Next Article in Journal
Heat Shock Factors in the European Eel: Gene Characterization and Expression Response to Different Environmental Conditions and to Induced Sexual Maturation
Next Article in Special Issue
Methyltransferase HsdM Regulates the Pathogenicity of Streptococcus agalactiae to Nile Tilapia (Oreochromis niloticus)
Previous Article in Journal
Morphology and Histology of the Digestive System of Japanese Mantis Shrimp (Oratosquilla oratoria)
Previous Article in Special Issue
Garlic Powder Evaluation as Feed Additive on Nile Tilapia (Oreochromis niloticus L.) Growth Performance, Feed Utilization, Gill Parasitic Treatment, and Monogenean Diversity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms

by
Dimitrios K. Papadopoulos
1,*,
Ioannis A. Giantsis
2,
Athanasios Lattos
1,
Konstantina Bitchava
3 and
Basile Michaelidis
1
1
Laboratory of Animal Physiology, Department of Zoology, Faculty of Science, School of Biology, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
2
Laboratory of Ichthyology & Fisheries, Faculty of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
3
Laboratory of Applied Hydrobiology, Department of Animal Science, Agricultural University of Athens, 11855 Athens, Greece
*
Author to whom correspondence should be addressed.
Fishes 2025, 10(2), 72; https://doi.org/10.3390/fishes10020072
Submission received: 20 December 2024 / Revised: 7 February 2025 / Accepted: 10 February 2025 / Published: 11 February 2025
(This article belongs to the Special Issue Prevention and Control of Aquatic Animal Diseases)

Abstract

:
The impact of pathogenic Vibrio on bivalves is expected to be aggravated by global warming, posing a growing threat to aquaculture. Clam production has been particularly vulnerable, with significant losses attributed to the lack of pathogen-resistant strains. In this study, the mantle cavity of the grooved carpet shell clam Ruditapes decussatus (Linnaeus, 1758) was injected with Vibrio splendidus at 18 °C, 22 °C, and 24 °C and the transcription of the phagelysozyme, Cu-Zn superoxide dismutase (Cu-Zn sod), tumor necrosis factor receptor associated factor 6 (traf6), inhibitor of NF-κB (IκB), and Fas-associated protein with death domain (fadd) genes were assessed during a 20-day period. Additionally, the coding sequences of lysozyme, fadd, and IκB in Ruditapes decussatus were characterized for the first time, and SNPs were identified. Some SNPs showed significantly different distributions between infection-resistant and infection-susceptible individuals. Infected clams experienced increased mortality at elevated temperatures. Lysozyme mRNA was upregulated in infected groups across all temperatures. The sustained increase on day 20, coinciding with elevated traf6 mRNA, suggests a prolonged activation of the immune response. Cu-Zn sod transcription at 18 °C and 22 °C peaked on day 7 and returned to control levels by day 20, indicating an effective immune response, while at 24 °C, infected animals showed a continuously increased transcription. IκΒ and traf6 transcription, reflecting NF-κB pathway activity, varied with temperature and showed transient stimulation at higher temperatures. The pattern of fadd expression indicated a late induction of apoptosis, particularly at 18 °C and 24 °C. Overall, this study illustrates the involvement of five key genes in host–pathogen interactions and identifies potential markers for selection for Vibrio resistance in Ruditapes decussatus. However, given the weak correlation observed, further research is needed on the link between these polymorphisms and pathogen resilience.
Key Contribution: This study demonstrates the impact of elevated temperatures on the mortality of Ruditapes decussatus infected with Vibrio splendidus and also reveals the transcriptional regulation of five key immune-related genes in host–pathogen interactions. Finally, this work identified potential markers for the selective breeding of resistant clams.

Graphical Abstract

1. Introduction

The aquaculture of Mollusks is dominated by bivalves and the majority of the cultured species belong to the families Ostreidae and Veneridae [1]. Bivalve farming nowadays represents a large portion of the global seafood market [2]. Ruditapes decussatus holds significant commercial value in Europe [3], with consumer demand far exceeding current supply [4]. Infectious diseases caused by various microorganisms are accountable for severe economic losses [5] and represent a significant threat for the productivity of both aquaculture and fisheries. Vibriosis is among the most worrying bacterial diseases in the aquaculture sector, since the majority of bacterial diseases are generated by members of the Vibrio genus [6]. Μany Vibrio species are primary pathogens to many marine animals [7], but most Vibrios are opportunistic pathogens [8] that take advantage of host weaknesses. Pathogen proliferation, disease spread, and host susceptibility in bivalves have risen due to climate change over the past century [9].
According to the recent report of the Intergovernmental Panel on Climate Change (IPCC), by 2100, the global mean surface temperature could increase by 1.4–4.4 °C relative to the years 1850–1900, while by 2040, the temperature increase will almost certainly exceed 1.5 °C [10]. Paillard et al. [11] highlighted the possibility of the increased emergence of Vibrios as etiological factors in the mortalities of cultured bivalves due to ocean warming. In addition to warming, ocean acidification has been shown to increase the vulnerability of clams to Vibrio spp. infections [12]. Studies have documented that elevated temperature can increase the transmission of Vibrio species from infected to non-infected oysters [13], while heat waves were found to promote Vibrio abundance in Crassostrea gigas [14]. Massive mortalities of bivalves may also be triggered at much lower temperatures by cold-adapted Vibrio strains [15]. In this respect, the understanding of the immune response and the mechanisms implicated in encountering infections is of great importance for the development of disease-resilient varieties in bivalve aquaculture.
Bivalves lack adaptive immunity and rely entirely on their innate immune system to defend against pathogens. Despite the absence of adaptive immunity, bivalves possess effective mechanisms that eliminate the majority of the invading agents [16] by a complex cooperation of cellular and humoral components [17]. These animals are equipped with an open circulatory system full of hemocytes that play a crucial role in the innate immune response, which involves the identification of invaders, activation of respective signaling pathways, and phagocytosis [18]. Foreign material and invading microorganisms are detected through humoral and hemocyte-attached recognition factors. This detection stimulates the production of cytokines, which promote the recruitment of additional hemocytes, trigger phagocytosis, and lead to the production of multiple antimicrobial compounds [19].
The amount of microorganisms that invade into the circulatory system is only a small fraction of the microbial load in the mucosal tissues. The progress of infection fails when the pathogen is efficiently eliminated by the host at entry points [20]. An efficient physical barrier of the immune defense is mucus. Mucus contains glycoproteins, several cells, as well as bioactive molecules [21]. Lysozymes (EC 3.2.1.17) are ubiquitous hydrolytic enzymes in all major taxa and represent one of the most important bioactive molecules. Lysozymes are classified into six groups on the basis of structural, functional, and evolutionary differences [22]. In bivalves, these enzymes are located in extrapallial fluids and contribute to pathogen neutralization through the degradation of substrates in their cell wall. Particularly, phage-type lysozymes seem to play an important role against infections since they were shown to display bactericidal activitiesagainst a variety of pathogens in bivalves [23,24].
The clearance of pathogenic agents involves enhanced production of reactive oxygen species (ROS) which have microbicidal properties and are toxic to most invaders [25]. However, the accumulation of ROS inside cells can lead to oxidative stress and cellular damage. Therefore, the antioxidant response of infected bivalves is of certain interest. Superoxide dismutases (SOD) (E.C.1.15.1.1) are key enzymatic components of the antioxidant machinery. These oxidoreductases convert the superoxide radical to molecular oxygen and hydrogen peroxide. Based on their metal binding, three main types of SOD are found in the organisms, which are the intracellular cytosolic Cu/Zn-SOD, the intracellular mitochondrial Mn-SOD, and the extracellular Cu/Zn-SOD [26]. The expression of the intracellular Cu-Zn SOD in Ruditapes phillipinarum infected with different Vibrios revealed varying patterns over short periods after infection [27,28], suggesting the involvement of this enzyme in the innate immunity against microorganisms.
Nuclear factor-kappa B (NF-κΒ) is a dimeric transcription factor essential for the innate immune system of bivalves as it regulates the expression of effector molecules and cytokines [29]. The TLR/NF-κB signaling pathway in bivalves is vital for their innate immune response. This pathway is activated by the specific binding and recognition of microbial components by Toll-like receptors (TLRs), leading to the activation of key transcription factors such as NF-κB [30]. The initial step in this process involves the TNF receptor-associated factor 6 (TRAF6), a conserved adaptor protein identified in multiple bivalve species [31], which regulates the activation of the IκB kinase (IKK) complex in conjunction with the transforming growth factor β-activated kinase-1 (TAK1) [32]. Upon external stimuli, the activated TAK1 complex phosphorylates and activates the IKK complex, leading to the phosphorylation and subsequent degradation of IκB, the inhibitor of NF-κB, which is a key regulatory protein in the signaling cascade that inactivates NF-κB, by sequestering it in the cytosol. The degradation of IκB releases NF-κB, allowing its translocation to the nucleus where it regulates the expression of immune effectors, cytokines, and other pro-inflammatory genes [33], thus facilitating various immune functions such as inflammation, cell growth, differentiation, and apoptosis [34].
Apoptosis plays a vital role in immunity by the strict control of pathogen proliferation within internal tissues and by preventing inflammatory reactions in damaged tissues [35]. Apoptosis is a highly conserved process of programmed cell death that occurs in multicellular organisms to maintain their homeostasis. It involves two major pathways: the death receptor-mediated (extrinsic) pathway, and the intrinsic mitochondrial pathway. In bivalves, apoptosis can be activated by various stimuli, including pathogens [36,37,38]. The TLR pathway is linked to apoptosis through the regulation of the proteins MyD88 and caspase-8 [39]. Additionally, apoptosis can be triggered by ROS [40].
Tumor necrosis factor receptor (TNFR) family members, including Fas, mediate apoptosis signals [41]. The binding of Fas to the Fas-associated protein with death domain (FADD) activates the FADD–procaspase-8 complex, which regulates executioner caspases implicated in the apoptotic process [42]. FADD is a pro-apoptotic adaptor molecule and a fundamental element of the cell death process [43]. Studies on bivalves have documented that under stress, shifts in the expression of the fadd gene occur [44] and that the expression of fadd is correlated with cell apoptosis [45,46].
Global warming is expected to significantly impact both aquaculture and natural populations of bivalve mollusks primarily through altered temperature regimes. In addition, elevated water temperature can enhance the growth and virulence of pathogenic microorganisms leading to increased disease outbreaks in bivalve populations [47]. The Splendidus clade includes 16 species [48], some of which have shown pathogenic potential in clams [49,50]. Pathogens of this clade can infect various aquaculture animals [51]. In this work, we investigated the physiological response of the European clam Ruditapes decussatus following experimental injections with a Vibrio species of the Splendidus clade at various ambient temperatures. The transcriptions of phage-type lysozyme, Cu-Zn sod, IκΒ, traf6, and fadd were studied for 20 days following the injections at 18 °C, 22 °C, and 24 °C to assess, in parallel, the impact of elevated temperatures on the response of the infected clams.
Additionally, the coding sequences (cds) of fadd, IκΒ, and lysozyme were sequenced in clams that survived (resistant) and those that died early (susceptible) during the exposure, aiming to identify polymorphisms potentially associated with increased tolerance to the infection and to provide potential markers for selective breeding in these species. Polymorphisms such as single nucleotide polymorphisms (SNPs) within coding regions represent a valuable tool for understanding the reaction of the immune system in resistance to pathogenic agents and stressful environmental conditions [38,52], while selective breeding could improve the productivity of aquaculture and support the sustainability of wild bivalve populations, helping to mitigate the impact of global warming.

