Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate
Abstract
1. Introduction
2. Materials and Methods
2.1. Diet Preparation
2.2. Zebrafish Culture
2.3. Feeding Trial
2.4. Immune Challenge with Either P. aeruginosa Lipopolysaccharide (LPS) Endotoxin or F. psychrophilum
2.5. RNA Extraction and cDNA Synthesis
2.6. Proximate Composition Analysis
2.7. Real-Time Quantitative PCR (qPCR)
2.8. Statistical Analysis
3. Results
3.1. Effect of Immune Challenge Between Control Groups
3.2. Effect of Dietary Treatments Within the PBS Subgroup
3.3. Effect of Dietary Treatments Within the LPS Challenge Subgroup
3.4. Effect of Dietary Treatments Within the Pathogen Challenge Subgroup
4. Discussion
4.1. LPS and F. psychrophilum Cause a Significant Immune Response
4.2. BSFL Upregulated Immune Genes Following PBS Injection
4.3. Effects of Diet on LPS-Challenged Fish
4.4. BSFL and Butyrate Downregulated Immune Genes After F. psychrophilum Challenge
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Naylor, R.; Fang, S.; Fanzo, J. A Global View of Aquaculture Policy. Food Policy 2023, 116, 102422. [Google Scholar] [CrossRef]
- Schar, D.; Klein, E.Y.; Laxminarayan, R.; Gilbert, M.; Van Boeckel, T.P. Global Trends in Antimicrobial Use in Aquaculture. Sci. Rep. 2020, 10, 21878. [Google Scholar] [CrossRef] [PubMed]
- Knupp, C.; Wiens, G.D.; Faisal, M.; Call, D.R.; Cain, K.D.; Nicolas, P.; Van Vliet, D.; Yamashita, C.; Ferguson, J.A.; Meuninck, D.; et al. Large-Scale Analysis of Flavobacterium psychrophilum Multilocus Sequence Typing Genotypes Recovered from North American Salmonids Indicates That Both Newly Identified and Recurrent Clonal Complexes Are Associated with Disease. Appl. Environ. Microbiol. 2019, 85, e02305–e02318. [Google Scholar] [CrossRef] [PubMed]
- Hussein, M.A.; El-tahlawy, A.S.; Abdelmoneim, H.M.; Abdallah, K.M.E.; El Bayomi, R.M. Pseudomonas aeruginosa in Fish and Fish Products: A Review on the Incidence, Public Health Significance, Virulence Factors, Antimicrobial Resistance, and Biofilm Formation. J. Adv. Vet. Res. 2023, 13, 1464–1468. [Google Scholar]
- Necela, B.M.; Su, W.; Thompson, E.A. Toll-like Receptor 4 Mediates Cross-talk between Peroxisome Proliferator-activated Receptor γ and Nuclear factor-κB in Macrophages. Immunology 2008, 125, 344–358. [Google Scholar] [CrossRef]
- Novoa, B.; Bowman, T.V.; Zon, L.; Figueras, A. LPS Response and Tolerance in the Zebrafish (Danio rerio). Fish Shellfish Immunol. 2009, 26, 326–331. [Google Scholar] [CrossRef]
- Landolt, M.L. The Relationship between Diet and the Immune Response of Fish. Aquaculture 1989, 79, 193–206. [Google Scholar] [CrossRef]
- Del Valle, J.C.; Bonadero, M.C.; Fernández-Gimenez, A.V. Saccharomyces Cerevisiae as Probiotic, Prebiotic, Synbiotic, Postbiotics and Parabiotics in Aquaculture: An Overview. Aquaculture 2023, 569, 739342. [Google Scholar] [CrossRef]
