish [33]. Previous research has found that 1% chitin inclusion in the diet resulted in increased lysozyme activity as well as upregulation of IFN-γ2, IL-10, TNF-α, and NF-κB/p65 mRNA expressions in common carp (Cyprinus carpio) and grass carp (Ctenopharyngodon idella) [34,35]. However, TNF-α was not significantly upregulated by the BSFL diet group within the PBS subgroup in the present study.

4.3. Effects of Diet on LPS-Challenged Fish

To investigate the influence of yeast prebiotic, yeast probiotic, butyrate, and BSFL meal on the immune responses of zebrafish, expressions of key hepatic immune-related genes induced by P. aeruginosa-derived LPS were analyzed. In the LPS-injected fish, the probiotic diet showed a downward trend in angptl4 expression (Figure 3H). As far as we know, this is the first study to assess angptl4 expression in zebrafish fed a probiotic diet followed by an LPS challenge. Angiopoietin-like protein 4 (angptl4) regulates lipid metabolism by inhibiting the enzyme lipoprotein lipase [36]. Interestingly, angptl4 expression levels have also been correlated with social stress and anxiety in young adult zebrafish [37]. Alnassar et al. (2023), for example, observed that isolated zebrafish displaying signs of anxiety had decreased angptl4 expression, which was reversed upon reintroduction to a social group [37]. Unfortunately, we did not consider assessing fish behavior in the present study. In addition, peroxisome proliferator-activator receptor (PPAR) (PPAR)-γ, which plays a role in maintaining the homeostasis of the immune system by regulating the differentiation and polarization of various immune cells, has been identified to be an activator of angptl4 expression [36,38]. Specifically, LPS exposure reduces PPAR-γ expression via an NF-κB-dependent mechanism where, upon activation of TLR4, NF-κB drives down PPAR-γ expression [5,39]. Even though zebrafish TLR4 receptors do not recognize LPS, a significant reduction in PPARγ expression has also been observed in zebrafish exposed to LPS [40]. Thus, it is possible that the downregulated angptl4 in the current study may be attributed to LPS-mediated reduction in PPAR-γ, although we did not consider PPAR-γ when formulating our gene list.
It is unclear whether the decrease in angptl4 expression was due to LPS-induced stress or prebiotic yeast supplementation. Yeast autolysate and probiotics’ impact on stress is novel, but one study showed that zebrafish fed mannan oligosaccharide (MOS) (4 g/kg) had lower stress and anxiety without growth being affected [41]. Provided that social stress and anxiety can potentially be linked with angptl4 expression, it is possible that yeast cell wall components, such as MOS, can help alleviate stress and anxiety in zebrafish. However, this does not explain the lack of angptl4 expression changes in the prebiotic yeast group. S. cerevisiae has also been observed to influence other stress tolerance- and immune-related parameters in Nile tilapia (Oreochromis niloticus) [42,43]. In one study, researchers observed that the yeast-fed juvenile Nile tilapia exhibited greater tolerance to acute heat and hypoxia following stress challenges [43]. A different study also demonstrated downregulation of TNF-α and IL-1β expression in the liver tissue of Nile tilapia that were fed fermented S. cerevisiae [42]. However, we did not observe any significant changes in the expression of TNF-α and IL-1β expression within our yeast probiotic diet group. It is possible that these reported changes may have been due to differences in the prebiotic and probiotic form, inclusion amount, and sampling time. Overall, this study suggests that probiotic yeast has a potential influence on lipid metabolism and stress in zebrafish upon receiving LPS through the downregulation of angptl4 expression.