2. Materials and Methods

2.1. Animal Collection and Acclimation Procedure

Approximately 450 Ruditapes decussatus, with an average wet weight of 19.32 ± 2.18 g were obtained from the fisheries of Vistonikos Bay (northeastern Greece) in May 2022. Clams were transferred to the laboratory facilities, washed with tap water, and placed in two aerated 2000 L tanks. The tanks were filled with filtered natural seawater and contained a recirculating system, mechanical and biological filters, and a UV light lamp. Two days later, 444 clams were randomly distributed into twelve 300 L aquaria containing a similar water-recirculating system (Figure 1). The clams were placed in the aquaria within square permeable baskets (50 × 50 × 10 cm) filled with fine gravel (2 mm) up to a height of 8 cm (Figure 1), allowing them to bury themselves at will, and a two-week acclimation period followed.
Clams were fed a mix of live marine flagellate (Tisochrysis lutea, CCAP 927/14 and Tetraselmis spp., Mediterranean strain) in a 1:1 dry weight ratio. The amount of (dry) microalgae provided equaled 3% of the clams live weight per week. Temperature (Hanna HI98129, Hanna Instruments Inc., Woonsocket, RI, USA) and dissolved oxygen (Hanna HI9142) were recorded daily using electronic devices. Nitrogen compounds, including total ammonia nitrogen (TAN), nitrites (NO2), and nitrates (NO3), were measured daily with saltwater test kits (Tetra, Melle, Germany). The water temperature in the aquaria was 17.7 ± 0.62 °C. Artificial light was supplied by fluorescent lamps for 16 h a day. Depending on the clam load in the aquarium, water exchanges were made every 2 days with fresh filtered seawater. In all treatments, nitrogen compounds remained at similar concentrations due to water exchanges, thus TAN and NO2never exceeded 0.25 mg/L, while NO3 never exceeded 20 mg/L.

2.2. Trial Setup, Experimental Injections, and Sampling Procedure

Right before the two-week acclimation period, the animals were placed in aquaria and divided into groups of 30, 35, 40, and 52, as shown in Table 1. All treatments were replicated twice. On the fifteenth day, the different treatments were subjected to temperature increase and to bacterial injections. Since several Vibrio species thrive at temperatures above 17 °C [53] and clams were collected on May, we used 18 °C as the lowest experimental temperature to reflect the average seawater temperature in northeastern Greece during May [54]. Two additional temperatures (22 °C and 24 °C) were tested to evaluate the response of the infected clams at moderately elevated temperatures. The temperature of the 22 °C and 24 °C treatments (Table 1) was gradually increased at a rate of 0.1 °C per hour by using aquarium heaters (Digital Aquarium Heater DR-9300, Boyu, Guangdong Province, China). When the temperature in all treatments reached the target levels, the injections were conducted. Specifically, injections for animals at 18 °C were performed in an adjacent room next to the experimental tanks (room temperature was 17.6 °C). Clams at 22 °C and 24 °C were transferred and injected in adjacent rooms with temperatures of 22.2 °C and 23.9 °C, respectively.
The bacteria were grown under agitation at 23 °C in Zobell medium prepared from autoclaved natural seawater supplemented with bactopeptone (4 g/L) and yeast extract (1 g/L). Bacterial density was determined by optical density (OD) measurements in a spectrophotometer (M501 single beam, CAMSPEC, Leeds, UK) at 600 nm. A standard curve correlating optical density (OD) with colony-forming units (CFUs) per mL was previously established for the strain under the specified conditions to find the equation estimating the CFU/mL from OD at 600 nm. When the culture reached the intended OD, which was 0.652 (corresponding to 5 × 108 CFU/mL), it was centrifuged (3000× g, 10 min) and resuspended in sterile PBS (phosphate buffer saline, pH 7.4). The experimental infections were made by injecting 100 μL of bacteria suspension (5 × 108 CFU/mL) into the extrapallial cavity of the clams through sterile needles (0.5 × 16 mm) fitted onto 1 mL sterile syringes. Each individual was injected carefully by placing the needle in the extrapallial cavity between the mantle and the shell and received 5 × 107 CFUs. Control animals were injected in the same way with 100 μL of the autoclaved PBS. Following the injections, animals were kept out of the aquaria for 6 h to keep the inoculated bacteria and favor their growth. Afterward, animals were immersed in the aquaria within their baskets (Figure 1). We selected injection as the bacterial exposure method to ensure a consistent dose for each individual, minimizing variability across different temperatures. While seawater exposure better simulates natural conditions, injection allows for more controlled comparisons between treatments.
The daily routine and feeding regime during the experiment were exactly as in the acclimation period. The daily measurements throughout the experimental period are summarized in Table 1. During the first 20 days, five samplings were conducted on hours 3, 12, and 48 and on days 7 and 20. Samplings were carried out by choosing 2 random animals from each aquarium, and thus 4 clams from each treatment. The sampled animals were anatomized and their mantles were dissected with sterilized tools, immediately flash-frozen in liquid nitrogen, and stored at −80 °C. In the last 12 days only, mortality was recorded, as no further samplings were made for gene expression. Mortality was documented twice a day and dead animals were removed from the aquaria. Clams were considered dead when they had open valves and were not closing them even after mechanical stimuli.

2.3. Genetic Profiling of the Vibrio Strain

The Vibrio strain was a bacterium isolated in Greece from moribund Pinna nobilis specimens by Lattos et al. [55] in 2020. This strain (GR129) was found to harbor the virulence genes outer membrane protein U (ompU) and vibriolysin metalloprotease (vsm) in its genome [55]. For further genetic characterization of the Vibrio strain, the 16S rRNA was re-sequenced using the primer pair 27f-1492r [56] to obtain a larger sequence, since the deposited sequence (MW715032.1) was 100% similar to multiple different strains. In addition, to further evaluate the pathogenicity of the strain, another virulence gene was amplified and sequenced. This was a hemolysin gene and was amplified in conventional PCR by using the set of primers hem-F 5′CAATACCGACACCAGAATCG3′ and hem-R 5′TCAGAGCGCTACTGAAATCG3′. The primers were designed based on an available sequence in GenBank (OR743458.1).

2.4. Selection of Animals for Genotyping

One of the objectives of this work was the research for polymorphisms within coding regions of key genes that are involved in the response against infections and the possible association of specific polymorphisms with resistant or susceptible phenotypes against Vibrio infections. After day 20, the experiment continued for the collection of resistant animals since there were still relatively low mortalities in the bacteria-injected treatments. Finally, 24 infected animals were collected in total from the bacteria-injected groups on day 32. These were 12 animals from 22 °C and 12 animals from 24 °C. These were designated as the resistant clams. In addition, 24 animals from Vibrio-injected groups were collected during the experiment as the susceptible ones. These were the first animals that died right after the initial high mortality at each Vibrio-injected treatment. Therefore, 8 dead individuals that died on days 4–8 at 18 °C, 8 individuals that died on days 7–12 at 22 °C, and 8 clams that died on days 4–8 at 24 °C were marked as the susceptible group. Dead animals during the first two days after the injections were not collected since many of them possibly died due to the combination of multiple stressors (bacteria, needle, air exposure). The mantle tissue of the above clams was dissected with sterilized tools, transferred to 1.5 mL tubes, and subsequently deposited at −80 °C.

2.5. RNA Extraction and cDNA Synthesis

Total RNA extractions for gene expression analysis were performed from the mantles of the animals sampled during the experiment and also from the resistant and susceptible individuals. A total of 168 R. decussatus mantles were processed for RNA extraction (120 for gene expression and 48 for genotyping) with the use of NucleoZOL reagent (Macherey-Nagel, Düren, Germany), following the protocol provided by the manufacturer. RNA concentration and purity were evaluated on a Quawell UV-Vis 5000 spectrophotometer (Quawell Technology, San Jose, CA, USA), and the RNA samples were stored at −80 °C up until the reverse transcription step. Finally, for the reverse transcription procedure, 500 ng (for gene expression) or 1000 ng (for genotyping) of total RNA was used in the reaction, along with the PrimeScript RT Reagent Kit (Takara, Otsu, Japan), following the kit protocol. The resulting cDNA was diluted and stored at −20 °C until quantitative PCR (qPCR) applications.

2.6. Gene Transcription Analysis

The transcription of five genes (Table 2) was analyzed through qPCR. Expression of all genes was calculated relative to the mRNA levels of the same gene in the control treatments (PBS-injected), separately at the different temperatures. A total of 120 samples (4 clams/treatment/sampling time) were used for each gene assay. Information concerning the primers is shown in Table 2. The reaction wells contained 10 ng of mantle cDNA, 5 μL of KAPA SYBR®FAST qPCR Master Mix, 2 μΜ of the two primers, and PCR-grade water up to the final volume (10 μL). qPCR reactions were carried out in the Thermocycler Eco 48 Real-time PCR (Illumina, San Diego, CA, USA).The efficiency of the primer pairs was analyzed in preliminary trials by preparing five-fold dilutions of 3 random cDNA samples. Efficiency was estimated from the equation E = 10(−1/slope) [57] and the slope value was produced from the regression line of the Ct values of the serial dilutions versus the relative concentration of cDNA. If efficiency was not within the range of 90–110%, a new primer pair was designed.
The primers in this study were designed from the selected sequences reported in Table 2 and Table 3 through the primer 3 software (Version 4.1.0) [58]. The primers for the amplification of TRAF6 (Table 2) as well as for the whole coding sequence of phagelysozyme, IκB, and FADD genes (Table 3) were designed based on highly conserved regions of related bivalves since there were no sequences for R. decussatus in public databases. When the sequences of phagelysozyme, IκB, and FADD were obtained, qPCR primers were designed based on the gene sequences. Regarding the analysis of gene expression, primer dimmers and hairpin formation were predicted in Oligo Analyzer 1.0.2. The melt curve after each run was evaluated to ensure the lack of primer dimmers and multiple peaks and electrophoresis was conducted using 1% agarose gels stained with Midori Green (NIPPON Genetics EUROPE, Düren, Germany) to verify the size of the amplified products (Table 2). The threshold cycle (Ct) values of the examined genes were normalized to the corresponding Ct values of the reference gene (18S rRNA), whose expression was not influenced by temperature or infections. The comparative Ct (2−ΔΔCt) method [59] was applied for the calculation of the relative expression of all target genes since all efficiencies were less than 5% divergent from the efficiency of 18S rRNA, as shown in Table 2.