- Wang, M.X.; Shandilya, U.K.; Wu, X.; Huyben, D.; Karrow, N.A. Assessing Larval Zebrafish Survival and Gene Expression Following Sodium Butyrate Exposure and Subsequent Lethal Bacterial Lipopolysaccharide (LPS) Endotoxin Challenge. Toxins 2023, 15, 588. [Google Scholar] [CrossRef]
- Abdel-Latif, H.M.R.; Abdel-Tawwab, M.; Khalil, R.H.; Metwally, A.A.; Shakweer, M.S.; Ghetas, H.A.; Khallaf, M.A. Black Soldier Fly (Hermetia illucens) Larvae Meal in Diets of European Seabass: Effects on Antioxidative Capacity, Non-Specific Immunity, Transcriptomic Responses, and Resistance to the Challenge with Vibrio alginolyticus. Fish Shellfish Immunol. 2021, 111, 111–118. [Google Scholar] [CrossRef]
- Koutsos, E.; Modica, B.; Freel, T. Immunomodulatory Potential of Black Soldier Fly Larvae: Applications beyond Nutrition in Animal Feeding Programs. Transl. Anim. Sci. 2022, 6, txac084. [Google Scholar] [CrossRef]
- Boyd, C.E.; D’Abramo, L.R.; Glencross, B.D.; Huyben, D.C.; Juarez, L.M.; Lockwood, G.S.; McNevin, A.A.; Tacon, A.G.J.; Teletchea, F.; Tomasso, J.R.; et al. Achieving Sustainable Aquaculture: Historical and Current Perspectives and Future Needs and Challenges. J. World Aquac. Soc. 2020, 51, 578–633. [Google Scholar] [CrossRef]
- Jørgensen, L.V.G. Zebrafish as a Model for Fish Diseases in Aquaculture. Pathogens 2020, 9, 609. [Google Scholar] [CrossRef] [PubMed]
- Meyers, J.R. Zebrafish: Development of a Vertebrate Model Organism. CP Essent. Lab. Tech. 2018, 16, e19. [Google Scholar] [CrossRef]
- Leber, A.L. (Ed.) Clinical Microbiology Procedures Handbook, 4th ed.; ASM Press: Washington, DC, USA, 2016; ISBN 978-1-55581-880-7. [Google Scholar]
- Jarau, M.; MacInnes, J.I.; Lumsden, J.S. Erythromycin and Florfenicol Treatment of Rainbow Trout Oncorhynchus mykiss (Walbaum) Experimentally Infected with Flavobacterium psychrophilum. J. Fish Dis. 2019, 42, 325–334. [Google Scholar] [CrossRef]
- Camp, J.G.; Jazwa, A.L.; Trent, C.M.; Rawls, J.F. Intronic Cis-Regulatory Modules Mediate Tissue-Specific and Microbial Control of Angptl4/Fiaf Transcription. PLoS Genet. 2012, 8, e1002585. [Google Scholar] [CrossRef]
- Childs, C.E.; Calder, P.C.; Miles, E.A. Diet and Immune Function. Nutrients 2019, 11, 1933. [Google Scholar] [CrossRef]
- Oteri, M.; Di Rosa, A.R.; Lo Presti, V.; Giarratana, F.; Toscano, G.; Chiofalo, B. Black Soldier Fly Larvae Meal as Alternative to Fish Meal for Aquaculture Feed. Sustainability 2021, 13, 5447. [Google Scholar] [CrossRef]
- El-Saadony, M.T.; Alagawany, M.; Patra, A.K.; Kar, I.; Tiwari, R.; Dawood, M.A.O.; Dhama, K.; Abdel-Latif, H.M.R. The Functionality of Probiotics in Aquaculture: An Overview. Fish Shellfish Immunol. 2021, 117, 36–52. [Google Scholar] [CrossRef]
- Huyben, D.; Chiasson, M.; Lumsden, J.S.; Pham, P.H.; Chowdhury, M.A.K. Dietary Microencapsulated Blend of Organic Acids and Plant Essential Oils Affects Intestinal Morphology and Microbiome of Rainbow Trout (Oncorhynchus mykiss). Microorganisms 2021, 9, 2063. [Google Scholar] [CrossRef]