4.4. BSFL and Butyrate Downregulated Immune Genes After F. psychrophilum Challenge

In zebrafish, F. psychrophilum infection activates the innate immune system; prevents myeloid cell differentiation; and causes damage to the fins, muscles, and caudal peduncle, similar to signs in commercial fish species like salmonids [44,45]. In the pathogen-challenged diet groups, the BSFL diet group in the current study exhibited significant downregulation of NF-kB/p65 expression (p < 0.0001; Figure 3). The butyrate diet group also displayed significantly downregulated expression of TNF-α, caspase-b, IL-1β, hepcidin, NF-kB/p65, and PGRP (p < 0.05), with a trending decrease in SAA expression.
The 10% inclusion of defatted BSFL significantly attenuated the expression of NF-κB/p65 mRNA following a live F. psychrophilum challenge in comparison to the PBS subgroup, which experienced significantly elevated levels. Hence, it appears that in the absence of an immune challenge, the BSFL diet activated the NF-κB signaling pathway during the 63-day feeding trial period, which was then attenuated upon pathogen introduction. A recent study involving gilthead seabream (Sparus aurata) revealed that 15% inclusion of de-fatted BSFL meal significantly upregulated IL-1β and generally downregulated TNF-α at the end of a 67-day feeding trial [46]. While IL-1β and TNF-α also appeared to be downregulated by the BSFL diet in the present study, these changes were not statistically significant. Other insect meals, such as yellow mealworm (Tenebrio molitor) at 24 and 36% inclusion in the diet, have been found to significantly upregulate the expression of p65 (RelA) and MyD88 in the intestine of largemouth bass after an Edwardsiella tarda challenge [47]. While the expression of NF-κB/p65 from this study varied from others, perhaps due to timing, the overall results agree with BSF’s immune-stimulating properties. However, there is still uncertainty regarding the mechanism behind the BSFL diet’s influence on the animal’s response to F. psychrophilum, or how F. psychrophilum resulted in the downregulation of NF-κB/p65 within the BSFL diet group. In mammals, chitin is recognized by the immune system as a microbial-associated molecular pattern (MAMP) by membrane-bound pattern-recognition receptors (PRRs) on innate immune cells such as macrophages [48]. Ligation to this MAMP in turn triggers various signaling cascades to stimulate cytokine production, specifically through TLR2 and dectin-1 signaling [48]. Similarly, in zebrafish, TLR2 plays a role in the protection against bacteria such as Mycobacterium marinum and the recognition of other MAMPs such as flagellin [31,49]. In addition to TLR2, C-type lectin receptors (CLRs) are also utilized by zebrafish to recognize other types of MAMPs such as zymosans, which is a mixture of β-glucans, MOS, proteins, and chitin [50,51]. Hence, it is possible that zebrafish chitin recognition in the present study leading to activation of NF-κB is mediated by TLR2 and/or CLR [50]. This may explain the upregulation of NF-κB/p65 expression in the present study in response to the control PBS injection. Provided that chitin can activate TLR2 signaling, which is also involved in LPS recognition, it is possible that chitin exposure also leads to cross-tolerance to LPS through the chemokine receptor CXCR4, which has been previously reported to occur in response to other MAMPs [6,48,52]. Since F. psychrophilum and possibly chitin both act on TLR2, which subsequently activates the NF-κB signaling pathway, the development of chitin cross-tolerance may explain the downregulation of NF-κB/p65 expression following the pathogen challenge.
Aside from chitin, BSFL also contains antimicrobial peptides (AMPs) and fatty acids such as lauric acid (also known as dodecanoic acid), which modulate the immune system [11,53]. AMPs including attacin, cecropin, defensin, and diptericin have all been identified in black soldier flies [54,55]. Defensins have been shown to inhibit the NF-κB signaling pathway by downregulating the expression of NF-κB/p65 in immune-challenged mice models, while cecropin has been observed to significantly upregulate NF-κB/p65 [56,57]. Moreover, lauric acid has also been studied for its antimicrobial, antitumor, and anti-inflammatory activity over the years [53]. Notably, it has been observed to downregulate IL-6 and TNF-α expression and increase serum levels of anti-inflammatory cytokines such as TGF-β1 and IL-10 [58,59]. These components may explain BSFL’s influence on the inflammatory response, but further studies are needed to investigate their effects on NF-κB activation.
When examining the immune effects associated with the butyrate diet, the findings from this study demonstrate its potency in attenuating pro-inflammatory responses to F. psychrophilum. A recent study that conducted intestinal gene expression profiling of F. psychrophilum-infected rainbow trout revealed higher expression levels of TNF-α and IL-1β [60,61]. Additionally, F. psychrophilum infection incites heavy infiltration of neutrophils surrounding the eroded tissues, thereby causing unregulated production of reactive oxygen species (ROS), furthering inflammatory tissue injury [60,62]. The consensus of a profile of an infected salmonid appears to consist of excessive gene expression of IL-1β, TNF-α, and IL-10 in spleen tissue, coupled with repressed levels of transforming growth factor β (TGF-β) and tight junction-associated proteins in spleen and intestinal tissue in infected rainbow trout [60,63]. Consequently, F. psychrophilum infection eventually manifests itself in severe outcomes such as high mortality rates, skin erosion, anemia, gill hemorrhages, necrotic myositis, and septicemia despite antibiotic treatment [62,64]. In recent times, butyrate supplementation in fish has been recognized to ameliorate those pathological immune gene profiles in several studies, which is also supported by the findings from this study [9,65,66].
Butyrate immersion of zebrafish has been shown to exert anti-inflammatory effects by reducing the recruitment of neutrophils and TNF-α-positive M1 macrophage polarization at wound sites via the ortholog of the mammalian hydrocarboxylic acid receptor (hcar1) [67]. In turn, this suggests that butyrate reduces excessive ROS produced by neutrophils and the secretion of pro-inflammatory cytokines. The butyrate diet group in this study also exhibited decreased mRNA expression of TNF-α and IL-1β, which are two markers of pro-inflammatory M1 macrophages. Previous research has indicated that butyrate induces macrophage differentiation into the M2 phenotype, which is mainly involved in anti-inflammatory responses in comparison to M1 macrophages [68,69]. In future studies, it would be interesting to specifically look at macrophage polarization in butyrate-exposed zebrafish. Overall, butyrate supplementation and exposure may elicit anti-inflammatory and anti-microbial properties without exacerbating ROS-associated tissue damage, which is especially important, as fin erosion is common in F. psychrophilum pathogenesis. Furthermore, expression of hepcidin, the primary regulator of systemic iron homeostasis, was significantly downregulated [70]. F. psychrophilum infection is commonly characterized by anemia, which is heavily associated with impaired erythropoiesis, accelerated hemorrhage, or blood loss in teleost fish, as well as increased hepcidin expression [71,72]. Hepcidin is a peptide hormone primarily expressed in the liver that plays a central role in iron metabolism, and during infection, it binds to the iron exporter, ferroportin, to block the release of iron from macrophages, hepatocytes, and enterocytes, presumably to restrict iron availability to pathogens [72]. Numerous pathogenic bacteria, including F. psychrophilum, have evolved various iron acquisition mechanisms to obtain free iron from the host, which can impair iron absorption and erythropoiesis in the host, leading to a condition known as anemia of inflammation [73,74]. In a recent study, butyrate supplementation was shown to mitigate inflammation-induced anemia in mice by upregulating ferroportin, a molecular target of hepcidin that works to release iron from storage, as well as reduce TNF-α production in macrophages [75]. Thus, butyrate potentially improves iron availability by both increasing iron release through upregulation of ferroportin and decreasing iron sequestration by downregulating hepcidin. This study demonstrates that the inclusion of 0.05% sodium butyrate in the zebrafish diet significantly attenuates pro-inflammatory marker expression in response to live F. psychrophilum when compared to the challenged control diet group.

5. Conclusions

The findings from this study provide insight on the immunomodulatory properties of S. cerevisiae probiotic, BSFL meal, and butyrate when supplemented in zebrafish. The BSFL meal diet demonstrated both immunostimulatory and anti-inflammatory effects, as seen with the changes in NF-κB/p65 expression between the PBS and pathogen subgroups, which may possibly be attributed to chitins, AMPs, and lauric acid that are found in BSFL. For the LPS challenge, the probiotic diet exhibited downregulated angptl4, suggesting an influence on lipid metabolism and stress levels. Additional studies should be conducted to validate the role of angptl4 in social stress and its connection to probiotic supplementation. Lastly, sodium butyrate supplementation significantly downregulated various pro-inflammatory genes during an F. psychrophilum infection, indicating that it may have therapeutic potential in terms of BCWD or rainbow trout fry syndrome. Therefore, future studies should be carried out to investigate the mechanism behind the anti-inflammatory effects of butyrate, how BSFL or its immunomodulatory components influence pro-inflammatory markers depending on the immune status of the animal, and the immunometabolism effect of probiotics and prebiotic yeast.

