Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Collection and Acclimation Procedure
2.2. Trial Setup, Experimental Injections, and Sampling Procedure
2.3. Genetic Profiling of the Vibrio Strain
2.4. Selection of Animals for Genotyping
2.5. RNA Extraction and cDNA Synthesis
2.6. Gene Transcription Analysis
2.7. Sequencing and Sequence Analysis of Resistant and Susceptible Clams
2.8. Annotation and Structure of the Corresponding Proteins
2.9. Statistical Analysis
3. Results
3.1. Vibrio Strain
3.2. Mortality
3.3. Phage-Type Lysozyme Transcription
3.4. Cu-Zn Sod Transcription
3.5. Transcription of traf6 and IκB
3.6. Transcription of fadd
3.7. Characterized Polymorphisms and Their Distribution in Resistant Versus Susceptible Clams
3.7.1. fadd
3.7.2. IκB
3.7.3. phage-type lysozyme
3.8. Three-Dimensional (3D) Modeling, Annotation, and Visualization of the Signal Peptides
3.8.1. fadd
3.8.2. IκB
3.8.3. phage-type lysozyme
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Binias, C.; Gonzalez, P.; Provost, M.; Lambert, C.; de Montaudouin, X. Brown muscle disease: Impact on Manila clam Venerupis (= Ruditapes) philippinarum biology. Fish Shellfish Immunol. 2014, 36, 510–518. [Google Scholar] [CrossRef]
- FAO. The State of World Fisheries and Aquaculture 2022; Towards Blue Transformation: Rome, Italy; Food and Agriculture Organization of the United Nations: Rome, Italy, 2022. [Google Scholar] [CrossRef]
- FAO. GLOBEFISH Highlights—International Markets for Fisheries and Aquaculture Products, Second Issue 2022, with January–December 2021 Statistics. Available online: https://www.fao.org/in-action/globefish/publications/details-publication/en/c/1604273/ (accessed on 2 September 2024).
- Cruz, A.; da Costa, F.; Fernández-Pérez, J.; Nantón, A.; Fernández-Boo, S.; Insua, A.; Méndez, J. Genetic variability in Ruditapes decussatus clam combined with Perkinsus infection level to support founder population selection for a breeding program. PeerJ 2020, 8, e9728. [Google Scholar] [CrossRef]
- Lafferty, K.D.; Harvell, C.D.; Conrad, J.M.; Friedman, C.S.; Kent, M.L.; Kuris, A.M.; Powell, E.N.; Rondeau, D.; Saksida, S.M. Infectious diseases affect marine fisheries and aquaculture economics. Annu. Rev. Mar. Sci. 2015, 7, 471–496. [Google Scholar] [CrossRef] [PubMed]
- Gestal, C.; Roch, P.; Renault, T.; Pallavicini, A.; Paillard, C.; Novoa, B.; Oubella, R.; Venier, P.; Figueras, A. Study of diseases and the immune system of bivalves using molecular biology and genomics. Rev. Fish Sci. 2008, 16 (Suppl. 1), 133–156. [Google Scholar] [CrossRef]
- Reichelt, J.L.; Baumann, P.; Baumann, L. Study of genetic relationships among marine species of the genera Beneckea and Photobacterium by means of in vitro DNA/DNA hybridization. Arch. Microbiol. 1976, 110, 101–120. [Google Scholar] [CrossRef]
- Destoumieux-Garzón, D.; Canesi, L.; Oyanedel, D.; Travers, M.A.; Charrière, G.M.; Pruzzo, C.; Vezzulli, L. Vibrio–bivalve interactions in health and disease. Environ. Microbiol. 2020, 22, 4323–4341. [Google Scholar] [CrossRef]
- Williams, J.W.; Ordonez, A.; Svenning, J.C. A unifying framework for studying and managing climate-driven rates of ecological change. Nat. Ecol. Evol. 2021, 5, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Intergovernmental Panel on Climate Change. Summary for Policymakers. In Climate Change 2023: Synthesis Report; Contribution of Working Groups I, II and III to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change; Core Writing Team, Lee, H., Romero, J., Eds.; IPCC: Geneva, Switzerland, 2023; pp. 1–34. [Google Scholar] [CrossRef]