- Pech-Canul, A.D.L.C.; Ortega, D.; García-Triana, A.; González-Silva, N.; Solis-Oviedo, R.L. A Brief Review of Edible Coating Materials for the Microencapsulation of Probiotics. Coatings 2020, 10, 197. [Google Scholar] [CrossRef]
- Schlein, L.J.; Thamm, D.H. Review: NF-kB Activation in Canine Cancer. Vet. Pathol. 2022, 59, 724–732. [Google Scholar] [CrossRef]
- Ouyang, G.; Liao, Q.; Zhang, D.; Rong, F.; Cai, X.; Fan, S.; Zhu, J.; Wang, J.; Liu, X.; Liu, X.; et al. Zebrafish NF-κB/P65 Is Required for Antiviral Responses. J. Immunol. 2020, 204, 3019–3029. [Google Scholar] [CrossRef]
- Lawrence, T. The Nuclear Factor NF-B Pathway in Inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Gu, X.; Fan, X.; Zhou, Y.; Wang, H.; Si, N.; Yang, J.; Bian, B.; Zhao, H. Anti-Inflammatory and Regulatory Effects of Huanglian Jiedu Decoction on Lipid Homeostasis and the TLR4/MyD88 Signaling Pathway in LPS-Induced Zebrafish. Front. Physiol. 2019, 10, 1241. [Google Scholar] [CrossRef] [PubMed]
- Ko, E.-Y.; Cho, S.-H.; Kwon, S.-H.; Eom, C.-Y.; Jeong, M.S.; Lee, W.; Kim, S.-Y.; Heo, S.-J.; Ahn, G.; Lee, K.P.; et al. The Roles of NF-κB and ROS in Regulation of pro-Inflammatory Mediators of Inflammation Induction in LPS-Stimulated Zebrafish Embryos. Fish Shellfish Immunol. 2017, 68, 525–529. [Google Scholar] [CrossRef]
- Wang, Z.; Han, Y. Response of Gene Expression to LPS Challenge Manifests the Ontogeny and Maturation of the Complement System in Zebrafish Larvae. J. Mar. Biol. Ass. 2013, 93, 1965–1971. [Google Scholar] [CrossRef]
- Sullivan, C.; Kim, C.H. Zebrafish as a Model for Infectious Disease and Immune Function. Fish Shellfish Immunol. 2008, 25, 341–350. [Google Scholar] [CrossRef]
- Phelan, P.E.; Mellon, M.T.; Kim, C.H. Functional Characterization of Full-Length TLR3, IRAK-4, and TRAF6 in Zebrafish (Danio rerio). Mol. Immunol. 2005, 42, 1057–1071. [Google Scholar] [CrossRef]
- Yang, D.; Zheng, X.; Chen, S.; Wang, Z.; Xu, W.; Tan, J.; Hu, T.; Hou, M.; Wang, W.; Gu, Z.; et al. Sensing of Cytosolic LPS through Caspy2 Pyrin Domain Mediates Noncanonical Inflammasome Activation in Zebrafish. Nat. Commun. 2018, 9, 3052. [Google Scholar] [CrossRef]
- Nunes, C.S.; Philipps-Wiemann, P. Chitinases. In Enzymes in Human and Animal Nutrition; Elsevier: Amsterdam, The Netherlands, 2018; pp. 361–378. ISBN 978-0-12-805419-2. [Google Scholar]
- Xiao, Y.; Zhu, L.; Liang, R.; Su, J.; Yang, J.; Cao, X.; Lu, Y.; Yu, Y.; Hu, J. A Meta-analysis of the Effects of Black Soldier Fly Meal on Fish Immune Response and Antioxidant Capacity. Comp. Immunol. Rep. 2024, 7, 200162. [Google Scholar] [CrossRef]
- Gopalakannan, A.; Arul, V. Immunomodulatory Effects of Dietary Intake of Chitin, Chitosan and Levamisole on the Immune System of Cyprinus carpio and Control of Aeromonas hydrophila Infection in Ponds. Aquaculture 2006, 255, 179–187. [Google Scholar] [CrossRef]