Author Contributions

Conceptualization, D.H., J.S.L., U.K.S. and N.A.K.; formal analysis, U.K.S., A.B.B. and N.G.; investigation, N.G. and J.Z.; methodology, N.G., U.K.S. and J.Z.; writing—original draft, N.G.; writing—review and editing, D.H., U.K.S. and N.A.K. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by Dr. Niel Karrow’s NSERC Discovery grant (400232) and by Dr. David Huyben’s OMAFRA (UG-T1-2021-101077) and NSERC Alliance grants (ALLRP-568553-21).

Institutional Review Board Statement

All animal utilization protocols involved in this study were approved by the Animal Care Committee of the University of Guelph, Ontario, Canada (protocol code AUP # 4076).

Data Availability Statement

The datasets used and analyzed during the current study are available from the corresponding author upon request.

Acknowledgments

We would like to thank Matt Cornish and Mike Davies at the Hagen Aqualab as well as Kayla Price and Philip Lyons from Alltech for donating the prebiotic and probiotic yeast. Also, thanks to Maddie Borland, Carmi Riesenbach, Cody Anderson, and Megan Woo for their help sampling and weighing fish.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Naylor, R.; Fang, S.; Fanzo, J. A Global View of Aquaculture Policy. Food Policy 2023, 116, 102422. [Google Scholar] [CrossRef]
  2. Schar, D.; Klein, E.Y.; Laxminarayan, R.; Gilbert, M.; Van Boeckel, T.P. Global Trends in Antimicrobial Use in Aquaculture. Sci. Rep. 2020, 10, 21878. [Google Scholar] [CrossRef] [PubMed]
  3. Knupp, C.; Wiens, G.D.; Faisal, M.; Call, D.R.; Cain, K.D.; Nicolas, P.; Van Vliet, D.; Yamashita, C.; Ferguson, J.A.; Meuninck, D.; et al. Large-Scale Analysis of Flavobacterium psychrophilum Multilocus Sequence Typing Genotypes Recovered from North American Salmonids Indicates That Both Newly Identified and Recurrent Clonal Complexes Are Associated with Disease. Appl. Environ. Microbiol. 2019, 85, e02305–e02318. [Google Scholar] [CrossRef] [PubMed]
  4. Hussein, M.A.; El-tahlawy, A.S.; Abdelmoneim, H.M.; Abdallah, K.M.E.; El Bayomi, R.M. Pseudomonas aeruginosa in Fish and Fish Products: A Review on the Incidence, Public Health Significance, Virulence Factors, Antimicrobial Resistance, and Biofilm Formation. J. Adv. Vet. Res. 2023, 13, 1464–1468. [Google Scholar]
  5. Necela, B.M.; Su, W.; Thompson, E.A. Toll-like Receptor 4 Mediates Cross-talk between Peroxisome Proliferator-activated Receptor γ and Nuclear factor-κB in Macrophages. Immunology 2008, 125, 344–358. [Google Scholar] [CrossRef]
  6. Novoa, B.; Bowman, T.V.; Zon, L.; Figueras, A. LPS Response and Tolerance in the Zebrafish (Danio rerio). Fish Shellfish Immunol. 2009, 26, 326–331. [Google Scholar] [CrossRef]
  7. Landolt, M.L. The Relationship between Diet and the Immune Response of Fish. Aquaculture 1989, 79, 193–206. [Google Scholar] [CrossRef]
  8. Del Valle, J.C.; Bonadero, M.C.; Fernández-Gimenez, A.V. Saccharomyces Cerevisiae as Probiotic, Prebiotic, Synbiotic, Postbiotics and Parabiotics in Aquaculture: An Overview. Aquaculture 2023, 569, 739342. [Google Scholar] [CrossRef]
  9. Wang, M.X.; Shandilya, U.K.; Wu, X.; Huyben, D.; Karrow, N.A. Assessing Larval Zebrafish Survival and Gene Expression Following Sodium Butyrate Exposure and Subsequent Lethal Bacterial Lipopolysaccharide (LPS) Endotoxin Challenge. Toxins 2023, 15, 588. [Google Scholar] [CrossRef]
  10. Abdel-Latif, H.M.R.; Abdel-Tawwab, M.; Khalil, R.H.; Metwally, A.A.; Shakweer, M.S.; Ghetas, H.A.; Khallaf, M.A. Black Soldier Fly (Hermetia illucens) Larvae Meal in Diets of European Seabass: Effects on Antioxidative Capacity, Non-Specific Immunity, Transcriptomic Responses, and Resistance to the Challenge with Vibrio alginolyticus. Fish Shellfish Immunol. 2021, 111, 111–118. [Google Scholar] [CrossRef]
  11. Koutsos, E.; Modica, B.; Freel, T. Immunomodulatory Potential of Black Soldier Fly Larvae: Applications beyond Nutrition in Animal Feeding Programs. Transl. Anim. Sci. 2022, 6, txac084. [Google Scholar] [CrossRef]
  12. Boyd, C.E.; D’Abramo, L.R.; Glencross, B.D.; Huyben, D.C.; Juarez, L.M.; Lockwood, G.S.; McNevin, A.A.; Tacon, A.G.J.; Teletchea, F.; Tomasso, J.R.; et al. Achieving Sustainable Aquaculture: Historical and Current Perspectives and Future Needs and Challenges. J. World Aquac. Soc. 2020, 51, 578–633. [Google Scholar] [CrossRef]
  13. Jørgensen, L.V.G. Zebrafish as a Model for Fish Diseases in Aquaculture. Pathogens 2020, 9, 609. [Google Scholar] [CrossRef] [PubMed]
  14. Meyers, J.R. Zebrafish: Development of a Vertebrate Model Organism. CP Essent. Lab. Tech. 2018, 16, e19. [Google Scholar] [CrossRef]
  15. Leber, A.L. (Ed.) Clinical Microbiology Procedures Handbook, 4th ed.; ASM Press: Washington, DC, USA, 2016; ISBN 978-1-55581-880-7. [Google Scholar]