- Paillard, C.; Le Roux, F.; Borrego, J.J. Bacterial disease in marine bivalves, a review of recent studies: Trends and evolution. Aquat. Living Resour. 2004, 17, 477–498. [Google Scholar] [CrossRef]
- Schwaner, C.; Barbosa, M.; Connors, P.; Park, T.J.; de Silva, D.; Griffith, A.; Gobler, C.J.; Espinosa, E.P.; Allam, B. Experimental acidification increases susceptibility of Mercenaria mercenaria to infection by Vibrio species. Mar. Environ. Res. 2020, 154, 104872. [Google Scholar] [CrossRef]
- Petton, B.; Pernet, F.; Robert, R.; Boudry, P. Temperature influence on pathogen transmission and subsequent mortalities in juvenile Pacific oysters Crassostrea gigas. Aquac. Environ. Interac. 2013, 3, 257–273. [Google Scholar] [CrossRef]
- Green, T.J.; Siboni, N.; King, W.L.; Labbate, M.; Seymour, J.R.; Raftos, D. Simulated marine heat wave alters abundance and structure of Vibrio populations associated with the Pacific oyster resulting in a mass mortality event. Microb. Ecol. 2019, 77, 736–747. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Qiu, L.; Yu, Z.; Zi, J.; Yue, F.; Wang, L.; Zhang, H.; Teng, W.; Liu, X.; Song, L. Identification and characterisation of pathogenic Vibrio splendidus from Yesso scallop (Patinopecten yessoensis) cultured in a low temperature environment. J. Invertebr. Pathol. 2013, 114, 144–150. [Google Scholar] [CrossRef] [PubMed]
- Labreuche, Y.; Lambert, C.; Soudant, P.; Boulo, V.; Huvet, A.; Nicolas, J.L. Cellular and molecular hemocyte responses of the Pacific oyster, Crassostrea gigas, following bacterial infection with Vibrio aestuarianus strain 01/32. Microbes Infect. 2006, 8, 2715–2724. [Google Scholar] [CrossRef] [PubMed]
- Ellis, R.P.; Parry, H.; Spicer, J.I.; Hutchinson, T.H.; Pipe, R.K.; Widdicombe, S. Immunological function in marine invertebrates: Responses to environmental perturbation. Fish Shellfish Immunol. 2011, 30, 1209–1222. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Wang, L.; Qiu, L.; Zhang, H. Bivalve immunity. Adv. Exp. Med. Biol. 2010, 708, 44–65. [Google Scholar]
- Allam, B.; Raftos, D. Immune responses to infectious diseases in bivalves. J. Invertebr. Pathol. 2015, 131, 121–136. [Google Scholar] [CrossRef] [PubMed]
- Liévin-Le Moal, V.; Servin, A.L. The front line of enteric host defense against unwelcome intrusion of harmful microorganisms: Mucins, antimicrobial peptides, and microbiota. Clin. Microbiol. Rev. 2006, 19, 315–337. [Google Scholar] [CrossRef] [PubMed]
- Russell, M.W.; Mestecky, J.; Strober, W.; Lambrecht, B.N.; Kelsall, B.L.; Cheroutre, H. Overview: The mucosal immune system. Mucosal Immunol. 2015, 1, 3–8. [Google Scholar] [CrossRef]
- Jollès, P.; Jollès, J. What’s new in lysozyme research? Always a model system, today as yesterday. Mol. Cell. Biochem. 1984, 63, 165–189. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.; Wang, Q.; Chen, L.; Liu, Y.; Cao, R.; Wu, H.; Li, F.; Ji, C.; Cong, M.; Zhao, J. Molecular characterization and antibacterial activity of a phage-type lysozyme from the Manila clam, Ruditapes philippinarum. Fish Shellfish Immunol. 2017, 65, 17–24. [Google Scholar] [CrossRef]