2.7. Sequencing and Sequence Analysis of Resistant and Susceptible Clams

Τhe genes encoding Fas-associated protein with death domain (FADD), inhibitor of NF-κB (IκB), and phage-type lysozyme were successfully amplified in resistant and susceptible R. decussatus through conventional PCR. PCR reactions were carried out in a FastGene ULTRA Cycler (NIPPON Genetics EUROPE, Düren, Germany) in 20 μL final volume. Each PCR tube contained 10 μL of FastGene Taq 2 × Ready Mix (Nippon Genetics, Europe), 0.4 μΜ of each primer, about 30 ng of cDNA, and PCR-grade water up to the final volume. The thermal cycling program was set as follows: 95 °C for 3 min, 38 cycles of 95 °C (30 s), 49–51 °C (Table 3, 30 s), and 72 °C (30–60 s, determined by the size of the target sequence), and a final extension step at 72 °C for 10 min.
After the PCR incubation, 5 μL of the PCR products were subjected to electrophoresis on 1.5% agarose gel stained with Midori Green Advance (Nippon Genetics, Europe). Gels were observed under UV light and all successfully amplified products were purified with the use of the NucleoSpin Gel and PCR Clean-up®kit (Macherey Nagel, Düren, Germany) and subsequently sequenced in both directions by the ABI 3730xl automatic sequencer. The resulting chromatograms were visually examined for bad sequenced regions and double peaks using Finch TV 1.4.0 (Geospiza, Seattle, WA, USA) and BioEdit [60]. All well-read sequences were aligned in MEGA X [61] through the MUSCLE algorithm.

2.8. Annotation and Structure of the Corresponding Proteins

The nucleotide sequences were translated into amino acids using MEGA X, and the resulting amino acid sequences were uploaded to the I-TASSER online server [62] for the prediction of their 3D structure. The 3D protein structures were generated by I-TASSER and the most supported model (higher confidence score or C-score, [63]) was further characterized through the molecular graphic software PyMOL version 3.0.1 http://www.pymol.org/pymol (accessed on 8 October 2024). Domain annotations and prediction of ligand binding sites and active sites, etc., were based on predictions of I-TASSER and were crosschecked against annotations of homologous proteins from related bivalve species available in GenBank.

2.9. Statistical Analysis

As the qPCRs could not be analyzed in the same run owing to the size of the RT-PCR plate (48-well plate), gene expression analysis was conducted at each temperature separately. Before analysis, all data were subjected to normality tests (Shapiro–Wilk test). Data were then analyzed using a one-way analysis of variance (ANOVA) at a significance level of p < 0.05. During ANOVA, the test of Brown–Forsythe (at p < 0.05) was also checked for confirming the homogeneity of variances. Multiple comparisons were made between all infected groups vs. their control and between all infected groups at all sampling times in a given temperature. When significant differences were detected, post hoc comparisons were conducted using the Bonferroni test to adjust for multiple comparisons and adjusted p-values lower than 0.05 were marked as statistically significant (Table S2). All statistical analyses and visualizations were performed using GraphPad Prism (Version 10.4.1), and the results were illustrated as means ± standard deviations. The allele and genotype frequencies of resistant and susceptible clams were examined using the chi-squared (χ2) test, with p-values below 0.05 considered statistically significant.

3. Results

3.1. Vibrio Strain

Sequencing of the 16S rRNA gene yielded a sequence (Acc. No. PQ826361) that was 100% identical to multiple V. splendidus species. In contrast, the obtained sequence of the hemolysin gene (Acc. No. PQ867532) showed 100% identity to Vibrio splendidus isolate A06 (OZ078861) and 99.25% identity to Vibrio splendidus strain BST398 (CP031056.1). The 16S rRNA sequences were 100% identical to both of these strains. Therefore, the strain used for injections harbored virulence genes encoding an adhesin (ompU), a metalloprotease, and a hemolysin, and it is likely a strain closely related to Vibrio splendidus isolate A06 and Vibrio splendidus strain BST398.

3.2. Mortality

Control clams at 18 °C, exhibited no mortality. However, at 22 °C, uninfected clams showed an 8% mortality by day 9, with no further deaths recorded up to day 32 (Figure 2). R. decussatus injected with PBS at 24 °C experienced a 25.7% death percentage. All bacteria-injected groups exhibited approximately 7% mortality by day 2 (Figure 2). At 18 °C, Vibrio injection resulted in 19.6% mortality, with a rapid rate until day 3 and no deaths in the last seven days of the experiment. For the Vibrio-injected group at 22 °C, mortality reached 16% within six days and continued to increase, resulting in 31.4% by the end of the experiment (Figure 2). The highest mortality rate (42%) was observed in the infected clamsat 24 °C, where the mortality rate remained relatively stable throughout the experiment (Figure 2).

3.3. Phage-Type Lysozyme Transcription

Lysozyme mRNA was significantly upregulated in the mantle of all Vibrio-injected groups compared to the control clams (Figure 3). A relatively constant increase in transcription was observed throughout the experiment at 18 °C and 22 °C due to the bacteria (Figure 3). In clams at 24 °C, infection led to an initial significantly higher transcription until hour 12, followed by stabilization to control levels until day 7. On day 20, these clams exhibited a threefold increase in lysozyme mRNA compared to the controls (Figure 3).

3.4. Cu-Zn Sod Transcription

The transcription of Cu-Zn sod significantly increased due to the bacterial injections and remained elevated up until day 7, at 18 °C and 22 °C (Figure 4). A peak was observed at these temperatures on day 7, while on day 20, infected clams at 18 °C and 22 °C exhibited similar levels of Cu-Zn sod mRNA to the controls. Clams at 24 °C showed an early increase in sod transcription, which dropped to the levels of uninfected animals by hour 12 (Figure 4). The mRNA levels were again significantly elevated on day 7 in the mantles of infected clams at 24 °C, exhibiting an even higher foldincrease compared to controls (Figure 4). On day 20, only infected individuals at 24 °C exhibited a significant elevation in Cu-Zn sod transcription compared to the uninfected clams.

3.5. Transcription of traf6 and IκB

The mRNA levels of traf6 showed an approximately twofold increase in infected clams at 18 °C, from hour 12 until day 20, compared to the PBS-injected individuals (Figure 5a). Bacterial injection at higher temperatures led to a significant rapid increase in traf6 mRNA during the first 12 h, followed by downregulation (Figure 5a). On day 20, all groups of Vibrio-injected individuals exhibited significantly higher transcription of traf 6.
The mRNA of IκΒ was also increased by about twofold at 18 °C from hour 12 onwards in infected R. decussatus (Figure 5b). Vibrio-injected clams at higher temperatures (22 °C, 24 °C) exhibited significant transcriptional upregulation of IκB from the beginning of the trial until hour 48. On days 7 and 20, these clams had similar levels of IκB mRNA to the control individuals (Figure 5b).

3.6. Transcription of fadd

The transcription of the fadd gene significantly increased late in Vibrio-injected clams at 18 °C and 24 °C compared to the uninfected R. decussatus (Figure 6). Fadd was significantly upregulated only on days 7 and 20 at these temperatures. In contrast, the mRNA levels in infected clams at 22 °C exhibited the highest increase at hour 3. These infected clams had about a twofold increased transcription at hour 12 and day 7, while on day 20, the transcription levels were similar to those of PBS-injected individuals (Figure 6).

3.7. Characterized Polymorphisms and Their Distribution in Resistant Versus Susceptible Clams

Six SNPs were identified in the amplified gene sequences. In total, 48 clams from the two groups with different Vibrio resistances (24 resistant, 24 susceptible) were analyzed. Genotype and allele frequencies were calculated and are summarized in Table 4. Of the six SNPs identified, three showed a significant statistical association with resistance to Vibrio (p < 0.05). These three SNPs are located in the coding regions of IκB and phagelysozyme.

3.7.1. fadd

The amplification of the R. decussatus fadd gene using the primers from Table 3 produced a 387-base pair sequence (Acc. No. PQ230466). This sequence starts at the beginning of the coding sequence (cds) and encodes the first 129 amino acids of the signal peptide. The newly characterized gene shows 81.98% sequence similarity to the fadd gene of R. philipinarum (MH507512.1). One non-synonymous substitution was identified in the amplified cds. This was a dimorphism caused by an A to T transversion that leads to a substitution of Leu to Phe in the amino acid 66 of the signal peptide (Table 4). Allele and genotype frequencies did not differ significantly (p > 0.05) between the two clam groups and thus no association was made for this SNP with resistance to the bacterial infection.

3.7.2. IκB

The sequencing of the R. decussatus IκΒ gene resulted in a well-sequenced fragment of 867 base pairs (Acc. No. PQ237690) corresponding to 289 amino acids in the signal peptide. This gene, newly characterized in this species, exhibited 71.73% sequence similarity to the corresponding gene of the Asiatic hard clam Meretrix meretrix (HM536186.1). Two non-synonymous substitutions were detected in the amplified region (Acc. No. PQ237690). Both SNPs were caused by a G to A transition at positions 469 and 809 of the amplified partial gene sequence (Table 4). These polymorphisms resulted in Ala to Thr and Lys to Arg substitutions, respectively, within the ankyrin repeats of IκΒ. The genotype frequencies significantly varied between resilient and susceptible clams only in one position (cds-469). Moreover, allele frequencies of both SNPs differed significantly (p < 0.05). Therefore, the presence of G at position 469, along with the G/G genotype and also the allele A at position 809, and the corresponding amino acids Ala and Lys, were associated with increased resilience to the bacterial infection.

3.7.3. phage-type lysozyme

The amplification of the lysozyme gene resulted in a sequence of 420 base pairs (Acc. No. PQ237691). This partial sequence encodes 140 amino acids of a phage-type lysozyme in R. decussatus. Multiple sequence alignment showed 80–83% similarities to phage-type lysozymes of other clam species (KJ427777.1, KT934018.1, PP930267.1). Three non-synonymous substitutions were found in the obtained sequence, all of which exhibited similar allele distributions among susceptible and resilient clams (Table 4). However, the transversion of G to T at position 143, which leads to the replacement of Arg with Ile, showed significantly different genotype frequencies between the two groups of clams, and thus the G/G genotype and the prevalence of Arg residue were associated with increased susceptibility to Vibrio infection.

3.8. Three-Dimensional (3D) Modeling, Annotation, and Visualization of the Signal Peptides

3.8.1. fadd

The partial cds of fadd encodes the first 129 amino acids of the corresponding signal peptide. Based on the annotation of the homologous protein of R. phillipinarum in GenBank (QBB20029.1), which consists of 132 amino acids, the amino acids 7–89 are representing the death effector domain (orange region, Figure 7). The death effector domain (DED) of FADD includes six alpha-helices and through this structure, it interacts specifically with other proteins containing death effector domains (DEDs) for creating complexes essential for initiating apoptosis. The amino acid that changes due to the identified substitution is located within this domain (red color, Figure 7).

3.8.2. IκB

Members of the IκB family have three distinct domains: an N-terminal domain that regulates signal-dependent degradation, a central ankyrin repeat region that binds to Rel/NF-κB and includes the degradation motif of IκB, and a region rich in proline, glutamic acid, serine, and threonine residues, known as the PEST sequence [64]. The sequence encoding the terminal domains of R. decussatus IκB was not amplified in this study. However, all six ankyrin repeats are included in the signal peptide (Figure 8) of the amplified sequence (Acc. No. PQ237690). The identified non-synonymous substitutions affect amino acids within the third and the sixth ankyrin repeats (Figure 8). We show two binding sites within this peptide in orange sticks in Figure 8. The first binding site, based on the I-TASSER prediction, spans from the left up to the third ankyrin repeat. The second (fourth to sixth ankyrin repeat) is based on the annotation of the same peptide in Mercenaria mercenaria (XP_045178270.2) and Meretrix meretrix (ADK74377.1) from GenBank. The amino acid affected by the second identified SNP (cds-809) belongs to the sixth ankyrin repeat and is adjacent to the second peptide binding site of IκB (Figure 8).