  16. Jarau, M.; MacInnes, J.I.; Lumsden, J.S. Erythromycin and Florfenicol Treatment of Rainbow Trout Oncorhynchus mykiss (Walbaum) Experimentally Infected with Flavobacterium psychrophilum. J. Fish Dis. 2019, 42, 325–334. [Google Scholar] [CrossRef]
  17. Camp, J.G.; Jazwa, A.L.; Trent, C.M.; Rawls, J.F. Intronic Cis-Regulatory Modules Mediate Tissue-Specific and Microbial Control of Angptl4/Fiaf Transcription. PLoS Genet. 2012, 8, e1002585. [Google Scholar] [CrossRef]
  18. Childs, C.E.; Calder, P.C.; Miles, E.A. Diet and Immune Function. Nutrients 2019, 11, 1933. [Google Scholar] [CrossRef]
  19. Oteri, M.; Di Rosa, A.R.; Lo Presti, V.; Giarratana, F.; Toscano, G.; Chiofalo, B. Black Soldier Fly Larvae Meal as Alternative to Fish Meal for Aquaculture Feed. Sustainability 2021, 13, 5447. [Google Scholar] [CrossRef]
  20. El-Saadony, M.T.; Alagawany, M.; Patra, A.K.; Kar, I.; Tiwari, R.; Dawood, M.A.O.; Dhama, K.; Abdel-Latif, H.M.R. The Functionality of Probiotics in Aquaculture: An Overview. Fish Shellfish Immunol. 2021, 117, 36–52. [Google Scholar] [CrossRef]
  21. Huyben, D.; Chiasson, M.; Lumsden, J.S.; Pham, P.H.; Chowdhury, M.A.K. Dietary Microencapsulated Blend of Organic Acids and Plant Essential Oils Affects Intestinal Morphology and Microbiome of Rainbow Trout (Oncorhynchus mykiss). Microorganisms 2021, 9, 2063. [Google Scholar] [CrossRef]
  22. Pech-Canul, A.D.L.C.; Ortega, D.; García-Triana, A.; González-Silva, N.; Solis-Oviedo, R.L. A Brief Review of Edible Coating Materials for the Microencapsulation of Probiotics. Coatings 2020, 10, 197. [Google Scholar] [CrossRef]
  23. Schlein, L.J.; Thamm, D.H. Review: NF-kB Activation in Canine Cancer. Vet. Pathol. 2022, 59, 724–732. [Google Scholar] [CrossRef]
  24. Ouyang, G.; Liao, Q.; Zhang, D.; Rong, F.; Cai, X.; Fan, S.; Zhu, J.; Wang, J.; Liu, X.; Liu, X.; et al. Zebrafish NF-κB/P65 Is Required for Antiviral Responses. J. Immunol. 2020, 204, 3019–3029. [Google Scholar] [CrossRef]
  25. Lawrence, T. The Nuclear Factor NF-B Pathway in Inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [PubMed]
  26. Zhou, J.; Gu, X.; Fan, X.; Zhou, Y.; Wang, H.; Si, N.; Yang, J.; Bian, B.; Zhao, H. Anti-Inflammatory and Regulatory Effects of Huanglian Jiedu Decoction on Lipid Homeostasis and the TLR4/MyD88 Signaling Pathway in LPS-Induced Zebrafish. Front. Physiol. 2019, 10, 1241. [Google Scholar] [CrossRef] [PubMed]
  27. Ko, E.-Y.; Cho, S.-H.; Kwon, S.-H.; Eom, C.-Y.; Jeong, M.S.; Lee, W.; Kim, S.-Y.; Heo, S.-J.; Ahn, G.; Lee, K.P.; et al. The Roles of NF-κB and ROS in Regulation of pro-Inflammatory Mediators of Inflammation Induction in LPS-Stimulated Zebrafish Embryos. Fish Shellfish Immunol. 2017, 68, 525–529. [Google Scholar] [CrossRef]
  28. Wang, Z.; Han, Y. Response of Gene Expression to LPS Challenge Manifests the Ontogeny and Maturation of the Complement System in Zebrafish Larvae. J. Mar. Biol. Ass. 2013, 93, 1965–1971. [Google Scholar] [CrossRef]
  29. Sullivan, C.; Kim, C.H. Zebrafish as a Model for Infectious Disease and Immune Function. Fish Shellfish Immunol. 2008, 25, 341–350. [Google Scholar] [CrossRef]
  30. Phelan, P.E.; Mellon, M.T.; Kim, C.H. Functional Characterization of Full-Length TLR3, IRAK-4, and TRAF6 in Zebrafish (Danio rerio). Mol. Immunol. 2005, 42, 1057–1071. [Google Scholar] [CrossRef]
  31. Yang, D.; Zheng, X.; Chen, S.; Wang, Z.; Xu, W.; Tan, J.; Hu, T.; Hou, M.; Wang, W.; Gu, Z.; et al. Sensing of Cytosolic LPS through Caspy2 Pyrin Domain Mediates Noncanonical Inflammasome Activation in Zebrafish. Nat. Commun. 2018, 9, 3052. [Google Scholar] [CrossRef]
  32. Nunes, C.S.; Philipps-Wiemann, P. Chitinases. In Enzymes in Human and Animal Nutrition; Elsevier: Amsterdam, The Netherlands, 2018; pp. 361–378. ISBN 978-0-12-805419-2. [Google Scholar]
  33. Xiao, Y.; Zhu, L.; Liang, R.; Su, J.; Yang, J.; Cao, X.; Lu, Y.; Yu, Y.; Hu, J. A Meta-analysis of the Effects of Black Soldier Fly Meal on Fish Immune Response and Antioxidant Capacity. Comp. Immunol. Rep. 2024, 7, 200162. [Google Scholar] [CrossRef]
  34. Gopalakannan, A.; Arul, V. Immunomodulatory Effects of Dietary Intake of Chitin, Chitosan and Levamisole on the Immune System of Cyprinus carpio and Control of Aeromonas hydrophila Infection in Ponds. Aquaculture 2006, 255, 179–187. [Google Scholar] [CrossRef]
  35. Harikrishnan, R.; Devi, G.; Van Doan, H.; Balasundaram, C.; Thamizharasan, S.; Hoseinifar, S.H.; Abdel-Tawwab, M. Effect of Diet Enriched with Agaricus bisporus Polysaccharides (ABPs) on Antioxidant Property, Innate-Adaptive Immune Response and pro-Anti Inflammatory Genes Expression in Ctenopharyngodon idella against Aeromonas hydrophila. Fish Shellfish Immunol. 2021, 114, 238–252. [Google Scholar] [CrossRef] [PubMed]