- Huang, Y.; Song, J.; Soyano, K.; Ren, Q. Dorsal regulates the expression of two phage lysozymes acquired via horizontal gene transfer in triangle sail mussel Hyriopsis cumingii. Dev. Comp. Immunol. 2021, 120, 104068. [Google Scholar] [CrossRef] [PubMed]
- Donaghy, L.; Hong, H.K.; Jauzein, C.; Choi, K.S. The known and unknown sources of reactive oxygen and nitrogen species in haemocytes of marine bivalve molluscs. Fish Shellfish Immunol. 2015, 42, 91–97. [Google Scholar] [CrossRef] [PubMed]
- Zelko, I.N.; Mariani, T.J.; Folz, R.J. Superoxide dismutase multigene family: A comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radic. Biol. Med. 2002, 33, 337–349. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Sun, H.; Chen, A.; Ning, X.; Wu, H.; Qin, S.; Xue, Q.; Zhao, J. Identification and characterization of an intracellular Cu, Zn-superoxide dismutase (icCu/Zn-SOD) gene from clam Venerupis philippinarum. Fish Shellfish Immunol. 2010, 28, 499–503. [Google Scholar] [CrossRef] [PubMed]
- Umasuthan, N.; Bathige, S.D.N.K.; Revathy, K.S.; Lee, Y.; Whang, I.; Choi, C.Y.; Park, H.-C.; Lee, J. A manganese superoxide dismutase (MnSOD) from Ruditapes philippinarum: Comparative structural and expressional analysis with copper/zinc superoxide dismutase (Cu/Zn SOD) and biochemical analysis of its antioxidant activities. Fish Shellfish Immunol. 2012, 33, 753–765. [Google Scholar] [CrossRef] [PubMed]
- Toubiana, M.; Rosani, U.; Giambelluca, S.; Cammarata, M.; Gerdol, M.; Pallavicini, A.; Venier, P.; Roch, P. Toll signal transduction pathway in bivalves: Complete cds of intermediate elements and related gene transcription levels in hemocytes of immune stimulated Mytilus galloprovincialis. Dev. Comp. Immunol. 2014, 45, 300–312. [Google Scholar] [CrossRef]
- Su, J. Toll-like receptor signaling in teleosts. Sci. China Life Sci. 2025; in press. [Google Scholar]
- Gerdol, M. Immune-related genes in gastropods and bivalves: A comparative overview. Invertebr. Surviv. J. 2017, 14, 95–111. [Google Scholar]
- Gerdol, M.; Gomez-Chiarri, M.; Castillo, M.G.; Figueras, A.; Fiorito, G.; Moreira, R.; Novoa, B.; Pallavicini, A.; Ponte, G.; Roumbedakis, K.; et al. Immunity in molluscs: Recognition and effector mechanisms, with a focus on bivalvia. Adv. Comp. Immunol. 2018, 225–341. [Google Scholar] [CrossRef]
- Hayden, M.S.; Ghosh, S. Shared principles in NF-κB signaling. Cell 2008, 132, 344–362. [Google Scholar] [CrossRef]
- Pahl, H.L. Activators and target genes of Rel/NF-κB transcription factors. Oncogene 1999, 18, 6853–6866. [Google Scholar] [CrossRef] [PubMed]
- Sokolova, I.M. Apoptosis in molluscan immune defense. Invert. Surviv. J. 2009, 6, 49–58. [Google Scholar]
- de Lorgeril, J.; Zenagui, R.; Rosa, R.D.; Piquemal, D.; Bachère, E. Whole transcriptome profiling of successful immune response to Vibrio infections in the oyster Crassostrea gigas by digital gene expression analysis. PLoS ONE 2011, 6, e23142. [Google Scholar] [CrossRef] [PubMed]
- Carella, F.; Feist, S.W.; Bignell, J.P.; De Vico, G. Comparative pathology in bivalves: Aetiological agents and disease processes. J. Invertebr. Pathol. 2015, 131, 107–120. [Google Scholar] [CrossRef] [PubMed]
- Romero, A.; Novoa, B.; Figueras, A. The complexity of apoptotic cell death in mollusks: An update. Fish Shellfish Immunol. 2015, 46, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Núñez-Acuña, G.; Gallardo-Escárate, C. Identification of immune-related SNPs in the transcriptome of Mytilus chilensis through high-throughput sequencing. Fish Shellfish Immunol. 2013, 35, 1899–1905. [Google Scholar] [CrossRef]