- Harikrishnan, R.; Devi, G.; Van Doan, H.; Balasundaram, C.; Thamizharasan, S.; Hoseinifar, S.H.; Abdel-Tawwab, M. Effect of Diet Enriched with Agaricus bisporus Polysaccharides (ABPs) on Antioxidant Property, Innate-Adaptive Immune Response and pro-Anti Inflammatory Genes Expression in Ctenopharyngodon idella against Aeromonas hydrophila. Fish Shellfish Immunol. 2021, 114, 238–252. [Google Scholar] [CrossRef] [PubMed]
- Mattijssen, F.; Alex, S.; Swarts, H.J.; Groen, A.K.; Van Schothorst, E.M.; Kersten, S. Angptl4 Serves as an Endogenous Inhibitor of Intestinal Lipid Digestion. Mol. Metab. 2014, 3, 135–144. [Google Scholar] [CrossRef] [PubMed]
- Alnassar, N.; Hillman, C.; Fontana, B.D.; Robson, S.C.; Norton, W.H.J.; Parker, M.O. Angptl4 Gene Expression as a Marker of Adaptive Homeostatic Response to Social Isolation across the Lifespan in Zebrafish. Neurobiol. Aging 2023, 131, 209–221. [Google Scholar] [CrossRef]
- Christofides, A.; Konstantinidou, E.; Jani, C.; Boussiotis, V.A. The Role of Peroxisome Proliferator-Activated Receptors (PPAR) in Immune Responses. Metabolism 2021, 114, 154338. [Google Scholar] [CrossRef]
- Simonin, M.-A.; Bordji, K.; Boyault, S.; Bianchi, A.; Gouze, E.; Bécuwe, P.; Dauça, M.; Netter, P.; Terlain, B. PPAR-γ Ligands Modulate Effects of LPS in Stimulated Rat Synovial Fibroblasts. Am. J. Physiol. Cell Physiol. 2002, 282, C125–C133. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, C.; Jia, Z.; Ma, R.; Wang, X.; Chen, W.; Liu, K. Isoniazid Promotes the Anti-Inflammatory Response in Zebrafish Associated with Regulation of the PPARγ/NF-κB/AP-1 Pathway. Chem.-Biol. Interact. 2020, 316, 108928. [Google Scholar] [CrossRef]
- Forsatkar, M.N.; Nematollahi, M.A.; Rafiee, G.; Farahmand, H.; Martínez-Rodríguez, G. Effects of Prebiotic Mannan Oligosaccharide on the Growth, Survival, and Anxiety-like Behaviors of Zebrafish (Danio rerio). J. Appl. Aquac. 2017, 29, 183–196. [Google Scholar] [CrossRef]
- Abu-Elala, N.M.; Younis, N.A.; AbuBakr, H.O.; Ragaa, N.M.; Borges, L.L.; Bonato, M.A. Influence of Dietary Fermented Saccharomyces Cerevisiae on Growth Performance, Oxidative Stress Parameters, and Immune Response of Cultured Oreochromis niloticus. Fish Physiol. Biochem. 2020, 46, 533–545. [Google Scholar] [CrossRef]
- Abass, D.A.; Obirikorang, K.A.; Campion, B.B.; Edziyie, R.E.; Skov, P.V. Dietary Supplementation of Yeast (Saccharomyces cerevisiae) Improves Growth, Stress Tolerance, and Disease Resistance in Juvenile Nile Tilapia (Oreochromis niloticus). Aquacult. Int. 2018, 26, 843–855. [Google Scholar] [CrossRef]
- Avendaño-Herrera, R.; Benavides, I.; Espina, J.A.; Soto-Comte, D.; Poblete-Morales, M.; Valdés, J.A.; Feijóo, C.G.; Reyes, A.E. Zebrafish (Danio rerio) as an Animal Model for Bath Infection by Flavobacterium psychrophilum. J. Fish Dis. 2020, 43, 561–570. [Google Scholar] [CrossRef] [PubMed]