  36. Mattijssen, F.; Alex, S.; Swarts, H.J.; Groen, A.K.; Van Schothorst, E.M.; Kersten, S. Angptl4 Serves as an Endogenous Inhibitor of Intestinal Lipid Digestion. Mol. Metab. 2014, 3, 135–144. [Google Scholar] [CrossRef] [PubMed]
  37. Alnassar, N.; Hillman, C.; Fontana, B.D.; Robson, S.C.; Norton, W.H.J.; Parker, M.O. Angptl4 Gene Expression as a Marker of Adaptive Homeostatic Response to Social Isolation across the Lifespan in Zebrafish. Neurobiol. Aging 2023, 131, 209–221. [Google Scholar] [CrossRef]
  38. Christofides, A.; Konstantinidou, E.; Jani, C.; Boussiotis, V.A. The Role of Peroxisome Proliferator-Activated Receptors (PPAR) in Immune Responses. Metabolism 2021, 114, 154338. [Google Scholar] [CrossRef]
  39. Simonin, M.-A.; Bordji, K.; Boyault, S.; Bianchi, A.; Gouze, E.; Bécuwe, P.; Dauça, M.; Netter, P.; Terlain, B. PPAR-γ Ligands Modulate Effects of LPS in Stimulated Rat Synovial Fibroblasts. Am. J. Physiol. Cell Physiol. 2002, 282, C125–C133. [Google Scholar] [CrossRef]
  40. Zhang, Y.; Wang, C.; Jia, Z.; Ma, R.; Wang, X.; Chen, W.; Liu, K. Isoniazid Promotes the Anti-Inflammatory Response in Zebrafish Associated with Regulation of the PPARγ/NF-κB/AP-1 Pathway. Chem.-Biol. Interact. 2020, 316, 108928. [Google Scholar] [CrossRef]
  41. Forsatkar, M.N.; Nematollahi, M.A.; Rafiee, G.; Farahmand, H.; Martínez-Rodríguez, G. Effects of Prebiotic Mannan Oligosaccharide on the Growth, Survival, and Anxiety-like Behaviors of Zebrafish (Danio rerio). J. Appl. Aquac. 2017, 29, 183–196. [Google Scholar] [CrossRef]
  42. Abu-Elala, N.M.; Younis, N.A.; AbuBakr, H.O.; Ragaa, N.M.; Borges, L.L.; Bonato, M.A. Influence of Dietary Fermented Saccharomyces Cerevisiae on Growth Performance, Oxidative Stress Parameters, and Immune Response of Cultured Oreochromis niloticus. Fish Physiol. Biochem. 2020, 46, 533–545. [Google Scholar] [CrossRef]
  43. Abass, D.A.; Obirikorang, K.A.; Campion, B.B.; Edziyie, R.E.; Skov, P.V. Dietary Supplementation of Yeast (Saccharomyces cerevisiae) Improves Growth, Stress Tolerance, and Disease Resistance in Juvenile Nile Tilapia (Oreochromis niloticus). Aquacult. Int. 2018, 26, 843–855. [Google Scholar] [CrossRef]
  44. Avendaño-Herrera, R.; Benavides, I.; Espina, J.A.; Soto-Comte, D.; Poblete-Morales, M.; Valdés, J.A.; Feijóo, C.G.; Reyes, A.E. Zebrafish (Danio rerio) as an Animal Model for Bath Infection by Flavobacterium psychrophilum. J. Fish Dis. 2020, 43, 561–570. [Google Scholar] [CrossRef] [PubMed]
  45. Huyben, D.; Jarau, M.; MacInnes, J.; Stevenson, R.; Lumsden, J. Impact of Infection with Flavobacterium psychrophilum and Antimicrobial Treatment on the Intestinal Microbiota of Rainbow Trout. Pathogens 2023, 12, 454. [Google Scholar] [CrossRef]
  46. Moutinho, S.; Oliva-Teles, A.; Fontinha, F.; Martins, N.; Monroig, Ó.; Peres, H. Black Soldier Fly Larvae Meal as a Potential Modulator of Immune, Inflammatory, and Antioxidant Status in Gilthead Seabream Juveniles. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2024, 271, 110951. [Google Scholar] [CrossRef]
  47. Ge, C.; Liang, X.; Wu, X.; Wang, J.; Wang, H.; Qin, Y.; Xue, M. Yellow Mealworm (Tenebrio molitor) Enhances Intestinal Immunity in Largemouth Bass (Micropterus salmoides) via the NFκB/Survivin Signaling Pathway. Fish Shellfish Immunol. 2023, 136, 108736. [Google Scholar] [CrossRef]
  48. Elieh Ali Komi, D.; Sharma, L.; Dela Cruz, C.S. Chitin and Its Effects on Inflammatory and Immune Responses. Clin. Rev. Allergy Immunol. 2018, 54, 213–223. [Google Scholar] [CrossRef]
  49. Hu, W.; Yang, S.; Shimada, Y.; Münch, M.; Marín-Juez, R.; Meijer, A.H.; Spaink, H.P. Infection and RNA-Seq Analysis of a Zebrafish Tlr2 Mutant Shows a Broad Function of This Toll-like Receptor in Transcriptional and Metabolic Control and Defense to Mycobacterium marinum Infection. BMC Genom. 2019, 20, 878. [Google Scholar] [CrossRef] [PubMed]
  50. Glass, E.; Robinson, S.L.; Rosowski, E.E. Zebrafish Use Conserved CLR and TLR Signaling Pathways to Respond to Fungal PAMPs in Zymosan. bioRxiv 2024. [Google Scholar] [CrossRef] [PubMed]
  51. Takeda, K.; Akira, S. Microbial Recognition by Toll-like Receptors. J. Dermatol. Sci. 2004, 34, 73–82. [Google Scholar] [CrossRef]
  52. Novoa, B.; Figueras, A. Zebrafish: Model for the Study of Inflammation and the Innate Immune Response to Infectious Diseases. In Current Topics in Innate Immunity II; Lambris, J.D., Hajishengallis, G., Eds.; Advances in Experimental Medicine and Biology; Springer: New York, NY, USA, 2012; Volume 946, pp. 253–275. ISBN 978-1-4614-0105-6. [Google Scholar]
  53. Ameena, M.; Arumugham, M.; Ramalingam, K.; Shanmugam, R. Biomedical Applications of Lauric Acid: A Narrative Review. Cureus 2024, 16, e62770. [Google Scholar] [CrossRef]