- Fulda, S.; Gorman, A.M.; Hori, O.; Samali, A. Cellular stress responses: Cell survival and cell death. Int. J. Cell Biol. 2010, 2010, 214074. [Google Scholar] [CrossRef] [PubMed]
- Aggarwal, B.B. Signalling pathways of the TNF superfamily: A double-edged sword. Nat. Rev. Immunol. 2003, 3, 745–756. [Google Scholar] [CrossRef]
- Fischer, U.; Jänicke, R.U.; Schulze-Osthoff, K. Many cuts to ruin: A comprehensive update of caspase substrates. Cell Death Differ. 2003, 10, 76–100. [Google Scholar] [CrossRef]
- Carrington, P.E.; Sandu, C.; Wei, Y.; Hill, J.M.; Morisawa, G.; Huang, T.; Gavathiotis, E.; Wei, Y.; Werner, M.H. The structure of FADD and its mode of interaction with procaspase-8. Mol. Cell 2006, 22, 599–610. [Google Scholar] [CrossRef]
- Zhang, L.; Li, L.; Zhang, G. Gene discovery, comparative analysis and expression profile reveal the complexity of the Crassostrea gigas apoptosis system. Dev. Comp. Immunol. 2011, 35, 603–610. [Google Scholar] [CrossRef] [PubMed]
- Chi, C.; Giri, S.S.; Jun, J.W.; Kim, H.J.; Yun, S.; Kim, S.W.; Kang, J.W.; Park, S.C. Detoxification, apoptosis, and immune transcriptomic responses of the gill tissue of bay scallop following exposure to the algicide thiazolidinedione 49. Biomolecules 2019, 9, 310. [Google Scholar] [CrossRef]
- Hu, G.; Han, Y.; Yang, D.; Cao, R.; Wang, Q.; Liu, H.; Zhao, J. Molecular cloning and characterization of FADD from the manila clam Ruditapes philippinarum. Fish Shellfish Immunol. 2019, 88, 556–566. [Google Scholar] [CrossRef]
- Alfaro, A.C.; Nguyen, T.V.; Merien, F. The complex interactions of Ostreid herpesvirus 1, Vibrio bacteria, environment and host factors in mass mortality outbreaks of Crassostrea gigas. Rev. Aquac. 2019, 11, 1148–1168. [Google Scholar] [CrossRef]
- Travers, M.A.; Miller, K.B.; Roque, A.; Friedman, C.S. Bacterial diseases in marine bivalves. J. Invertebr. Pathol. 2015, 131, 11–31. [Google Scholar] [CrossRef]
- Gómez-León, J.; Villamil, L.; Lemos, M.L.; Novoa, B.; Figueras, A. Isolation of Vibrio alginolyticus and Vibrio splendidus from aquacultured carpet shell clam (Ruditapes decussatus) larvae associated with mass mortalities. Appl. Environ. Microbiol. 2005, 71, 98–104. [Google Scholar] [CrossRef]
- Beaz-Hidalgo, R.; Balboa, S.; Romalde, J.L.; Figueras, M.J. Diversity and pathogenecity of Vibrio species in cultured bivalve molluscs. Environ. Microbiol. Rep. 2010, 2, 34–43. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Li, C. Virulence mechanisms of vibrios belonging to the Splendidus clade as aquaculture pathogens, from case studies and genome data. Rev. Aquacult. 2021, 13, 2004–2026. [Google Scholar] [CrossRef]
- Liao, Z.; Wan, Q.; Shang, X.; Su, J. Large-scale SNP screenings identify markers linked with GCRV resistant traits through transcriptomes of individuals and cell lines in Ctenopharyngodon idella. Sci. Rep. 2017, 7, 1184. [Google Scholar] [CrossRef]
- Ceccarelli, D.; Amaro, C.; Romalde, J.L.; Suffredini, E.; Vezzulli, L. Vibrio species. In Food microbiology: Fundamentals and Frontiers, 5th ed.; Doyle, M.P., Diez-Gonzalez, F., Colin, H., Eds.; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2019; pp. 347–388. [Google Scholar]
- World Sea Temperatures. Available online: https://www.seatemperature.org/europe/greece/#:~:text (accessed on 28 September 2024).