3.8.3. phage-type lysozyme

The obtained sequence of the R. decussatus phage-type lysozyme encodes 140 amino acids. The homologous protein in R. phillipinarum (AIH07346.1), M. meretrix (ALL27387.1), and M. mercenaria (XCD29959.1) contains 154 amino acids. The amplified sequence (Acc. No. PQ237691) encodes amino acids 14–153 of the corresponding proteins in the aforementioned clams. The 3D structure of the signal peptide is shown in Figure 9. The active site and the ligand binding site residues, as were predicted in I-TASSER, appear in cyan and orange sticks, respectively. The identified SNPs change two amino acids (red color) that are potentially not critical to the core catalytic function.

4. Discussion

Microorganisms within the Vibrio splendidus clade are frequently described as common symbiotic microorganisms of marine animals. The Vibrio splendidus group contains significant opportunistic pathogens commonly found in seawater and sediments. In this study, a Vibrio splendidus strain isolated from moribund Pinna nobilis [55] was used for experimental injections. This strain harbors virulence genes, including a metalloprotease, a hemolysin, and an adhesin (ompU). Although phenotypic and genotypic virulence patterns may not always correlate [65], the presence of virulence-related genes can still contribute to mortality [66]. In this experiment, mortality was significantly higher in all bacteria-injected groups compared to PBS-injected groups across all temperatures, suggesting that this strain may have pathogenic potential in R. decussatus under the tested conditions.
Vibrios belonging to the Splendidus clade can infect a broad range of aquatic animals and have been linked with mass mortalities in shellfish populations [67]. Warmer temperatures can exacerbate the impact Vibrio splendidus infections in bivalves [68]. In the present study, infected clams at all temperatures exhibited higher mortality than PBS-injected (control) groups, and higher mortalities were found at higher temperatures. After 32 days, control individuals at 24 °C experienced 25.7% mortality, which was higher than the Vibrio-injected treatment at 18 °C, and comparable to infected animals at 22 °C. Bacterial injections at 24 °C resulted in 42% mortality, suggesting that the elevated mortality in infected clams at this temperature was due to the combined effect of high temperature and bacterial infection rather than bacterial pathogenicity alone.
Healthy populations of R. decussatus from Vistonikos Bay (northeastern Mediterranean), where our clams were obtained, exhibited high vulnerability to temperatures above 24 °C [69], unpublished data, with mortality reaching 30% after 20 days at 24.5 °C. This rationale guided our choice of 24 °C as the upper temperature limit for the current study. In contrast, a western Mediterranean population showed only 7% mortality after 28 days at 25 °C [70], and generally, a higher upper thermal tolerance has been reported for this species in the western Mediterranean [71]. Such differences may be influenced by local temperatures, as temperature tolerance in aquatic organisms is shaped by the environmental conditions they naturally encounter [72]. Given also the significant genetic subdivision between eastern and western Mediterranean populations of R. decussatus [73], variations in thermal stress tolerance across regions are expected.
Allam et al. [74] reported significant mortalities in R. philippinarum when V. tapetis was injected directly into the posterior adductor muscle or the central extrapallial space. In contrast, minor mortality was found with injections in the pallial cavity since survivors rapidly eradicated the pathogen from tissues, highlighting the importance of external barriers for pathogen elimination [74]. In this study, injections were made in the peripheral extrapallial cavity (between the mantle and the shell), and clams were left out of the aquaria for 6 h to facilitate infection. This approach bypassed the physical barrier of the periostracal lamina, aiding bacterial colonization in the extrapallial fluids.However, this area is less connected to vital organs or major circulatory systems, and therefore, the way the injections were performed possibly allowed the clams to trigger an effective immune response. Except for the injection site, the quantity of the bacteria significantly influences the progression of an experimental infection. For instance, the experiment in the Manila clam R. phillipinarum by Le Bris et al. [75], who inoculated V. tapetis with a 500-fold lower concentrationcompared to Allam et al. [74], resulted in remarkably lower mortality rates.
The transcription of lysozyme was earlier found to increase in the tissues of different clams in response to pathogen exposure [76,77]. The two phage-type lysozyme genes in R. phillipinarum were induced by both Gram-negative and Gram-positive bacteria [23,78]. In this study, phagelysozyme mRNA was significantly upregulated in all Vibrio-injected groups, with an approximate constant 2-fold increase at 18 °C and 22 °C. Infected clams at 24 °C showed an early increase until hour 12 and a threefold increase on day 20. Ding et al. [78] also observed a gradual increase in phage-type lysozyme mRNA in R. phillipinarum immediately after injection with immune stimulant, and a significant decrease after 72 h. Interestingly, all groups showed similar mRNA levels of lysozyme to controls on day 7, and again an increased transcription on day 20. The elevated transcription on day 20 inall infected treatments, along with the sustained mortalities, suggests that clams continue to combat the pathogen twenty days after the infection.
Bacterial challenges in bivalves commonly lead to the enhancement of superoxide dismutase mRNA within two days, likely due to the increased need for ROS scavenging after their accumulation caused by the infection [79,80,81]. In our study, bacteria resulted in the elevation of Cu-Zn sod transcription, and a peak on day 7 at all temperatures. Wang et al. [80] highlighted the importance of maintaining the redox balance to counteract pathogen infection in the clam Meretrix meretrix. In this study, infected animals at 18 °C and 22 °C dropped the expression of Cu-Zn sod at control levels on day 20, possibly due to an effective immune response as it is also witnessed by the low mortality rates after day 20. In contrast, on day 20, infected clams at 24 °C exhibited elevated Cu-Zn sod mRNA levels, which, along with the upregulated lysozyme and increased rate of mortality after day 20, suggests a prolonged activated immune response.
IκΒ transcription increased early in Vibrio-injected clams at all temperatures. The elevated transcription was maintained until hour 48 at 22 °C and 24 °C, whereas infected clams at 18 °C showed a constant mildly increased transcription until day 20. The rapid upregulation of IκB followed by a decrease after a few hours has been documented in several bivalves following injections with various Vibrio species [82,83,84]. In R. decussatus injected with V. alginolyticus, a peak expression was detected in hemocytes at hour 24 [85]. IκB is strongly transcribed following NF-κB activation, and its transcription is upregulated by NF-κB, which eventually leads to the downregulation of NF-κB activity through a negative feedback loop [33,86]. Therefore, the decrease in IκΒ mRNA to control levels on days 7 and 20 at 22 °C and 24 °C may indicate increased NF-κB activity in the later stages compared to the initial stages post-injection. This modulation of IκΒ expression might reflect an effective immune response by the clams or be a sign of impending mortality [87].
TRAF6 is a key adaptor molecule in the NF-κB signaling pathway that mediates NF-κB activation. Infected R. decussatus at 18 °C showed an approximate 2-fold increase in traf6 mRNA from hour 12 to day 20. The prolonged increase in traf6 transcription at 18 °C suggests a constantly activated NF-κB pathway that likely contributed to the sustained upregulation of IκB at 18 °C. At 22 °C and 24 °C, a rapid early increase until hour 12 was observed, followed by downregulation, and again increased transcription on day 20. The early peak, and then the upregulation of traf6 on day 20 at 22 °C and 24 °C, may correlate with the observed decrease in IκB transcription at later time points, reflecting a transient NF-κB activation which is possibly crucial in the later stages post-infection at these higher temperatures.
Hu et al. [46] identified a new member of the FADD family in R. phillipinarum. Their study showed that the overexpression of this gene in the Manila clam promoted apoptosis, and also positively regulated the NF-κB signaling. In our study, using the homologous gene of R. decussatus, infected clams at 24 °C exhibited an upregulation of IκB when fadd mRNA was at control levels, and a downregulation of IκB when fadd mRNA levels increased. This pattern was occasionally observed in the other temperatures as well. At 18 °C, fadd transcription found to increase on days 7 and 20 in infected clams, coinciding with equal to control Cu-Zn sod mRNA levels on day 20. This suggests a late induction of apoptotic processes at 18 °C, likely exacerbated by elevated oxidative damage since the surplus of ROS can activate apoptosis in bivalves [36,88]. A similar pattern of fadd expression was found in Vibrio-injected clams at 24 °C, with upregulation on days 7 and 20, but these clams showed increased Cu-Zn sod transcription inthe later stages of the infection. Along with the increased traf6 mRNA and control levels of IκΒ transcription at 24 °C on day 20, these findings suggest active apoptotic processes and NF-κB signaling that are likely linked with higher damage and thus increased mortality rates.
Infected animals at 22 °C showed the highest increase in fadd mRNA at hour 3, with elevated levels athour 12 and on day 7. The transcription of fadd in this group was found similar to controls on day 20, as was Cu-Zn sod. However, the increased lysozyme and traf6 transcription as well as the control levels of IκΒ indicates that clams at 22 °C also sustained their immune response against the pathogen twenty days post-infection. As earlier reported, the observed modulation of fadd and Cu-Zn sod transcription on day 20 either indicates an effective immune response or is a sign of impending mortality [87].
To our knowledge, in bivalves, only a few phage-type lysozymes have been identified e.g., [23,24,78]. There is evidence that two bivalve subclasses (Heterodonta and Palaeoheterodonta) acquired a bacteriophage lysozyme gene via horizontal gene transfer [89]. These lysozymes are crucial in combating infections, as they have demonstrated bactericidal activity against a range of pathogens in different bivalves [24,78]. The three catalytic residues (Glu20, Asp29, and Thr35) of the newly characterized gene in R. decussatus were in the same positions as in R. phillipinarum [78], suggesting that they may perform similar functions. Three non-synonymous substitutions were identified in the amplified sequence, all affecting amino acids not directly involvedin the primary catalytic role. In addition, one of them (cds-143) exhibited different genotype frequencies between resistant and susceptible clams, and thus it was correlated with a differential resilience of the clams against Vibrio infections. Such amino acid substitutions that are not affecting peptide regions not directly involved in the primary catalytic role can still significantly impact the structure, stability, interactions, and function of the protein [90,91].
IκB family members have three key domains: an N-terminal domain for degradation control, a central ankyrin repeat region for Rel/NF-κB binding, and a PEST sequence [64]. The terminal domains of R. decussatus IκB were not amplified in this study. However, the central ankyrin repeat including six repeats was obtained in the signal peptide. Ankyrin repeats are found in many important proteins and generally act as mediators of specific protein–protein interactions [92]. The two identified substitutions in the central ankyrin repeat showed significantly differential distributions of allele frequencies among resistant and susceptible clams and, therefore, were associated with increased resilience of R. decussatus to Vibrio infections. Such substitutions, even not located within the predicted peptide binding sites of IκB, may alter the interaction of IκΒ with Rel/NF-κB and thus influence the activation of this vital transcription factor.
FADD consists of the N-terminal death effector (DED) domain and the C-terminal death (DD) domain. The DD is attached to the receptor and the DED contains the binding site for procaspase-8 and procaspase-10 [46,93]. The death effector domain (DED) of FADD, with its six alpha-helices, specifically interacts with other DED-containing proteins to recruit procaspase-8 or procaspase-10 and form the death-inducing signaling complex (DISC), essential for apoptosis [43]. The complete DED domain was characterized in the newly characterized fadd gene of R. decussatus. A non-synonymous substitution affecting an amino acid within this domain was identified. However, this SNP did not showa significantly differential distribution of nucleotides and genotypes between the resilient and susceptible clams.