  54. Vogel, H.; Müller, A.; Heckel, D.G.; Gutzeit, H.; Vilcinskas, A. Nutritional Immunology: Diversification and Diet-Dependent Expression of Antimicrobial Peptides in the Black Soldier Fly Hermetia illucens. Dev. Comp. Immunol. 2018, 78, 141–148. [Google Scholar] [CrossRef] [PubMed]
  55. Vogel, M.; Shah, P.N.; Voulgari-Kokota, A.; Maistrou, S.; Aartsma, Y.; Beukeboom, L.W.; Salles, J.F.; Van Loon, J.J.A.; Dicke, M.; Wertheim, B. Health of the Black Soldier Fly and House Fly under Mass-Rearing Conditions: Innate Immunity and the Role of the Microbiome. J. Insects Food Feed. 2022, 8, 857–878. [Google Scholar] [CrossRef]
  56. Zeng, L.; Tan, J.; Xue, M.; Liu, L.; Wang, M.; Liang, L.; Deng, J.; Chen, W.; Chen, Y. An Engineering Probiotic Producing Defensin-5 Ameliorating Dextran Sodium Sulfate-Induced Mice Colitis via Inhibiting NF-kB Pathway. J. Transl. Med. 2020, 18, 107. [Google Scholar] [CrossRef]
  57. Zhou, X.; Li, X.; Wang, X.; Jin, X.; Shi, D.; Wang, J.; Bi, D. Cecropin B Represses CYP3A29 Expression through Activation of the TLR2/4-NF-κB/PXR Signaling Pathway. Sci. Rep. 2016, 6, 27876. [Google Scholar] [CrossRef]
  58. Wang, Y.; Abdullah; Zhong, H.; Wang, J.; Feng, F. Dietary Glycerol Monolaurate Improved the Growth, Activity of Digestive Enzymes and Gut Microbiota in Zebrafish (Danio rerio). Aquac. Rep. 2021, 20, 100670. [Google Scholar] [CrossRef]
  59. Sypniewski, J.; Kierończyk, B.; Benzertiha, A.; Mikołajczak, Z.; Pruszyńska-Oszmałek, E.; Kołodziejski, P.; Sassek, M.; Rawski, M.; Czekała, W.; Józefiak, D. Replacement of Soybean Oil by Hermetia illucens Fat in Turkey Nutrition: Effect on Performance, Digestibility, Microbial Community, Immune and Physiological Status and Final Product Quality. Br. Poult. Sci. 2020, 61, 294–302. [Google Scholar] [CrossRef]
  60. Deng, F.; Wang, D.; Yu, Y.; Lu, T.; Li, S. Systemic Immune Response of Rainbow Trout Exposed to Flavobacterium psychrophilum Infection. Fish Shellfish Immunol. 2024, 144, 109305. [Google Scholar] [CrossRef] [PubMed]
  61. Muñoz-Atienza, E.; Távara, C.; Díaz-Rosales, P.; Llanco, L.; Serrano-Martínez, E.; Tafalla, C. Local Regulation of Immune Genes in Rainbow Trout (Oncorhynchus mykiss) Naturally Infected with Flavobacterium psychrophilum. Fish Shellfish. Immunol. 2019, 86, 25–34. [Google Scholar] [CrossRef]
  62. Nilsen, H.; Johansen, R.; Colquhoun, D.; Kaada, I.; Bottolfsen, K.; Vågnes, Ø.; Olsen, A. Flavobacterium Psychrophilum Associated with Septicaemia and Necrotic myositis in Atlantic Salmon Salmo Salar: A Case Report. Dis. Aquat. Org. 2011, 97, 37–46. [Google Scholar] [CrossRef]
  63. Orieux, N.; Douet, D.-G.; Le Hénaff, M.; Bourdineaud, J.-P. Prevalence of Flavobacterium psychrophilum Bacterial Cells in Farmed Rainbow Trout: Characterization of Metallothionein A and Interleukin1-β Genes as Markers Overexpressed in Spleen and Kidney of Diseased Fish. Vet. Microbiol. 2013, 162, 127–135. [Google Scholar] [CrossRef]
  64. Nematollahi, A.; Decostere, A.; Pasmans, F.; Haesebrouck, F. Flavobacterium psychrophilum infections in Salmonid Fish. J. Fish Dis. 2003, 26, 563–574. [Google Scholar] [CrossRef] [PubMed]
  65. Mirghaed, A.T.; Yarahmadi, P.; Soltani, M.; Paknejad, H.; Hoseini, S.M. Dietary Sodium Butyrate (Butirex® C4) Supplementation Modulates Intestinal Transcriptomic Responses and Augments Disease Resistance of Rainbow Trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2019, 92, 621–628. [Google Scholar] [CrossRef] [PubMed]
  66. Tian, L.; Zhou, X.-Q.; Jiang, W.-D.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Tang, W.-N.; Zhang, Y.-A.; et al. Sodium Butyrate Improved Intestinal Immune Function Associated with NF-κB and p38MAPK Signalling Pathways in Young Grass Carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2017, 66, 548–563. [Google Scholar] [CrossRef] [PubMed]
  67. Cholan, P.M.; Han, A.; Woodie, B.R.; Watchon, M.; Kurz, A.R.; Laird, A.S.; Britton, W.J.; Ye, L.; Holmes, Z.C.; McCann, J.R.; et al. Conserved Anti-Inflammatory Effects and Sensing of Butyrate in Zebrafish. Gut Microbes 2020, 12, 1824563. [Google Scholar] [CrossRef]
  68. Ji, J.; Shu, D.; Zheng, M.; Wang, J.; Luo, C.; Wang, Y.; Guo, F.; Zou, X.; Lv, X.; Li, Y.; et al. Microbial Metabolite Butyrate Facilitates M2 Macrophage Polarization and Function. Sci. Rep. 2016, 6, 24838. [Google Scholar] [CrossRef]
  69. Schulthess, J.; Pandey, S.; Capitani, M.; Rue-Albrecht, K.C.; Arnold, I.; Franchini, F.; Chomka, A.; Ilott, N.E.; Johnston, D.G.W.; Pires, E.; et al. The Short Chain Fatty Acid Butyrate Imprints an Antimicrobial Program in Macrophages. Immunity 2019, 50, 432–445.e7. [Google Scholar] [CrossRef] [PubMed]
  70. Pagani, A.; Nai, A.; Silvestri, L.; Camaschella, C. Hepcidin and Anemia: A Tight Relationship. Front. Physiol. 2019, 10, 1294. [Google Scholar] [CrossRef]
  71. Clauss, T.M.; Dove, A.D.M.; Arnold, J.E. Hematologic Disorders of Fish. Vet. Clin. N. Am. Exot. Anim. Pract. 2008, 11, 445–462. [Google Scholar] [CrossRef]