- Lattos, A.; Bitchava, K.; Giantsis, I.A.; Theodorou, J.A.; Batargias, C.; Michaelidis, B. The implication of Vibrio bacteria in the winter mortalities of the critically endangered Pinna nobilis. Microorganisms 2021, 9, 922. [Google Scholar] [CrossRef] [PubMed]
- Frank, J.A.; Reich, C.I.; Sharma, S.; Weisbaum, J.S.; Wilson, B.A.; Olsen, G.J. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl. Environ. Microbiol. 2008, 74, 2461–2470. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 1999, 132, 365–386. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Zhang, Y. I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef]
- Zhang, Y. I-TASSER server for protein 3D structure prediction. BMC Bioinf. 2008, 9, 40. [Google Scholar] [CrossRef]
- Huxford, T.; Huang, D.B.; Malek, S.; Ghosh, G. The crystal structure of the IκBα/NF-κB complex reveals mechanisms of NF-κB inactivation. Cell 1998, 95, 759–770. [Google Scholar] [CrossRef] [PubMed]
- Nasfi, H.; Travers, M.A.; de Lorgeril, J.; Habib, C.; Sannie, T.; Sorieul, L.; Gerard, J.; Avarre, J.C.; Haffner, P.; Tourbiez, D.; et al. A European epidemiological survey of Vibrio splendidus clade shows unexplored diversity and massive exchange of virulence factors. World J. Microbiol. Biotechnol. 2015, 31, 461–475. [Google Scholar] [CrossRef]
- Battistini, R.; Varello, K.; Listorti, V.; Zambon, M.; Arcangeli, G.; Bozzetta, E.; Serracca, L. Microbiological and histological analysis for the evaluation of farmed mussels (Mytilus galloprovincialis) health status, in coastal areas of Italy. Pathogens 2020, 9, 395. [Google Scholar] [CrossRef]
- Le Roux, F.; Gay, M.; Lambert, C.; Nicolas, J.L.; Gouy, M.; Berthe, F. Phylogenetic study and identification of Vibrio splendidus-related strains based on gyrB gene sequences. Dis. Aquat. Org. 2004, 58, 143–150. [Google Scholar] [CrossRef] [PubMed]
- Le Roux, F.; Gay, M.; Lambert, C.; Waechter, M.; Poubalanne, S.; Chollet, B.; Nicolas, J.-L.; Berthe, F. Comparative analysis of Vibrio splendidus-related strains isolated during Crassostrea gigas mortality events. Aquat. Living Resour. 2002, 15, 251–258. [Google Scholar] [CrossRef]
- Papadopoulos, D.K.; Michaelidis, B.; Giantsis, I.A. Climate Change-Driven Evolution in Ruditapes Decussatus: Gene Expression Dynamics and Novel SNPs Linked to Thermal Resilience in Antioxidant Genes; Aristotle University of Thessaloniki: Thessaloniki, Greece, 2025; manuscript under review. [Google Scholar]
- Velez, C.; Figueira, E.; Soares, A.M.; Freitas, R. Effects of seawater temperature increase on economically relevant native and introduced clam species. Mar. Environ. Res. 2017, 123, 62–70. [Google Scholar] [CrossRef] [PubMed]
- de Oliveira Sobral, M.P. Ecophysiology of Ruditapes decussatus. Ph.D. Dissertation, Universidade NOVA de Lisboa, Lisbon, Portugal, 1995. [Google Scholar]
- Sorte, C.J.; Jones, S.J.; Miller, L.P. Geographic variation in temperature tolerance as an indicator of potential population responses to climate change. J. Exp. Mar. Biol. Ecol. 2011, 400, 209–217. [Google Scholar] [CrossRef]
- Cordero, D.; Peña, J.B.; Saavedra, C. Phylogeographic analysis of introns and mitochondrial DNA in the clam Ruditapes decussatus uncovers the effects of Pleistocene glaciations and endogenous barriers to gene flow. Mol. Phylogenet. Evol. 2014, 71, 274–287. [Google Scholar] [CrossRef] [PubMed]
- Allam, B.; Paillard, C.; Ford, S.E. Pathogenicity of Vibrio tapetis, the etiological agent of brown ring disease in clams. Dis. Aquat. Org. 2002, 48, 221–231. [Google Scholar] [CrossRef]