- Huyben, D.; Jarau, M.; MacInnes, J.; Stevenson, R.; Lumsden, J. Impact of Infection with Flavobacterium psychrophilum and Antimicrobial Treatment on the Intestinal Microbiota of Rainbow Trout. Pathogens 2023, 12, 454. [Google Scholar] [CrossRef]
- Moutinho, S.; Oliva-Teles, A.; Fontinha, F.; Martins, N.; Monroig, Ó.; Peres, H. Black Soldier Fly Larvae Meal as a Potential Modulator of Immune, Inflammatory, and Antioxidant Status in Gilthead Seabream Juveniles. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2024, 271, 110951. [Google Scholar] [CrossRef]
- Ge, C.; Liang, X.; Wu, X.; Wang, J.; Wang, H.; Qin, Y.; Xue, M. Yellow Mealworm (Tenebrio molitor) Enhances Intestinal Immunity in Largemouth Bass (Micropterus salmoides) via the NFκB/Survivin Signaling Pathway. Fish Shellfish Immunol. 2023, 136, 108736. [Google Scholar] [CrossRef]
- Elieh Ali Komi, D.; Sharma, L.; Dela Cruz, C.S. Chitin and Its Effects on Inflammatory and Immune Responses. Clin. Rev. Allergy Immunol. 2018, 54, 213–223. [Google Scholar] [CrossRef]
- Hu, W.; Yang, S.; Shimada, Y.; Münch, M.; Marín-Juez, R.; Meijer, A.H.; Spaink, H.P. Infection and RNA-Seq Analysis of a Zebrafish Tlr2 Mutant Shows a Broad Function of This Toll-like Receptor in Transcriptional and Metabolic Control and Defense to Mycobacterium marinum Infection. BMC Genom. 2019, 20, 878. [Google Scholar] [CrossRef] [PubMed]
- Glass, E.; Robinson, S.L.; Rosowski, E.E. Zebrafish Use Conserved CLR and TLR Signaling Pathways to Respond to Fungal PAMPs in Zymosan. bioRxiv 2024. [Google Scholar] [CrossRef] [PubMed]
- Takeda, K.; Akira, S. Microbial Recognition by Toll-like Receptors. J. Dermatol. Sci. 2004, 34, 73–82. [Google Scholar] [CrossRef]
- Novoa, B.; Figueras, A. Zebrafish: Model for the Study of Inflammation and the Innate Immune Response to Infectious Diseases. In Current Topics in Innate Immunity II; Lambris, J.D., Hajishengallis, G., Eds.; Advances in Experimental Medicine and Biology; Springer: New York, NY, USA, 2012; Volume 946, pp. 253–275. ISBN 978-1-4614-0105-6. [Google Scholar]
- Ameena, M.; Arumugham, M.; Ramalingam, K.; Shanmugam, R. Biomedical Applications of Lauric Acid: A Narrative Review. Cureus 2024, 16, e62770. [Google Scholar] [CrossRef]
- Vogel, H.; Müller, A.; Heckel, D.G.; Gutzeit, H.; Vilcinskas, A. Nutritional Immunology: Diversification and Diet-Dependent Expression of Antimicrobial Peptides in the Black Soldier Fly Hermetia illucens. Dev. Comp. Immunol. 2018, 78, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Vogel, M.; Shah, P.N.; Voulgari-Kokota, A.; Maistrou, S.; Aartsma, Y.; Beukeboom, L.W.; Salles, J.F.; Van Loon, J.J.A.; Dicke, M.; Wertheim, B. Health of the Black Soldier Fly and House Fly under Mass-Rearing Conditions: Innate Immunity and the Role of the Microbiome. J. Insects Food Feed. 2022, 8, 857–878. [Google Scholar] [CrossRef]