  72. Neves, J.V.; Caldas, C.; Ramos, M.F.; Rodrigues, P.N.S. Hepcidin-Dependent Regulation of Erythropoiesis during Anemia in a Teleost Fish, Dicentrarchus labrax. PLoS ONE 2016, 11, e0153940. [Google Scholar] [CrossRef]
  73. Vaibarová, V.; Čížek, A. Supposed Virulence Factors of Flavobacterium psychrophilum: A Review. Fishes 2024, 9, 163. [Google Scholar] [CrossRef]
  74. Liu, M.; Hu, R.; Li, W.; Yang, W.; Xu, Q.; Chen, L. Identification of Antibacterial Activity of Hepcidin From Antarctic Notothenioid Fish. Front. Microbiol. 2022, 13, 834477. [Google Scholar] [CrossRef] [PubMed]
  75. Xiao, P.; Cai, X.; Zhang, Z.; Guo, K.; Ke, Y.; Hu, Z.; Song, Z.; Zhao, Y.; Yao, L.; Shen, M.; et al. Butyrate Prevents the Pathogenic Anemia-Inflammation Circuit by Facilitating Macrophage Iron Export. Adv. Sci. 2024, 11, 2306571. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Experimental timeline illustrating the 63-day zebrafish feeding trial with five diets (control, black soldier fly larvae meal (BSFL), yeast probiotic or prebiotic, and sodium butyrate) followed by a 24 h immune challenge with 25 mg/mL Pseudomonas aeruginosa lipopolysaccharide (LPS) or 1.5 × 108 CFU/mL of the live pathogen Flavobacterium psychrophilum. After the immune challenge, qPCR was conducted on liver tissue samples to assess changes in the expression of hepatic TNF-α, IL-1β, hepcidin, MyD88, caspase-b, PGRP, serum amyloid A (SAA), angptl4, NF-κB (p65 subunit), and cxcl8. The sample size was 3 replicates (n = 3) of 3–4 pooled livers per subgroup (PBS, LPS or pathogen) per dietary treatment. Created in BioRender.com.
Figure 1. Experimental timeline illustrating the 63-day zebrafish feeding trial with five diets (control, black soldier fly larvae meal (BSFL), yeast probiotic or prebiotic, and sodium butyrate) followed by a 24 h immune challenge with 25 mg/mL Pseudomonas aeruginosa lipopolysaccharide (LPS) or 1.5 × 108 CFU/mL of the live pathogen Flavobacterium psychrophilum. After the immune challenge, qPCR was conducted on liver tissue samples to assess changes in the expression of hepatic TNF-α, IL-1β, hepcidin, MyD88, caspase-b, PGRP, serum amyloid A (SAA), angptl4, NF-κB (p65 subunit), and cxcl8. The sample size was 3 replicates (n = 3) of 3–4 pooled livers per subgroup (PBS, LPS or pathogen) per dietary treatment. Created in BioRender.com.
Fishes 09 00495 g001
Figure 2. Average weights of adult zebrafish fed the control, prebiotic yeast, yeast probiotic, butyrate, and black soldier fly larvae (BSFL) meal dietary treatments measured on days 0, 20, 40, and 63 (p > 0.05). Each point is an average weight of the 3 replicate tanks for each diet. Data are expressed as mean ± SD, n = 3.
Figure 2. Average weights of adult zebrafish fed the control, prebiotic yeast, yeast probiotic, butyrate, and black soldier fly larvae (BSFL) meal dietary treatments measured on days 0, 20, 40, and 63 (p > 0.05). Each point is an average weight of the 3 replicate tanks for each diet. Data are expressed as mean ± SD, n = 3.
Fishes 09 00495 g002
Figure 3. Expression of immune-relevant cytokine and protein genes relative to the housekeeping gene, 18s rRNA, following the 63-day zebrafish feeding trial of five diets (control, black soldier fly larvae (BSFL) meal, yeast probiotic, prebiotic yeast, and sodium butyrate) after a 24 h immune challenge with Pseudomonas aeruginosa lipopolysaccharide (LPS) or live Flavobacterium psychrophilum (pathogen). (A,B) The relative expression levels of pro-inflammatory cytokines, TNF-alpha and IL-1β. (C,D) The relative expression of the acute phase proteins, hepcidin and serum amyloid A in liver cells. (E) The relative expression level of the transcription factor, NF-κB/p65. (F) The relative expression level of the pattern recognition receptor protein, PGRP (peptidoglycan recognition protein). (G) The relative expression level of the protease, caspase-b. (H) The relative expression level of the protein, angptl4 (angiopoietin-like 4). The sample size comprised 3 replicates (n = 3) of 3–4 pooled livers per subgroup (PBS, LPS or pathogen) per dietary treatment. Data are expressed as least square means ± SEM. In terms of significance, trends between p-values 0.10 and 0.05 are specifically noted, p-values < 0.05 are indicated by *, and p-values < 0.001 are indicated by ***.