- Le Bris, C.; Richard, G.; Paillard, C.; Lambert, C.; Seguineau, C.; Gauthier, O.; Pernet, F.; Guérard, F. Immune responses of phenoloxidase and superoxide dismutase in the manila clam Venerupis philippinarum challenged with Vibrio tapetis–Part I: Spatio-temporal evolution of enzymes’ activities post-infection. Fish Shellfish Immunol. 2015, 42, 16–24. [Google Scholar] [CrossRef] [PubMed]
- Perrigault, M.; Tanguy, A.; Allam, B. Identification and expression of differentially expressed genes in the hard clam, Mercenaria mercenaria, in response to quahog parasite unknown (QPX). BMC Genom. 2009, 10, 377. [Google Scholar] [CrossRef] [PubMed]
- Allam, B.; Espinosa, E.P.; Tanguy, A.; Jeffroy, F.; Le Bris, C.; Paillard, C. Transcriptional changes in Manila clam (Ruditapes philippinarum) in response to Brown Ring Disease. Fish Shellfish Immunol. 2014, 41, 2–11. [Google Scholar] [CrossRef]
- Ding, J.; Wang, R.; Yang, F.; Zhao, L.; Qin, Y.; Zhang, G.; Yan, X. Identification and characterization of a novel phage-type like lysozyme from Manila clam, Ruditapes philippinarum. Dev. Comp. Immunol. 2014, 47, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; He, C.; Liu, H.; Li, H.; Zhu, D.; Cai, S.; Xia, Y.; Wang, Y.; Yu, Z. Intracellular Cu/Zn superoxide dismutase (Cu/Zn-SOD) from hard clam Meretrix meretrix: Its cDNA cloning, mRNA expression and enzyme activity. Mol. Biol. Rep. 2012, 39, 10713–10722. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Yue, X.; Lu, X.; Liu, B. The role of catalase in the immune response to oxidative stress and pathogen challenge in the clam Meretrix meretrix. Fish Shellfish Immunol. 2013, 34, 91–99. [Google Scholar] [CrossRef] [PubMed]
- Omeka, W.K.M.; Liyanage, D.S.; Jeong, T.; Lee, S.; Lee, J. Molecular characterization, immune responses, and functional activities of manganese superoxide dismutase in disk abalone (Haliotis discus discus). Dev. Comp. Immunol. 2022, 127, 104299. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.; Wickamarachchi, W.D.N.; Whang, I.; Oh, M.; Umasuthan, N.; De Zoysa, M.; Oh, C.; Kang, D.-H.; Lee, J. Immune response-related gene expression profile of a novel molluscan IκB protein member from Manila clam (Ruditapes philippinarum). Mol. Biol. Rep. 2013, 40, 1519–1527. [Google Scholar] [CrossRef]
- Zhang, Y.; He, X.; Yu, Z. Two homologues of inhibitor of NF-kappa B (IκB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol. 2011, 30, 1354–1361. [Google Scholar] [CrossRef]
- Zhang, D.; Jiang, S.; Qiu, L.; Su, T.; Wu, K.; Li, Y.; Zhu, C.; Xu, X. Molecular characterization and expression analysis of the IκB gene from pearl oyster Pinctada fucata. Fish Shellfish Immunol. 2009, 26, 84–90. [Google Scholar] [CrossRef] [PubMed]
- Moreira, R.; Balseiro, P.; Romero, A.; Dios, S.; Posada, D.; Novoa, B.; Figueras, A. Gene expression analysis of clams Ruditapes philippinarum and Ruditapes decussatus following bacterial infection yields molecular insights into pathogen resistance and immunity. Dev. Comp. Immunol. 2012, 36, 140–149. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.C.; Ganchi, P.A.; Ballard, D.W.; Greene, W.C. NF-κB controls expression of inhibitor IκBα: Evidence for an inducible autoregulatory pathway. Science 1993, 259, 1912–1915. [Google Scholar] [CrossRef]