5. Conclusions

Different ocean warming scenarios predict a promotion of Vibrio spp. proliferation in bivalves by 2100 [94]. Clam production has been greatly impacted by the lack of strains resistant to infections from bacteria, viruses, or protists [36]. Therefore, comprehending the immune mechanisms of bivalve mollusks at the molecular level is crucial for disease management and the development of sustainable bivalve aquaculture. Further, this knowledge is essential for protecting wild populations from environmental stressors and emerging pathogens. Given the large spectrum of immune-related genes implicated in pathogen elimination, facilitating the selective breeding of resilient individuals necessitates the implementation of marker-assisted selection techniques. Immune response-associated genes emerge as prime candidates for markers linked with pathogen resistance [95]. The pathogenicity of Vibrio strains may intensify in bivalves with weakened immune systems, particularly under adverse environmental conditions [96]. This study shows that the mortality of R. decussatus infected with V. splendidus increases at higher temperatures. In addition, it deepens the understanding of the roles of Cu-Zn SOD, TRAF6, IκB, FADD, and phage-type lysozyme in host–pathogen interactions in marine bivalves, and identifies potential markers for resistance selection in the clam R. decussatus. The dynamics between clams and Vibrios were tested in controlled environmental conditions. We should keep in mind that the interaction can be modulated by various environmental factors including temperature fluctuations, the presence of other microorganisms, low oxygen levels, and pH fluctuations.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes10020072/s1, Table S1: Mean and standard deviation of fold change from gene expression analysis; Table S2: ANOVA results and Bonferroni post-hoc comparisons from gene expression analysis; Table S3: The χ2 and p values from chi-square tests on the distribution of genotypes and alleles in the coding sequences of fadd, IkB, and phage-type lysozyme between resilient and susceptible Ruditapes decussatus.

Author Contributions

Conceptualization, D.K.P., A.L. and B.M.; methodology, D.K.P., A.L., K.B. and I.A.G.; software, D.K.P.; validation, D.K.P., I.A.G. and B.M.; formal analysis, D.K.P.; investigation, D.K.P., A.L. and K.B.; resources, B.M.; data curation, D.K.P.; writing—original draft preparation, D.K.P.; writing—review and editing, I.A.G. and K.B.; visualization, D.K.P.; supervision, B.M. and I.A.G.; project administration, B.M.; funding acquisition, B.M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Hellenic Foundation for Research and Innovation (HFRI) under the 3rd Call for HFRI PhD Fellowships [Fellowship Number: 6050].

Institutional Review Board Statement

As per EU Directive 2010/63/EU, research involving invertebrate species is not typically subject to Ethics Committee or Institutional Review Board approval. However, the treatments applied were approved by the Greek Ministry of the Environment and Energy, given the code ΥΠΕΝ/ΔΙΠA/122930/8079 on 15 December 2022, and we can confirm that all procedures were conducted in accordance with the highest ethical standards and followed internationally recognized guidelines for animal care and use.

Informed Consent Statement

Not applicable.