- Zeng, L.; Tan, J.; Xue, M.; Liu, L.; Wang, M.; Liang, L.; Deng, J.; Chen, W.; Chen, Y. An Engineering Probiotic Producing Defensin-5 Ameliorating Dextran Sodium Sulfate-Induced Mice Colitis via Inhibiting NF-kB Pathway. J. Transl. Med. 2020, 18, 107. [Google Scholar] [CrossRef]
- Zhou, X.; Li, X.; Wang, X.; Jin, X.; Shi, D.; Wang, J.; Bi, D. Cecropin B Represses CYP3A29 Expression through Activation of the TLR2/4-NF-κB/PXR Signaling Pathway. Sci. Rep. 2016, 6, 27876. [Google Scholar] [CrossRef]
- Wang, Y.; Abdullah; Zhong, H.; Wang, J.; Feng, F. Dietary Glycerol Monolaurate Improved the Growth, Activity of Digestive Enzymes and Gut Microbiota in Zebrafish (Danio rerio). Aquac. Rep. 2021, 20, 100670. [Google Scholar] [CrossRef]
- Sypniewski, J.; Kierończyk, B.; Benzertiha, A.; Mikołajczak, Z.; Pruszyńska-Oszmałek, E.; Kołodziejski, P.; Sassek, M.; Rawski, M.; Czekała, W.; Józefiak, D. Replacement of Soybean Oil by Hermetia illucens Fat in Turkey Nutrition: Effect on Performance, Digestibility, Microbial Community, Immune and Physiological Status and Final Product Quality. Br. Poult. Sci. 2020, 61, 294–302. [Google Scholar] [CrossRef]
- Deng, F.; Wang, D.; Yu, Y.; Lu, T.; Li, S. Systemic Immune Response of Rainbow Trout Exposed to Flavobacterium psychrophilum Infection. Fish Shellfish Immunol. 2024, 144, 109305. [Google Scholar] [CrossRef] [PubMed]
- Muñoz-Atienza, E.; Távara, C.; Díaz-Rosales, P.; Llanco, L.; Serrano-Martínez, E.; Tafalla, C. Local Regulation of Immune Genes in Rainbow Trout (Oncorhynchus mykiss) Naturally Infected with Flavobacterium psychrophilum. Fish Shellfish. Immunol. 2019, 86, 25–34. [Google Scholar] [CrossRef]
- Nilsen, H.; Johansen, R.; Colquhoun, D.; Kaada, I.; Bottolfsen, K.; Vågnes, Ø.; Olsen, A. Flavobacterium Psychrophilum Associated with Septicaemia and Necrotic myositis in Atlantic Salmon Salmo Salar: A Case Report. Dis. Aquat. Org. 2011, 97, 37–46. [Google Scholar] [CrossRef]
- Orieux, N.; Douet, D.-G.; Le Hénaff, M.; Bourdineaud, J.-P. Prevalence of Flavobacterium psychrophilum Bacterial Cells in Farmed Rainbow Trout: Characterization of Metallothionein A and Interleukin1-β Genes as Markers Overexpressed in Spleen and Kidney of Diseased Fish. Vet. Microbiol. 2013, 162, 127–135. [Google Scholar] [CrossRef]
- Nematollahi, A.; Decostere, A.; Pasmans, F.; Haesebrouck, F. Flavobacterium psychrophilum infections in Salmonid Fish. J. Fish Dis. 2003, 26, 563–574. [Google Scholar] [CrossRef] [PubMed]
- Mirghaed, A.T.; Yarahmadi, P.; Soltani, M.; Paknejad, H.; Hoseini, S.M. Dietary Sodium Butyrate (Butirex® C4) Supplementation Modulates Intestinal Transcriptomic Responses and Augments Disease Resistance of Rainbow Trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2019, 92, 621–628. [Google Scholar] [CrossRef] [PubMed]