- Moreira, R.; Milan, M.; Balseiro, P.; Romero, A.; Babbucci, M.; Figueras, A.; Bargelloni, L.; Novoa, B. Gene expression profile analysis of Manila clam (Ruditapes philippinarum) hemocytes after a Vibrio alginolyticus challenge using an immune-enriched oligo-microarray. BMC Genomics. 2014, 15, 1–16. [Google Scholar] [CrossRef]
- Wang, S.; Peatman, E.; Liu, H.; Bushek, D.; Ford, S.E.; Kucuktas, H.; Quilang, J.; Li, P.; Wallace, R.; Wang, Y.; et al. Microarray analysis of gene expression in eastern oyster (Crassostrea virginica) reveals a novel combination of antimicrobial and oxidative stress host responses after dermo (Perkinsus marinus) challenge. Fish Shellfish Immunol. 2010, 29, 921–929. [Google Scholar] [CrossRef]
- Ren, Q.; Wang, C.; Jin, M.; Lan, J.; Ye, T.; Hui, K.; Tan, J.; Wang, Z.; Wyckoff, G.J.; Wang, W.; et al. Co-option of bacteriophage lysozyme genes by bivalve genomes. Open Biol. 2017, 7, 160285. [Google Scholar] [CrossRef]
- Alberts, B.; Johnson, A.; Lewis, J.; Raff, M.; Roberts, K.; Walter, P. Molecular Biology of the Cell, 4th ed.; Garland Science: New York, NY, USA, 2002. [Google Scholar] [CrossRef]
- Dobson, C.M. Protein folding and misfolding. Nature 2003, 426, 884–890. [Google Scholar] [CrossRef] [PubMed]
- Mu, C.; Yu, Y.; Zhao, J.; Wang, L.; Song, X.; Zhang, H.; Qiu, L.; Song, L. An inhibitor κB homologue from bay scallop Argopecten irradians. Fish Shellfish Immunol. 2010, 28, 687–694. [Google Scholar] [CrossRef] [PubMed]
- Jeong, E.J.; Bang, S.; Lee, T.H.; Park, Y.I.; Sim, W.S.; Kim, K.S. The solution structure of FADD death domain: Structural basis of death domain interactions of Fas and FADD. J. Biol. Chem. 1999, 274, 16337–16342. [Google Scholar] [CrossRef]
- Ferchichi, H.; St-Hilaire, A.; Ouarda, T.B.; Lévesque, B. Impact of the future coastal water temperature scenarios on the risk of potential growth of pathogenic Vibrio marine bacteria. Estuar. Coast. Shelf. Sci. 2021, 250, 107094. [Google Scholar] [CrossRef]
- Bao, Y.; Li, L.; Zhang, G. Polymorphism of the superoxide dismutase gene family in the bay scallop (Argopecten irradians) and its association with resistance/susceptibility to Vibrio anguillarum. Dev. Comp. Immunol. 2010, 34, 553–561. [Google Scholar] [CrossRef] [PubMed]
- Balbi, T.; Fabbri, R.; Cortese, K.; Smerilli, A.; Ciacci, C.; Grande, C.; Vezzulli, L.; Pruzzo, C.; Canesi, L. Interactions between Mytilus galloprovincialis hemocytes and the bivalve pathogens Vibrio aestuarianus 01/032 and Vibrio splendidus LGP32. Fish Shellfish Immunol. 2013, 35, 1906–1915. [Google Scholar] [CrossRef] [PubMed]
Aquarium | Number of Clams | Vibrio | Temperature (°C) | Dissolved Oxygen (mg/L) | pH |
---|---|---|---|---|---|
1 | 30 | − | 17.8 ± 0.39 | 7.1 ± 0.32 | 8.32 ± 0.14 |
2 | 30 | − | 18.1 ± 0.27 | 6.9 ± 0.36 | 8.29 ± 0.1 |
3 | 35 | + | 18.1 ± 0.19 | 6.9 ± 0.35 | 8.28 ± 0.11 |
4 | 35 | + | 18 ± 0.31 | 7 ± 0.24 | 8.27 ± 0.09 |
5 | 30 | − | 22.2 ± 0.16 | 6.8 ± 0.43 | 8.27 ± 0.17 |
6 | 30 | − | 22 ± 0.24 | 6.9 ± 0.21 | 8.29 ± 0.06 |
7 | 40 | + | 22.1 ± 0.26 | 6.9 ± 0.24 | 8.25 ± 0.13 |
8 | 40 | + | 21.9 ± 0.31 | 7 ± 0.35 | 8.28 ± 0.1 |
9 | 35 | − | 24 ± 0.22 | 6.7 ± 0.4 | 8.23 ± 0.15 |
10 | 35 | − | 23.8 ± 0.29 | 6.8 ± 0.31 | 8.22 ± 0.1 |
11 | 52 | + | 23.9 ± 0.31 | 6.7 ± 0.26 | 8.21 ± 0.11 |
12 | 52 | + | 24.1 ± 0.24 | 6.6 ± 0.37 | 8.23 ± 0.05 |
Target Gene | Forward Primer (5′-3′) Reverse Primer (5′-3′) | E (%) | Annealing | Amplicon (bp) | GenBank Accession Number | Reference |
---|---|---|---|---|---|---|
Phage-type lysozyme | AACATGGCCTTCAATCTTGGA TGTCTTTAACAGCTCTCATTCTGC | 95.4 | 53 °C | 172 | PQ237691 | This study |