Data Availability Statement

The nucleotide sequences of Ruditapes decussatus fadd, IκB, and phage-type lysozyme have been deposited in the National Center for Biotechnology Information repository (NCBI) with accession numbers PQ230466, PQ237690, and PQ237691, respectively. The sequence data will be released on 31 March 2025. The nucleotide sequence of Vibrio’s 16S rRNA (Acc. No. PQ826361) is also scheduled for release on 31 March 2025, while the hemolysin gene sequence (Acc. No. PQ867532) has already been released.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Binias, C.; Gonzalez, P.; Provost, M.; Lambert, C.; de Montaudouin, X. Brown muscle disease: Impact on Manila clam Venerupis (= Ruditapes) philippinarum biology. Fish Shellfish Immunol. 2014, 36, 510–518. [Google Scholar] [CrossRef]
  2. FAO. The State of World Fisheries and Aquaculture 2022; Towards Blue Transformation: Rome, Italy; Food and Agriculture Organization of the United Nations: Rome, Italy, 2022. [Google Scholar] [CrossRef]
  3. FAO. GLOBEFISH Highlights—International Markets for Fisheries and Aquaculture Products, Second Issue 2022, with January–December 2021 Statistics. Available online: https://www.fao.org/in-action/globefish/publications/details-publication/en/c/1604273/ (accessed on 2 September 2024).
  4. Cruz, A.; da Costa, F.; Fernández-Pérez, J.; Nantón, A.; Fernández-Boo, S.; Insua, A.; Méndez, J. Genetic variability in Ruditapes decussatus clam combined with Perkinsus infection level to support founder population selection for a breeding program. PeerJ 2020, 8, e9728. [Google Scholar] [CrossRef]
  5. Lafferty, K.D.; Harvell, C.D.; Conrad, J.M.; Friedman, C.S.; Kent, M.L.; Kuris, A.M.; Powell, E.N.; Rondeau, D.; Saksida, S.M. Infectious diseases affect marine fisheries and aquaculture economics. Annu. Rev. Mar. Sci. 2015, 7, 471–496. [Google Scholar] [CrossRef] [PubMed]
  6. Gestal, C.; Roch, P.; Renault, T.; Pallavicini, A.; Paillard, C.; Novoa, B.; Oubella, R.; Venier, P.; Figueras, A. Study of diseases and the immune system of bivalves using molecular biology and genomics. Rev. Fish Sci. 2008, 16 (Suppl. 1), 133–156. [Google Scholar] [CrossRef]
  7. Reichelt, J.L.; Baumann, P.; Baumann, L. Study of genetic relationships among marine species of the genera Beneckea and Photobacterium by means of in vitro DNA/DNA hybridization. Arch. Microbiol. 1976, 110, 101–120. [Google Scholar] [CrossRef]
  8. Destoumieux-Garzón, D.; Canesi, L.; Oyanedel, D.; Travers, M.A.; Charrière, G.M.; Pruzzo, C.; Vezzulli, L. Vibrio–bivalve interactions in health and disease. Environ. Microbiol. 2020, 22, 4323–4341. [Google Scholar] [CrossRef]
  9. Williams, J.W.; Ordonez, A.; Svenning, J.C. A unifying framework for studying and managing climate-driven rates of ecological change. Nat. Ecol. Evol. 2021, 5, 17–26. [Google Scholar] [CrossRef] [PubMed]
  10. Intergovernmental Panel on Climate Change. Summary for Policymakers. In Climate Change 2023: Synthesis Report; Contribution of Working Groups I, II and III to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change; Core Writing Team, Lee, H., Romero, J., Eds.; IPCC: Geneva, Switzerland, 2023; pp. 1–34. [Google Scholar] [CrossRef]
  11. Paillard, C.; Le Roux, F.; Borrego, J.J. Bacterial disease in marine bivalves, a review of recent studies: Trends and evolution. Aquat. Living Resour. 2004, 17, 477–498. [Google Scholar] [CrossRef]
  12. Schwaner, C.; Barbosa, M.; Connors, P.; Park, T.J.; de Silva, D.; Griffith, A.; Gobler, C.J.; Espinosa, E.P.; Allam, B. Experimental acidification increases susceptibility of Mercenaria mercenaria to infection by Vibrio species. Mar. Environ. Res. 2020, 154, 104872. [Google Scholar] [CrossRef]
  13. Petton, B.; Pernet, F.; Robert, R.; Boudry, P. Temperature influence on pathogen transmission and subsequent mortalities in juvenile Pacific oysters Crassostrea gigas. Aquac. Environ. Interac. 2013, 3, 257–273. [Google Scholar] [CrossRef]
  14. Green, T.J.; Siboni, N.; King, W.L.; Labbate, M.; Seymour, J.R.; Raftos, D. Simulated marine heat wave alters abundance and structure of Vibrio populations associated with the Pacific oyster resulting in a mass mortality event. Microb. Ecol. 2019, 77, 736–747. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, R.; Qiu, L.; Yu, Z.; Zi, J.; Yue, F.; Wang, L.; Zhang, H.; Teng, W.; Liu, X.; Song, L. Identification and characterisation of pathogenic Vibrio splendidus from Yesso scallop (Patinopecten yessoensis) cultured in a low temperature environment. J. Invertebr. Pathol. 2013, 114, 144–150. [Google Scholar] [CrossRef] [PubMed]
  16. Labreuche, Y.; Lambert, C.; Soudant, P.; Boulo, V.; Huvet, A.; Nicolas, J.L. Cellular and molecular hemocyte responses of the Pacific oyster, Crassostrea gigas, following bacterial infection with Vibrio aestuarianus strain 01/32. Microbes Infect. 2006, 8, 2715–2724. [Google Scholar] [CrossRef] [PubMed]
  17. Ellis, R.P.; Parry, H.; Spicer, J.I.; Hutchinson, T.H.; Pipe, R.K.; Widdicombe, S. Immunological function in marine invertebrates: Responses to environmental perturbation. Fish Shellfish Immunol. 2011, 30, 1209–1222. [Google Scholar] [CrossRef] [PubMed]
  18. Song, L.; Wang, L.; Qiu, L.; Zhang, H. Bivalve immunity. Adv. Exp. Med. Biol. 2010, 708, 44–65. [Google Scholar]
  19. Allam, B.; Raftos, D. Immune responses to infectious diseases in bivalves. J. Invertebr. Pathol. 2015, 131, 121–136. [Google Scholar] [CrossRef] [PubMed]
  20. Liévin-Le Moal, V.; Servin, A.L. The front line of enteric host defense against unwelcome intrusion of harmful microorganisms: Mucins, antimicrobial peptides, and microbiota. Clin. Microbiol. Rev. 2006, 19, 315–337. [Google Scholar] [CrossRef] [PubMed]
  21. Russell, M.W.; Mestecky, J.; Strober, W.; Lambrecht, B.N.; Kelsall, B.L.; Cheroutre, H. Overview: The mucosal immune system. Mucosal Immunol. 2015, 1, 3–8. [Google Scholar] [CrossRef]
  22. Jollès, P.; Jollès, J. What’s new in lysozyme research? Always a model system, today as yesterday. Mol. Cell. Biochem. 1984, 63, 165–189. [Google Scholar] [CrossRef] [PubMed]
  23. Yang, D.; Wang, Q.; Chen, L.; Liu, Y.; Cao, R.; Wu, H.; Li, F.; Ji, C.; Cong, M.; Zhao, J. Molecular characterization and antibacterial activity of a phage-type lysozyme from the Manila clam, Ruditapes philippinarum. Fish Shellfish Immunol. 2017, 65, 17–24. [Google Scholar] [CrossRef]
  24. Huang, Y.; Song, J.; Soyano, K.; Ren, Q. Dorsal regulates the expression of two phage lysozymes acquired via horizontal gene transfer in triangle sail mussel Hyriopsis cumingii. Dev. Comp. Immunol. 2021, 120, 104068. [Google Scholar] [CrossRef] [PubMed]
  25. Donaghy, L.; Hong, H.K.; Jauzein, C.; Choi, K.S. The known and unknown sources of reactive oxygen and nitrogen species in haemocytes of marine bivalve molluscs. Fish Shellfish Immunol. 2015, 42, 91–97. [Google Scholar] [CrossRef] [PubMed]
  26. Zelko, I.N.; Mariani, T.J.; Folz, R.J. Superoxide dismutase multigene family: A comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radic. Biol. Med. 2002, 33, 337–349. [Google Scholar] [CrossRef] [PubMed]
  27. Li, C.; Sun, H.; Chen, A.; Ning, X.; Wu, H.; Qin, S.; Xue, Q.; Zhao, J. Identification and characterization of an intracellular Cu, Zn-superoxide dismutase (icCu/Zn-SOD) gene from clam Venerupis philippinarum. Fish Shellfish Immunol. 2010, 28, 499–503. [Google Scholar] [CrossRef] [PubMed]
  28. Umasuthan, N.; Bathige, S.D.N.K.; Revathy, K.S.; Lee, Y.; Whang, I.; Choi, C.Y.; Park, H.-C.; Lee, J. A manganese superoxide dismutase (MnSOD) from Ruditapes philippinarum: Comparative structural and expressional analysis with copper/zinc superoxide dismutase (Cu/Zn SOD) and biochemical analysis of its antioxidant activities. Fish Shellfish Immunol. 2012, 33, 753–765. [Google Scholar] [CrossRef] [PubMed]
  29. Toubiana, M.; Rosani, U.; Giambelluca, S.; Cammarata, M.; Gerdol, M.; Pallavicini, A.; Venier, P.; Roch, P. Toll signal transduction pathway in bivalves: Complete cds of intermediate elements and related gene transcription levels in hemocytes of immune stimulated Mytilus galloprovincialis. Dev. Comp. Immunol. 2014, 45, 300–312. [Google Scholar] [CrossRef]
  30. Su, J. Toll-like receptor signaling in teleosts. Sci. China Life Sci. 2025; in press. [Google Scholar]
  31. Gerdol, M. Immune-related genes in gastropods and bivalves: A comparative overview. Invertebr. Surviv. J. 2017, 14, 95–111. [Google Scholar]
  32. Gerdol, M.; Gomez-Chiarri, M.; Castillo, M.G.; Figueras, A.; Fiorito, G.; Moreira, R.; Novoa, B.; Pallavicini, A.; Ponte, G.; Roumbedakis, K.; et al. Immunity in molluscs: Recognition and effector mechanisms, with a focus on bivalvia. Adv. Comp. Immunol. 2018, 225–341. [Google Scholar] [CrossRef]
  33. Hayden, M.S.; Ghosh, S. Shared principles in NF-κB signaling. Cell 2008, 132, 344–362. [Google Scholar] [CrossRef]
  34. Pahl, H.L. Activators and target genes of Rel/NF-κB transcription factors. Oncogene 1999, 18, 6853–6866. [Google Scholar] [CrossRef] [PubMed]
  35. Sokolova, I.M. Apoptosis in molluscan immune defense. Invert. Surviv. J. 2009, 6, 49–58. [Google Scholar]
  36. de Lorgeril, J.; Zenagui, R.; Rosa, R.D.; Piquemal, D.; Bachère, E. Whole transcriptome profiling of successful immune response to Vibrio infections in the oyster Crassostrea gigas by digital gene expression analysis. PLoS ONE 2011, 6, e23142. [Google Scholar] [CrossRef] [PubMed]
  37. Carella, F.; Feist, S.W.; Bignell, J.P.; De Vico, G. Comparative pathology in bivalves: Aetiological agents and disease processes. J. Invertebr. Pathol. 2015, 131, 107–120. [Google Scholar] [CrossRef] [PubMed]
  38. Romero, A.; Novoa, B.; Figueras, A. The complexity of apoptotic cell death in mollusks: An update. Fish Shellfish Immunol. 2015, 46, 79–87. [Google Scholar] [CrossRef] [PubMed]
  39. Núñez-Acuña, G.; Gallardo-Escárate, C. Identification of immune-related SNPs in the transcriptome of Mytilus chilensis through high-throughput sequencing. Fish Shellfish Immunol. 2013, 35, 1899–1905. [Google Scholar] [CrossRef]
  40. Fulda, S.; Gorman, A.M.; Hori, O.; Samali, A. Cellular stress responses: Cell survival and cell death. Int. J. Cell Biol. 2010, 2010, 214074. [Google Scholar] [CrossRef] [PubMed]
  41. Aggarwal, B.B. Signalling pathways of the TNF superfamily: A double-edged sword. Nat. Rev. Immunol. 2003, 3, 745–756. [Google Scholar] [CrossRef]
  42. Fischer, U.; Jänicke, R.U.; Schulze-Osthoff, K. Many cuts to ruin: A comprehensive update of caspase substrates. Cell Death Differ. 2003, 10, 76–100. [Google Scholar] [CrossRef]
  43. Carrington, P.E.; Sandu, C.; Wei, Y.; Hill, J.M.; Morisawa, G.; Huang, T.; Gavathiotis, E.; Wei, Y.; Werner, M.H. The structure of FADD and its mode of interaction with procaspase-8. Mol. Cell 2006, 22, 599–610. [Google Scholar] [CrossRef]
  44. Zhang, L.; Li, L.; Zhang, G. Gene discovery, comparative analysis and expression profile reveal the complexity of the Crassostrea gigas apoptosis system. Dev. Comp. Immunol. 2011, 35, 603–610. [Google Scholar] [CrossRef] [PubMed]
  45. Chi, C.; Giri, S.S.; Jun, J.W.; Kim, H.J.; Yun, S.; Kim, S.W.; Kang, J.W.; Park, S.C. Detoxification, apoptosis, and immune transcriptomic responses of the gill tissue of bay scallop following exposure to the algicide thiazolidinedione 49. Biomolecules 2019, 9, 310. [Google Scholar] [CrossRef]
  46. Hu, G.; Han, Y.; Yang, D.; Cao, R.; Wang, Q.; Liu, H.; Zhao, J. Molecular cloning and characterization of FADD from the manila clam Ruditapes philippinarum. Fish Shellfish Immunol. 2019, 88, 556–566. [Google Scholar] [CrossRef]
  47. Alfaro, A.C.; Nguyen, T.V.; Merien, F. The complex interactions of Ostreid herpesvirus 1, Vibrio bacteria, environment and host factors in mass mortality outbreaks of Crassostrea gigas. Rev. Aquac. 2019, 11, 1148–1168. [Google Scholar] [CrossRef]