Figure 3. Expression of immune-relevant cytokine and protein genes relative to the housekeeping gene, 18s rRNA, following the 63-day zebrafish feeding trial of five diets (control, black soldier fly larvae (BSFL) meal, yeast probiotic, prebiotic yeast, and sodium butyrate) after a 24 h immune challenge with Pseudomonas aeruginosa lipopolysaccharide (LPS) or live Flavobacterium psychrophilum (pathogen). (A,B) The relative expression levels of pro-inflammatory cytokines, TNF-alpha and IL-1β. (C,D) The relative expression of the acute phase proteins, hepcidin and serum amyloid A in liver cells. (E) The relative expression level of the transcription factor, NF-κB/p65. (F) The relative expression level of the pattern recognition receptor protein, PGRP (peptidoglycan recognition protein). (G) The relative expression level of the protease, caspase-b. (H) The relative expression level of the protein, angptl4 (angiopoietin-like 4). The sample size comprised 3 replicates (n = 3) of 3–4 pooled livers per subgroup (PBS, LPS or pathogen) per dietary treatment. Data are expressed as least square means ± SEM. In terms of significance, trends between p-values 0.10 and 0.05 are specifically noted, p-values < 0.05 are indicated by *, and p-values < 0.001 are indicated by ***.
Fishes 09 00495 g003
Table 1. Formulated dietary composition (g/kg on a wet matter basis) for the control, black soldier fly larvae (BSFL), yeast probiotic and prebiotic, and butyrate diets fed to juvenile and adult zebrafish.
Table 1. Formulated dietary composition (g/kg on a wet matter basis) for the control, black soldier fly larvae (BSFL), yeast probiotic and prebiotic, and butyrate diets fed to juvenile and adult zebrafish.
Ingredients (g/kg)Control BSFL Meal ProbioticYeast PrebioticButyrate
Fishmeal, 68% CP300223300300300
Wheat Flour180180180180180
Soybean meal, 48% CP170170170170170
Poultry by-product meal, 62% CP100100100100100
BSF larvae, defatted, Enterra 100
Probiotic yeast, Alltech 10
Prebiotic yeast, Alltech 2
Sodium butyrate (SCFA), Sigma 0.5
Blood meal, porcine7070707070
Starch, corn9879989898
Fish oil, herring3535353535
Canola oil3430343434
Vitamin and mineral premix (DSM)55555
Vitamin E33333
Choline chloride33333
Limestone11111
NaCl11111
DL-Met0.510.50.50.5
Table 2. Proximate composition of diets based on the control, black soldier fly larvae (BSFL) meal, yeast prebiotic and probiotic, and butyrate diet.
Table 2. Proximate composition of diets based on the control, black soldier fly larvae (BSFL) meal, yeast prebiotic and probiotic, and butyrate diet.
Proximate CompositionUnit Control BSFL Meal ProbioticYeast PrebioticButyrate
Dry matter%96.696.696.896.596.6
Crude protein (CP)%46.846.346.946.945.4
Crude lipid (CL)%12.112.812.511.912.6
Ash%9.89.19.79.810.3
Carbohydrate%28.028.527.727.928.2
Gross energy (GE)GE21.021.020.821.020.8
Table 3. Forward and reverse primer sequences of zebrafish housekeeping and immune- and stress-related target genes. The annealing temperature for all primers was 60 °C.
Table 3. Forward and reverse primer sequences of zebrafish housekeeping and immune- and stress-related target genes. The annealing temperature for all primers was 60 °C.
GenePrimerSequence 5′-3′Accession No.
18S ribosomal RNA (18s rRNA/housekeeping gene)FTCGCTAGTTGGCATCGTTTATGBX296557.35
RCGGAGGTTCGAAGACGATCA
Tumor necrosis factor alpha (TNF-α)FAGGCAATTTCACTTCCAAGGNM_212859
RAGGTCTTTGATTCAGAGTTGTATCC
Interleukin 1 beta (IL-1β)FATGCTCATGGCGAACGTCNM_212844
RTGGTTTTAGTGTAAGACGGCACT
HepcidinFCACAGCCGTTCCCTTCATACNM_205583.2
RTCAGATGTTGGTTCTCCTGC
Myeloid differentiation primary response 88 (MyD88)FTCCACAGGGACTGACACCTGAGANM_212814
RGCTGAGTCTTCAGCACAGCAGAT
Caspase-bFATGGAGGATATTACCCAGNM_152884
RTCACAGTCCAGGAAAC
Peptidoglycan recognition protein (PGRP)FATGGGACGGTGTATGAAGGCNM_001044321.1
RAGCATTGAGGTTGCCCATGA
Serum Amlyloid A (SAA)FCGGGGTCCTGGGGGCTATTGNM_001005599.1
RGTTGGGGTCTCCGCCGTTTC
Nuclear factor kappa B p65 subunit (NF-κB/p65)FCCTACGGCTAAACGAACTCTACXM_005170796.4
RGACATGGCCTGCAGATACTT
CXC motif chemokine ligand 8 (CXCL8/IL-8)FCCAGCTGAACTGAGCTCCTCXM_001342570
RGGAGATCTGTCTGGACCCCT
Angitopoietin-like 4 (Angptl4)FCGAGCGCATCAAGCAACAJN606312–JN606321
RTCGCTCGTTTTTCATCGTAATCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gao, N.; Zhang, J.; Shandilya, U.K.; Lumsden, J.S.; Barzrgar, A.B.; Huyben, D.; Karrow, N.A. Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate. Fishes 2024, 9, 495. https://doi.org/10.3390/fishes9120495

AMA Style

Gao N, Zhang J, Shandilya UK, Lumsden JS, Barzrgar AB, Huyben D, Karrow NA. Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate. Fishes. 2024; 9(12):495. https://doi.org/10.3390/fishes9120495

Chicago/Turabian Style

Gao, Nancy, Junyu Zhang, Umesh K. Shandilya, John S. Lumsden, Amir Behzad Barzrgar, David Huyben, and Niel A. Karrow. 2024. "Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate" Fishes 9, no. 12: 495. https://doi.org/10.3390/fishes9120495

APA Style

Gao, N., Zhang, J., Shandilya, U. K., Lumsden, J. S., Barzrgar, A. B., Huyben, D., & Karrow, N. A. (2024). Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate. Fishes, 9(12), 495. https://doi.org/10.3390/fishes9120495

Article Metrics

Back to TopTop