Cu/Zn superoxide dismutase (Cu/Zn-sod) | TGTGCATGAGTTTGGTGACA CACTCTCATCAGCTGTGACA | 94.2 | 53 °C | 140 | PQ072799 | This study |
Tumor necrosis factor receptor associated factor 6 (traf6) | CCATTTAGTGGAAGGATWGTTCT GTGGTAAAAACTCCATGTAYCC | 97.4 | 52 °C | 166 | KP067203.1 XM_060714923.1 | This study |
Inhibitor of NF-κB (IκB) | TGGAGGCCAGGAACTATGATG GCAGTGTTGTTGCTTCACAAG | 94.3 | 57 °C | 200 | PQ237690 | This study |
Fas-associated protein with death domain (fadd) | AGAACTCTTCACAGCCTTGG TGCTTGAGCCTGTTGTACTG | 102.5 | 56 °C | 175 | PQ230466 | This study |
18S ribosomal RNA (18S rRNA) | CCCATTCGTGCTAGGGATTG GTACAAAGGGCAGGGACGTA | 98.8 | 54 °C | 106 | KX713340.1 | This study |
Gene | Forward Primer (5′-3′) Reverse Primer (5′-3′) | Annealing | Expected Amplicon Size (bp) | GenBank Accession Number |
---|---|---|---|---|
Fas-associated protein with death domain (fadd) | ATGGACGAGCGTCATAATTCC ACATAAACAATCTGTTGTCCTG | 51 °C | 396 | MH507512.1 |
Inhibitor of NF-κB (IκB) | TGACGAGGACAGGTTAATTCC CTTCATAWAGGCTCCTCRTTCA | 49 °C | ≈950 | HM536186.1 XM_045322335.2 |
Phage-type lysozyme | AAAGCCCAGCTGAAGGTAGA TGTCTTTAACAGCTCTCATTCTGC | 50 °C | 423 | KT934018.1 KJ427777.1 |
Position | Genotypes | Susceptible | Resistant | Mutation Type | Allele | Susceptible | Resistant |
---|---|---|---|---|---|---|---|
fadd | |||||||
1 cds-198 | A/A | 16 (72.7) | 12 (54.6) | Leu (L) or Phe (F) TTA or TTT | A T | 33 (75) 11 (25) | 29 (65.9) 15 (34.1) |
A/T | 1 (4.6) | 5 (22.7) | |||||
T/T | 5 (22.7) | 5 (22.7) | |||||
IkB | |||||||
1,2,3 cds-469 | G/G | 5 (22.7) | 13 (59.1) | Ala (A) or Thr (T) GCA or ACA | G A | 17 (38.6) 27 (61.4) | 31 (70.5) 13 (29.5) |
G/A | 7 (31.8) | 5 (22.7) | |||||
A/A | 10 (45.5) | 4 (18.2) | |||||
1,2,3 cds-809 | A/A | 5 (22.7) | 12 (54.6) | Lys (K) or Arg (R) AAG or AGG | G A | 29 (65.9) 15 (34.1) | 17 (38.6) 27 (61.4) |
A/G | 5 (22.7) | 3 (13.6) | |||||
G/G | 12 (54.6) | 7 (31.8) | |||||
phage-type lysozyme | |||||||
2 cds-139 | A/A | 11 (50) | 11 (47.8) | Asn (N) or Asp (D) AAC or GAC | A G | 29 (65.9) 15 (34.1) | 28 (60.9) 18 (39.1) |
A/G | 7 (31.8) | 6 (26.1) | |||||
G/G | 4 (18.2) | 6 (26.1) | |||||
2,3 cds-143 | G/G | 18 (81.8) | 11(47.8) | Arg (R) or Ile (I) AGA or ATA | G T | 38 (86.4) 6 (13.6) | 32 (69.6) 14 (30.4) |
G/T | 2 (9.1) | 10 (43.5) | |||||
T/T | 2 (9.1) | 2 (8.7) | |||||
2 cds-240 | G/G | 18 (81.8) | 16 (69.6) | Glu (E) or Asp (D) GAG or GAT | G T | 40 (90.9) 4 (9.1) | 38 (82.6) 8 (17.4) |
G/T | 4 (18.2) | 6 (26.1) | |||||
T/T | 0 (0) | 1 (4.3) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Papadopoulos, D.K.; Giantsis, I.A.; Lattos, A.; Bitchava, K.; Michaelidis, B. Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms. Fishes 2025, 10, 72. https://doi.org/10.3390/fishes10020072
Papadopoulos DK, Giantsis IA, Lattos A, Bitchava K, Michaelidis B. Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms. Fishes. 2025; 10(2):72. https://doi.org/10.3390/fishes10020072
Chicago/Turabian StylePapadopoulos, Dimitrios K., Ioannis A. Giantsis, Athanasios Lattos, Konstantina Bitchava, and Basile Michaelidis. 2025. "Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms" Fishes 10, no. 2: 72. https://doi.org/10.3390/fishes10020072
APA StylePapadopoulos, D. K., Giantsis, I. A., Lattos, A., Bitchava, K., & Michaelidis, B. (2025). Molecular Immune Responses of Ruditapes decussatus to Vibrio Infection at Different Temperatures: Expression of Key Genes and Resilience-Associated Single Nucleotide Polymorphisms. Fishes, 10(2), 72. https://doi.org/10.3390/fishes10020072