  48. Travers, M.A.; Miller, K.B.; Roque, A.; Friedman, C.S. Bacterial diseases in marine bivalves. J. Invertebr. Pathol. 2015, 131, 11–31. [Google Scholar] [CrossRef]
  49. Gómez-León, J.; Villamil, L.; Lemos, M.L.; Novoa, B.; Figueras, A. Isolation of Vibrio alginolyticus and Vibrio splendidus from aquacultured carpet shell clam (Ruditapes decussatus) larvae associated with mass mortalities. Appl. Environ. Microbiol. 2005, 71, 98–104. [Google Scholar] [CrossRef]
  50. Beaz-Hidalgo, R.; Balboa, S.; Romalde, J.L.; Figueras, M.J. Diversity and pathogenecity of Vibrio species in cultured bivalve molluscs. Environ. Microbiol. Rep. 2010, 2, 34–43. [Google Scholar] [CrossRef] [PubMed]
  51. Zhang, W.; Li, C. Virulence mechanisms of vibrios belonging to the Splendidus clade as aquaculture pathogens, from case studies and genome data. Rev. Aquacult. 2021, 13, 2004–2026. [Google Scholar] [CrossRef]
  52. Liao, Z.; Wan, Q.; Shang, X.; Su, J. Large-scale SNP screenings identify markers linked with GCRV resistant traits through transcriptomes of individuals and cell lines in Ctenopharyngodon idella. Sci. Rep. 2017, 7, 1184. [Google Scholar] [CrossRef]
  53. Ceccarelli, D.; Amaro, C.; Romalde, J.L.; Suffredini, E.; Vezzulli, L. Vibrio species. In Food microbiology: Fundamentals and Frontiers, 5th ed.; Doyle, M.P., Diez-Gonzalez, F., Colin, H., Eds.; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2019; pp. 347–388. [Google Scholar]
  54. World Sea Temperatures. Available online: https://www.seatemperature.org/europe/greece/#:~:text (accessed on 28 September 2024).
  55. Lattos, A.; Bitchava, K.; Giantsis, I.A.; Theodorou, J.A.; Batargias, C.; Michaelidis, B. The implication of Vibrio bacteria in the winter mortalities of the critically endangered Pinna nobilis. Microorganisms 2021, 9, 922. [Google Scholar] [CrossRef] [PubMed]
  56. Frank, J.A.; Reich, C.I.; Sharma, S.; Weisbaum, J.S.; Wilson, B.A.; Olsen, G.J. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl. Environ. Microbiol. 2008, 74, 2461–2470. [Google Scholar] [CrossRef] [PubMed]
  57. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
  58. Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 1999, 132, 365–386. [Google Scholar] [CrossRef]
  59. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  60. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  61. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  62. Yang, J.; Zhang, Y. I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef]
  63. Zhang, Y. I-TASSER server for protein 3D structure prediction. BMC Bioinf. 2008, 9, 40. [Google Scholar] [CrossRef]
  64. Huxford, T.; Huang, D.B.; Malek, S.; Ghosh, G. The crystal structure of the IκBα/NF-κB complex reveals mechanisms of NF-κB inactivation. Cell 1998, 95, 759–770. [Google Scholar] [CrossRef] [PubMed]
  65. Nasfi, H.; Travers, M.A.; de Lorgeril, J.; Habib, C.; Sannie, T.; Sorieul, L.; Gerard, J.; Avarre, J.C.; Haffner, P.; Tourbiez, D.; et al. A European epidemiological survey of Vibrio splendidus clade shows unexplored diversity and massive exchange of virulence factors. World J. Microbiol. Biotechnol. 2015, 31, 461–475. [Google Scholar] [CrossRef]
  66. Battistini, R.; Varello, K.; Listorti, V.; Zambon, M.; Arcangeli, G.; Bozzetta, E.; Serracca, L. Microbiological and histological analysis for the evaluation of farmed mussels (Mytilus galloprovincialis) health status, in coastal areas of Italy. Pathogens 2020, 9, 395. [Google Scholar] [CrossRef]
  67. Le Roux, F.; Gay, M.; Lambert, C.; Nicolas, J.L.; Gouy, M.; Berthe, F. Phylogenetic study and identification of Vibrio splendidus-related strains based on gyrB gene sequences. Dis. Aquat. Org. 2004, 58, 143–150. [Google Scholar] [CrossRef] [PubMed]
  68. Le Roux, F.; Gay, M.; Lambert, C.; Waechter, M.; Poubalanne, S.; Chollet, B.; Nicolas, J.-L.; Berthe, F. Comparative analysis of Vibrio splendidus-related strains isolated during Crassostrea gigas mortality events. Aquat. Living Resour. 2002, 15, 251–258. [Google Scholar] [CrossRef]
  69. Papadopoulos, D.K.; Michaelidis, B.; Giantsis, I.A. Climate Change-Driven Evolution in Ruditapes Decussatus: Gene Expression Dynamics and Novel SNPs Linked to Thermal Resilience in Antioxidant Genes; Aristotle University of Thessaloniki: Thessaloniki, Greece, 2025; manuscript under review. [Google Scholar]
  70. Velez, C.; Figueira, E.; Soares, A.M.; Freitas, R. Effects of seawater temperature increase on economically relevant native and introduced clam species. Mar. Environ. Res. 2017, 123, 62–70. [Google Scholar] [CrossRef] [PubMed]
  71. de Oliveira Sobral, M.P. Ecophysiology of Ruditapes decussatus. Ph.D. Dissertation, Universidade NOVA de Lisboa, Lisbon, Portugal, 1995. [Google Scholar]
  72. Sorte, C.J.; Jones, S.J.; Miller, L.P. Geographic variation in temperature tolerance as an indicator of potential population responses to climate change. J. Exp. Mar. Biol. Ecol. 2011, 400, 209–217. [Google Scholar] [CrossRef]
  73. Cordero, D.; Peña, J.B.; Saavedra, C. Phylogeographic analysis of introns and mitochondrial DNA in the clam Ruditapes decussatus uncovers the effects of Pleistocene glaciations and endogenous barriers to gene flow. Mol. Phylogenet. Evol. 2014, 71, 274–287. [Google Scholar] [CrossRef] [PubMed]
  74. Allam, B.; Paillard, C.; Ford, S.E. Pathogenicity of Vibrio tapetis, the etiological agent of brown ring disease in clams. Dis. Aquat. Org. 2002, 48, 221–231. [Google Scholar] [CrossRef]
  75. Le Bris, C.; Richard, G.; Paillard, C.; Lambert, C.; Seguineau, C.; Gauthier, O.; Pernet, F.; Guérard, F. Immune responses of phenoloxidase and superoxide dismutase in the manila clam Venerupis philippinarum challenged with Vibrio tapetis–Part I: Spatio-temporal evolution of enzymes’ activities post-infection. Fish Shellfish Immunol. 2015, 42, 16–24. [Google Scholar] [CrossRef] [PubMed]
  76. Perrigault, M.; Tanguy, A.; Allam, B. Identification and expression of differentially expressed genes in the hard clam, Mercenaria mercenaria, in response to quahog parasite unknown (QPX). BMC Genom. 2009, 10, 377. [Google Scholar] [CrossRef] [PubMed]
  77. Allam, B.; Espinosa, E.P.; Tanguy, A.; Jeffroy, F.; Le Bris, C.; Paillard, C. Transcriptional changes in Manila clam (Ruditapes philippinarum) in response to Brown Ring Disease. Fish Shellfish Immunol. 2014, 41, 2–11. [Google Scholar] [CrossRef]
  78. Ding, J.; Wang, R.; Yang, F.; Zhao, L.; Qin, Y.; Zhang, G.; Yan, X. Identification and characterization of a novel phage-type like lysozyme from Manila clam, Ruditapes philippinarum. Dev. Comp. Immunol. 2014, 47, 81–89. [Google Scholar] [CrossRef] [PubMed]
  79. Gao, X.; He, C.; Liu, H.; Li, H.; Zhu, D.; Cai, S.; Xia, Y.; Wang, Y.; Yu, Z. Intracellular Cu/Zn superoxide dismutase (Cu/Zn-SOD) from hard clam Meretrix meretrix: Its cDNA cloning, mRNA expression and enzyme activity. Mol. Biol. Rep. 2012, 39, 10713–10722. [Google Scholar] [CrossRef] [PubMed]
  80. Wang, C.; Yue, X.; Lu, X.; Liu, B. The role of catalase in the immune response to oxidative stress and pathogen challenge in the clam Meretrix meretrix. Fish Shellfish Immunol. 2013, 34, 91–99. [Google Scholar] [CrossRef] [PubMed]
  81. Omeka, W.K.M.; Liyanage, D.S.; Jeong, T.; Lee, S.; Lee, J. Molecular characterization, immune responses, and functional activities of manganese superoxide dismutase in disk abalone (Haliotis discus discus). Dev. Comp. Immunol. 2022, 127, 104299. [Google Scholar] [CrossRef] [PubMed]
  82. Lee, Y.; Wickamarachchi, W.D.N.; Whang, I.; Oh, M.; Umasuthan, N.; De Zoysa, M.; Oh, C.; Kang, D.-H.; Lee, J. Immune response-related gene expression profile of a novel molluscan IκB protein member from Manila clam (Ruditapes philippinarum). Mol. Biol. Rep. 2013, 40, 1519–1527. [Google Scholar] [CrossRef]
  83. Zhang, Y.; He, X.; Yu, Z. Two homologues of inhibitor of NF-kappa B (IκB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol. 2011, 30, 1354–1361. [Google Scholar] [CrossRef]
  84. Zhang, D.; Jiang, S.; Qiu, L.; Su, T.; Wu, K.; Li, Y.; Zhu, C.; Xu, X. Molecular characterization and expression analysis of the IκB gene from pearl oyster Pinctada fucata. Fish Shellfish Immunol. 2009, 26, 84–90. [Google Scholar] [CrossRef] [PubMed]
  85. Moreira, R.; Balseiro, P.; Romero, A.; Dios, S.; Posada, D.; Novoa, B.; Figueras, A. Gene expression analysis of clams Ruditapes philippinarum and Ruditapes decussatus following bacterial infection yields molecular insights into pathogen resistance and immunity. Dev. Comp. Immunol. 2012, 36, 140–149. [Google Scholar] [CrossRef] [PubMed]
  86. Sun, S.C.; Ganchi, P.A.; Ballard, D.W.; Greene, W.C. NF-κB controls expression of inhibitor IκBα: Evidence for an inducible autoregulatory pathway. Science 1993, 259, 1912–1915. [Google Scholar] [CrossRef]
  87. Moreira, R.; Milan, M.; Balseiro, P.; Romero, A.; Babbucci, M.; Figueras, A.; Bargelloni, L.; Novoa, B. Gene expression profile analysis of Manila clam (Ruditapes philippinarum) hemocytes after a Vibrio alginolyticus challenge using an immune-enriched oligo-microarray. BMC Genomics. 2014, 15, 1–16. [Google Scholar] [CrossRef]
  88. Wang, S.; Peatman, E.; Liu, H.; Bushek, D.; Ford, S.E.; Kucuktas, H.; Quilang, J.; Li, P.; Wallace, R.; Wang, Y.; et al. Microarray analysis of gene expression in eastern oyster (Crassostrea virginica) reveals a novel combination of antimicrobial and oxidative stress host responses after dermo (Perkinsus marinus) challenge. Fish Shellfish Immunol. 2010, 29, 921–929. [Google Scholar] [CrossRef]
  89. Ren, Q.; Wang, C.; Jin, M.; Lan, J.; Ye, T.; Hui, K.; Tan, J.; Wang, Z.; Wyckoff, G.J.; Wang, W.; et al. Co-option of bacteriophage lysozyme genes by bivalve genomes. Open Biol. 2017, 7, 160285. [Google Scholar] [CrossRef]
  90. Alberts, B.; Johnson, A.; Lewis, J.; Raff, M.; Roberts, K.; Walter, P. Molecular Biology of the Cell, 4th ed.; Garland Science: New York, NY, USA, 2002. [Google Scholar] [CrossRef]
  91. Dobson, C.M. Protein folding and misfolding. Nature 2003, 426, 884–890. [Google Scholar] [CrossRef] [PubMed]
  92. Mu, C.; Yu, Y.; Zhao, J.; Wang, L.; Song, X.; Zhang, H.; Qiu, L.; Song, L. An inhibitor κB homologue from bay scallop Argopecten irradians. Fish Shellfish Immunol. 2010, 28, 687–694. [Google Scholar] [CrossRef] [PubMed]
  93. Jeong, E.J.; Bang, S.; Lee, T.H.; Park, Y.I.; Sim, W.S.; Kim, K.S. The solution structure of FADD death domain: Structural basis of death domain interactions of Fas and FADD. J. Biol. Chem. 1999, 274, 16337–16342. [Google Scholar] [CrossRef]
  94. Ferchichi, H.; St-Hilaire, A.; Ouarda, T.B.; Lévesque, B. Impact of the future coastal water temperature scenarios on the risk of potential growth of pathogenic Vibrio marine bacteria. Estuar. Coast. Shelf. Sci. 2021, 250, 107094. [Google Scholar] [CrossRef]
  95. Bao, Y.; Li, L.; Zhang, G. Polymorphism of the superoxide dismutase gene family in the bay scallop (Argopecten irradians) and its association with resistance/susceptibility to Vibrio anguillarum. Dev. Comp. Immunol. 2010, 34, 553–561. [Google Scholar] [CrossRef] [PubMed]
  96. Balbi, T.; Fabbri, R.; Cortese, K.; Smerilli, A.; Ciacci, C.; Grande, C.; Vezzulli, L.; Pruzzo, C.; Canesi, L. Interactions between Mytilus galloprovincialis hemocytes and the bivalve pathogens Vibrio aestuarianus 01/032 and Vibrio splendidus LGP32. Fish Shellfish Immunol. 2013, 35, 1906–1915. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The experimental aquaria.
Figure 1. The experimental aquaria.
Fishes 10 00072 g001
Figure 2. Clam mortality in the different treatments during the experiment.