- Tian, L.; Zhou, X.-Q.; Jiang, W.-D.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Tang, W.-N.; Zhang, Y.-A.; et al. Sodium Butyrate Improved Intestinal Immune Function Associated with NF-κB and p38MAPK Signalling Pathways in Young Grass Carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2017, 66, 548–563. [Google Scholar] [CrossRef] [PubMed]
- Cholan, P.M.; Han, A.; Woodie, B.R.; Watchon, M.; Kurz, A.R.; Laird, A.S.; Britton, W.J.; Ye, L.; Holmes, Z.C.; McCann, J.R.; et al. Conserved Anti-Inflammatory Effects and Sensing of Butyrate in Zebrafish. Gut Microbes 2020, 12, 1824563. [Google Scholar] [CrossRef]
- Ji, J.; Shu, D.; Zheng, M.; Wang, J.; Luo, C.; Wang, Y.; Guo, F.; Zou, X.; Lv, X.; Li, Y.; et al. Microbial Metabolite Butyrate Facilitates M2 Macrophage Polarization and Function. Sci. Rep. 2016, 6, 24838. [Google Scholar] [CrossRef]
- Schulthess, J.; Pandey, S.; Capitani, M.; Rue-Albrecht, K.C.; Arnold, I.; Franchini, F.; Chomka, A.; Ilott, N.E.; Johnston, D.G.W.; Pires, E.; et al. The Short Chain Fatty Acid Butyrate Imprints an Antimicrobial Program in Macrophages. Immunity 2019, 50, 432–445.e7. [Google Scholar] [CrossRef] [PubMed]
- Pagani, A.; Nai, A.; Silvestri, L.; Camaschella, C. Hepcidin and Anemia: A Tight Relationship. Front. Physiol. 2019, 10, 1294. [Google Scholar] [CrossRef]
- Clauss, T.M.; Dove, A.D.M.; Arnold, J.E. Hematologic Disorders of Fish. Vet. Clin. N. Am. Exot. Anim. Pract. 2008, 11, 445–462. [Google Scholar] [CrossRef]
- Neves, J.V.; Caldas, C.; Ramos, M.F.; Rodrigues, P.N.S. Hepcidin-Dependent Regulation of Erythropoiesis during Anemia in a Teleost Fish, Dicentrarchus labrax. PLoS ONE 2016, 11, e0153940. [Google Scholar] [CrossRef]
- Vaibarová, V.; Čížek, A. Supposed Virulence Factors of Flavobacterium psychrophilum: A Review. Fishes 2024, 9, 163. [Google Scholar] [CrossRef]
- Liu, M.; Hu, R.; Li, W.; Yang, W.; Xu, Q.; Chen, L. Identification of Antibacterial Activity of Hepcidin From Antarctic Notothenioid Fish. Front. Microbiol. 2022, 13, 834477. [Google Scholar] [CrossRef] [PubMed]
- Xiao, P.; Cai, X.; Zhang, Z.; Guo, K.; Ke, Y.; Hu, Z.; Song, Z.; Zhao, Y.; Yao, L.; Shen, M.; et al. Butyrate Prevents the Pathogenic Anemia-Inflammation Circuit by Facilitating Macrophage Iron Export. Adv. Sci. 2024, 11, 2306571. [Google Scholar] [CrossRef] [PubMed]
Ingredients (g/kg) | Control | BSFL Meal | Probiotic | Yeast Prebiotic | Butyrate |
---|---|---|---|---|---|
Fishmeal, 68% CP | 300 | 223 | 300 | 300 | 300 |
Wheat Flour | 180 | 180 | 180 | 180 | 180 |
Soybean meal, 48% CP | 170 | 170 | 170 | 170 | 170 |
Poultry by-product meal, 62% CP | 100 | 100 | 100 | 100 | 100 |
BSF larvae, defatted, Enterra | 100 | ||||
Probiotic yeast, Alltech | 10 | ||||
Prebiotic yeast, Alltech | 2 | ||||
Sodium butyrate (SCFA), Sigma | 0.5 | ||||
Blood meal, porcine | 70 | 70 | 70 | 70 | 70 |
Starch, corn | 98 | 79 | 98 | 98 | 98 |
Fish oil, herring | 35 | 35 | 35 | 35 | 35 |
Canola oil | 34 | 30 | 34 | 34 | 34 |
Vitamin and mineral premix (DSM) | 5 | 5 | 5 | 5 | 5 |