Figure 2. Clam mortality in the different treatments during the experiment.
Fishes 10 00072 g002
Figure 3. Relative mRNA levels of lysozyme in the mantles of Ruditapes decussatus. Expression is shown relative to the control clams (no Vibrio) at each temperature and sampling time. Values are means ± SD (n = 4). Different lowercase letters indicate significant differences (p < 0.05) between Vibrio-injected clams and their respective controls, as well as among injected groups within each temperature. Darker columns represent control conditions, while lighter columns indicate Vibrio-injected clams.
Figure 3. Relative mRNA levels of lysozyme in the mantles of Ruditapes decussatus. Expression is shown relative to the control clams (no Vibrio) at each temperature and sampling time. Values are means ± SD (n = 4). Different lowercase letters indicate significant differences (p < 0.05) between Vibrio-injected clams and their respective controls, as well as among injected groups within each temperature. Darker columns represent control conditions, while lighter columns indicate Vibrio-injected clams.
Fishes 10 00072 g003
Figure 4. Relative mRNA levels of Cu/Zn-sod in the mantles of Ruditapes decussatus. Expression is shown relative to the control clams (no Vibrio) at each temperature and sampling time. Values are means ± SD (n = 4). Different lowercase letters indicate significant differences (p < 0.05) between Vibrio-injected clams and their respective controls, as well as among the injected groups within each temperature. Darker columns represent control conditions, while lighter columns indicate Vibrio-injected clams.
Figure 4. Relative mRNA levels of Cu/Zn-sod in the mantles of Ruditapes decussatus. Expression is shown relative to the control clams (no Vibrio) at each temperature and sampling time. Values are means ± SD (n = 4). Different lowercase letters indicate significant differences (p < 0.05) between Vibrio-injected clams and their respective controls, as well as among the injected groups within each temperature. Darker columns represent control conditions, while lighter columns indicate Vibrio-injected clams.
Fishes 10 00072 g004
Figure 5. Relative mRNA levels of traf6 (a) and IκB (b) in the mantles of Ruditapes decussatus. Expression is shown relative to the control clams (no Vibrio) at each temperature and sampling time. Values are means ± SD (n = 4). Different lowercase letters indicate significant differences (p < 0.05) between Vibrio-injected clams and their respective controls, as well as among the injected groups within each temperature. Darker columns represent control conditions, while lighter columns indicate Vibrio-injected clams.
Figure 5. Relative mRNA levels of traf6 (a) and IκB (b) in the mantles of Ruditapes decussatus. Expression is shown relative to the control clams (no Vibrio) at each temperature and sampling time. Values are means ± SD (n = 4). Different lowercase letters indicate significant differences (p < 0.05) between Vibrio-injected clams and their respective controls, as well as among the injected groups within each temperature. Darker columns represent control conditions, while lighter columns indicate Vibrio-injected clams.
Fishes 10 00072 g005
Figure 6. Relative mRNA levels of fadd in the mantles of Ruditapes decussatus. Expression is shown relative to the control clams (no Vibrio) at each temperature and sampling time. Values are means ± SD (n = 4). Different lowercase letters indicate significant differences (p < 0.05) between Vibrio-injected clams and their controls, as well as among the injected groups within each temperature. Darker columns represent control conditions, while lighter columns indicate Vibrio-injected clams.
Figure 6. Relative mRNA levels of fadd in the mantles of Ruditapes decussatus. Expression is shown relative to the control clams (no Vibrio) at each temperature and sampling time. Values are means ± SD (n = 4). Different lowercase letters indicate significant differences (p < 0.05) between Vibrio-injected clams and their controls, as well as among the injected groups within each temperature. Darker columns represent control conditions, while lighter columns indicate Vibrio-injected clams.
Fishes 10 00072 g006
Figure 7. The three-dimensional (3D) structure of FADD (C-score = −0.17). Death effector domain (DED) is shown in orange and the rest of the peptide is shown in green. The amino acid affected by the polymorphism is displayed in red color.
Figure 7. The three-dimensional (3D) structure of FADD (C-score = −0.17). Death effector domain (DED) is shown in orange and the rest of the peptide is shown in green. The amino acid affected by the polymorphism is displayed in red color.
Fishes 10 00072 g007
Figure 8. The three-dimensional (3D) structure of the amplified region of IκB (C-score = −0.09). The six distinct ankyrin repeats are shown in different colors and the rest of the peptide is green. The amino acids of the peptide binding sites (C-score = 0.26, right side, C-score = 0.15, left side) are displayed as orange sticks. The two polymorphic amino acids (pink and purple ankyrin repeats) are shown as red sticks.
Figure 8. The three-dimensional (3D) structure of the amplified region of IκB (C-score = −0.09). The six distinct ankyrin repeats are shown in different colors and the rest of the peptide is green. The amino acids of the peptide binding sites (C-score = 0.26, right side, C-score = 0.15, left side) are displayed as orange sticks. The two polymorphic amino acids (pink and purple ankyrin repeats) are shown as red sticks.
Fishes 10 00072 g008
Figure 9. The three-dimensional (3D) structure of the phage-type lysozyme (C-score = 0.25). The amino acids of the hydrophobic cavity responsible for ligand binding (C-score = 0.64) are shown as orange sticks and the active site residues (C-score = 0.63) are represented by the cyan-colored sticks. The three polymorphic amino acids are shown as red sticks.
Figure 9. The three-dimensional (3D) structure of the phage-type lysozyme (C-score = 0.25). The amino acids of the hydrophobic cavity responsible for ligand binding (C-score = 0.64) are shown as orange sticks and the active site residues (C-score = 0.63) are represented by the cyan-colored sticks. The three polymorphic amino acids are shown as red sticks.
Fishes 10 00072 g009
Table 1. Water quality parameters in the different treatments during the experimental period. Values are mean ± SD.
Table 1. Water quality parameters in the different treatments during the experimental period. Values are mean ± SD.
AquariumNumber of ClamsVibrioTemperature (°C)Dissolved Oxygen (mg/L)pH
13017.8 ± 0.397.1 ± 0.328.32 ± 0.14
23018.1 ± 0.276.9 ± 0.368.29 ± 0.1
335+18.1 ± 0.196.9 ± 0.358.28 ± 0.11
435+18 ± 0.317 ± 0.248.27 ± 0.09
53022.2 ± 0.166.8 ± 0.438.27 ± 0.17
63022 ± 0.246.9 ± 0.218.29 ± 0.06
740+22.1 ± 0.266.9 ± 0.248.25 ± 0.13
840+21.9 ± 0.317 ± 0.358.28 ± 0.1
93524 ± 0.226.7 ± 0.48.23 ± 0.15
103523.8 ± 0.296.8 ± 0.318.22 ± 0.1
1152+23.9 ± 0.316.7 ± 0.268.21 ± 0.11
1252+24.1 ± 0.246.6 ± 0.378.23 ± 0.05
Table 2. Selected genes, primer sequences, primer efficiency (E), annealing temperature, amplicon size, and target sequence accession number of the genes used for gene expression analysis.
Table 2. Selected genes, primer sequences, primer efficiency (E), annealing temperature, amplicon size, and target sequence accession number of the genes used for gene expression analysis.
Target GeneForward Primer (5′-3′)
Reverse Primer (5′-3′)
E (%)AnnealingAmplicon (bp)GenBank Accession NumberReference
Phage-type lysozymeAACATGGCCTTCAATCTTGGA
TGTCTTTAACAGCTCTCATTCTGC
95.453 °C172PQ237691This study
Cu/Zn superoxide dismutase (Cu/Zn-sod)TGTGCATGAGTTTGGTGACA
CACTCTCATCAGCTGTGACA
94.253 °C140PQ072799This study
Tumor necrosis factor receptor associated factor 6 (traf6)CCATTTAGTGGAAGGATWGTTCT
GTGGTAAAAACTCCATGTAYCC
97.452 °C166KP067203.1
XM_060714923.1
This study
Inhibitor of NF-κB (IκB)TGGAGGCCAGGAACTATGATG
GCAGTGTTGTTGCTTCACAAG
94.357 °C200PQ237690This study
Fas-associated protein with death domain
(fadd)
AGAACTCTTCACAGCCTTGG
TGCTTGAGCCTGTTGTACTG
102.556 °C175PQ230466This study
18S ribosomal RNA (18S rRNA)CCCATTCGTGCTAGGGATTG
GTACAAAGGGCAGGGACGTA
98.854 °C106KX713340.1This study
Table 3. Primers and annealing temperatures used for gene amplification and polymorphism detection.
Table 3. Primers and annealing temperatures used for gene amplification and polymorphism detection.
GeneForward Primer (5′-3′)
Reverse Primer (5′-3′)
AnnealingExpected Amplicon Size (bp)GenBank Accession Number
Fas-associated protein with death domain
(fadd)
ATGGACGAGCGTCATAATTCC
ACATAAACAATCTGTTGTCCTG
51 °C396MH507512.1
Inhibitor of NF-κB (IκB)TGACGAGGACAGGTTAATTCC
CTTCATAWAGGCTCCTCRTTCA
49 °C≈950HM536186.1
XM_045322335.2
Phage-type lysozymeAAAGCCCAGCTGAAGGTAGA
TGTCTTTAACAGCTCTCATTCTGC
50 °C423KT934018.1
KJ427777.1
Table 4. Distribution of non-synonymous polymorphisms in the coding sequence (cds) of fadd, IκΒ, and phage-type lysozyme among Vibrio-resistant and -susceptible clams. The synonymous substitutions that exhibited similar distributions were not included in the Table. Chi-square and p-values are shown in Table S3.
Table 4. Distribution of non-synonymous polymorphisms in the coding sequence (cds) of fadd, IκΒ, and phage-type lysozyme among Vibrio-resistant and -susceptible clams. The synonymous substitutions that exhibited similar distributions were not included in the Table. Chi-square and p-values are shown in Table S3.
PositionGenotypesSusceptibleResistantMutation TypeAllele SusceptibleResistant
fadd
1 cds-198A/A16 (72.7)12 (54.6)Leu (L) or Phe (F)
TTA or TTT
A
T
33 (75)
11 (25)
29 (65.9)
15 (34.1)
A/T1 (4.6)5 (22.7)
T/T5 (22.7)5 (22.7)
IkB
1,2,3 cds-469G/G5 (22.7)13 (59.1)Ala (A) or Thr (T)
GCA or ACA
G
A
17 (38.6)
27 (61.4)
31 (70.5)
13 (29.5)
G/A7 (31.8)5 (22.7)
A/A10 (45.5)4 (18.2)
1,2,3 cds-809A/A5 (22.7)12 (54.6)Lys (K) or Arg (R)
AAG or AGG
G
A
29 (65.9)
15 (34.1)
17 (38.6)
27 (61.4)
A/G5 (22.7)3 (13.6)
G/G12 (54.6)7 (31.8)
phage-type lysozyme
2 cds-139A/A11 (50)11 (47.8)Asn (N) or Asp (D)
AAC or GAC
A
G
29 (65.9)
15 (34.1)
28 (60.9)
18 (39.1)
A/G7 (31.8)6 (26.1)
G/G4 (18.2)6 (26.1)
2,3 cds-143G/G18 (81.8)11(47.8)Arg (R) or Ile (I)
AGA or ATA
G
T
38 (86.4)
6 (13.6)
32 (69.6)
14 (30.4)
G/T2 (9.1)10 (43.5)
T/T2 (9.1)2 (8.7)
2 cds-240G/G18 (81.8)16 (69.6)Glu (E) or Asp (D)
GAG or GAT
G
T
40 (90.9)
4 (9.1)
38 (82.6)
8 (17.4)
G/T4 (18.2)6 (26.1)
T/T0 (0)1 (4.3)
1 Bolded positions indicate SNPs affecting amino acids within important regions of the protein based on the protein annotation. 2 Corresponds to the amplified partial sequence. 3 Indicates statistically significant differences between resistant and susceptible animals and the specific differences are underlined.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Papadopoulos, D.K.; Giantsis, I.A.; Lattos, A.; Bitchava, K.; Michaelidis, B. Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms. Fishes 2025, 10, 72. https://doi.org/10.3390/fishes10020072

AMA Style

Papadopoulos DK, Giantsis IA, Lattos A, Bitchava K, Michaelidis B. Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms. Fishes. 2025; 10(2):72. https://doi.org/10.3390/fishes10020072

Chicago/Turabian Style

Papadopoulos, Dimitrios K., Ioannis A. Giantsis, Athanasios Lattos, Konstantina Bitchava, and Basile Michaelidis. 2025. "Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms" Fishes 10, no. 2: 72. https://doi.org/10.3390/fishes10020072

APA Style

Papadopoulos, D. K., Giantsis, I. A., Lattos, A., Bitchava, K., & Michaelidis, B. (2025). Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms. Fishes, 10(2), 72. https://doi.org/10.3390/fishes10020072

Article Metrics

Back to TopTop