Vitamin E | 3 | 3 | 3 | 3 | 3 |
Choline chloride | 3 | 3 | 3 | 3 | 3 |
Limestone | 1 | 1 | 1 | 1 | 1 |
NaCl | 1 | 1 | 1 | 1 | 1 |
DL-Met | 0.5 | 1 | 0.5 | 0.5 | 0.5 |
Proximate Composition | Unit | Control | BSFL Meal | Probiotic | Yeast Prebiotic | Butyrate |
---|---|---|---|---|---|---|
Dry matter | % | 96.6 | 96.6 | 96.8 | 96.5 | 96.6 |
Crude protein (CP) | % | 46.8 | 46.3 | 46.9 | 46.9 | 45.4 |
Crude lipid (CL) | % | 12.1 | 12.8 | 12.5 | 11.9 | 12.6 |
Ash | % | 9.8 | 9.1 | 9.7 | 9.8 | 10.3 |
Carbohydrate | % | 28.0 | 28.5 | 27.7 | 27.9 | 28.2 |
Gross energy (GE) | GE | 21.0 | 21.0 | 20.8 | 21.0 | 20.8 |
Gene | Primer | Sequence 5′-3′ | Accession No. |
---|---|---|---|
18S ribosomal RNA (18s rRNA/housekeeping gene) | F | TCGCTAGTTGGCATCGTTTATG | BX296557.35 |
R | CGGAGGTTCGAAGACGATCA | ||
Tumor necrosis factor alpha (TNF-α) | F | AGGCAATTTCACTTCCAAGG | NM_212859 |
R | AGGTCTTTGATTCAGAGTTGTATCC | ||
Interleukin 1 beta (IL-1β) | F | ATGCTCATGGCGAACGTC | NM_212844 |
R | TGGTTTTAGTGTAAGACGGCACT | ||
Hepcidin | F | CACAGCCGTTCCCTTCATAC | NM_205583.2 |
R | TCAGATGTTGGTTCTCCTGC | ||
Myeloid differentiation primary response 88 (MyD88) | F | TCCACAGGGACTGACACCTGAGA | NM_212814 |
R | GCTGAGTCTTCAGCACAGCAGAT | ||
Caspase-b | F | ATGGAGGATATTACCCAG | NM_152884 |
R | TCACAGTCCAGGAAAC | ||
Peptidoglycan recognition protein (PGRP) | F | ATGGGACGGTGTATGAAGGC | NM_001044321.1 |
R | AGCATTGAGGTTGCCCATGA | ||
Serum Amlyloid A (SAA) | F | CGGGGTCCTGGGGGCTATTG | NM_001005599.1 |
R | GTTGGGGTCTCCGCCGTTTC | ||
Nuclear factor kappa B p65 subunit (NF-κB/p65) | F | CCTACGGCTAAACGAACTCTAC | XM_005170796.4 |
R | GACATGGCCTGCAGATACTT | ||
CXC motif chemokine ligand 8 (CXCL8/IL-8) | F | CCAGCTGAACTGAGCTCCTC | XM_001342570 |
R | GGAGATCTGTCTGGACCCCT | ||
Angitopoietin-like 4 (Angptl4) | F | CGAGCGCATCAAGCAACA | JN606312–JN606321 |
R | TCGCTCGTTTTTCATCGTAATCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, N.; Zhang, J.; Shandilya, U.K.; Lumsden, J.S.; Barzrgar, A.B.; Huyben, D.; Karrow, N.A. Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate. Fishes 2024, 9, 495. https://doi.org/10.3390/fishes9120495
Gao N, Zhang J, Shandilya UK, Lumsden JS, Barzrgar AB, Huyben D, Karrow NA. Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate. Fishes. 2024; 9(12):495. https://doi.org/10.3390/fishes9120495
Chicago/Turabian StyleGao, Nancy, Junyu Zhang, Umesh K. Shandilya, John S. Lumsden, Amir Behzad Barzrgar, David Huyben, and Niel A. Karrow. 2024. "Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate" Fishes 9, no. 12: 495. https://doi.org/10.3390/fishes9120495
APA StyleGao, N., Zhang, J., Shandilya, U. K., Lumsden, J. S., Barzrgar, A. B., Huyben, D., & Karrow, N. A. (2024). Hepatic Gene Expression Changes of Zebrafish Fed Yeast Prebiotic, Yeast Probiotic, Black Soldier Fly Meal, and Butyrate. Fishes, 9(12), 495. https://doi.org/10.3390/fishes9120495