RIOK1/2 Negatively Regulates the Antiviral Response by Targeting TBK1 in Yellow Catfish (Pelteobagrus fulvidraco)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Fish, Cell Lines, and Viral Strains
2.2. Plasmids
2.3. Subcellular Localization Assays
2.4. Transfection, Luciferase Activity Assay, and RT-PCR
2.5. Antiviral Activity Analysis
2.6. Co-Immunoprecipitation (Co-IP) and Western Blot (WB)
2.7. Data Collection and Statistical Analysis
3. Results and Analysis
3.1. PfRIOK1/2 Negatively Regulates the IFN Response by Targeting the RLR Pathway
3.2. Co-Localization of PfRIOK1/2 with PfTBK1
3.3. Interaction of PfRIOK1/2 with PfTBK1
3.4. PfRIOK1/2 Degrade PfTBK1 Protein
3.5. PfRIOK1/2 Inhibits PFTBK1-Mediated Antiviral Response
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Diamond, M.S.; Kanneganti, T.-D. Innate immunity: The first line of defense against SARS-CoV-2. Nat. Immunol. 2022, 23, 165–176. [Google Scholar] [CrossRef] [PubMed]
- Platanias, L.C. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat. Rev. Immunol. 2005, 5, 375–386. [Google Scholar] [CrossRef] [PubMed]
- Ivashkiv, L.B.; Donlin, L.T. Regulation of type I interferon responses. Nat. Rev. Immunol. 2014, 14, 36–49. [Google Scholar] [CrossRef] [PubMed]
- Onomoto, K.; Onoguchi, K.; Yoneyama, M. Regulation of RIG-I-like receptor-mediated signaling: Interaction between host and viral factors. Cell. Mol. Immunol. 2021, 18, 539–555. [Google Scholar] [CrossRef] [PubMed]
- Chathuranga, K.; Weerawardhana, A.; Dodantenna, N.; Lee, J.-S. Regulation of antiviral innate immune signaling and viral evasion following viral genome sensing. Exp. Mol. Med. 2021, 53, 1647–1668. [Google Scholar] [CrossRef]
- Zheng, J.; Shi, W.; Yang, Z.; Chen, J.; Qi, A.; Yang, Y.; Deng, Y.; Yang, D.; Song, N.; Song, B.; et al. Chapter One—RIG-I-like receptors: Molecular mechanism of activation and signaling. In Advances in Immunology; Alt, F.W., Murphy, K.M., Eds.; Academic Press: Cambridge, MA, USA, 2023; Volume 158, pp. 1–74. [Google Scholar]
- Bakshi, S.; Taylor, J.; Strickson, S.; McCartney, T.; Cohen, P. Identification of TBK1 complexes required for the phosphorylation of IRF3 and the production of interferon β. Biochem. J. 2017, 474, 1163–1174. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Lei, X.; Jiang, Z.; Fitzgerald, K.A. Cellular nucleic acid-binding protein is essential for type I interferon-mediated immunity to RNA virus infection. Proc. Natl. Acad. Sci. USA 2021, 118, e2100383118. [Google Scholar] [CrossRef] [PubMed]
- Bhol, N.K.; Bhanjadeo, M.M.; Singh, A.K.; Dash, U.C.; Ojha, R.R.; Majhi, S.; Duttaroy, A.K.; Jena, A.B. The interplay between cytokines, inflammation, and antioxidants: Mechanistic insights and therapeutic potentials of various antioxidants and anti-cytokine compounds. Biomed. Pharmacother. 2024, 178, 117177. [Google Scholar] [CrossRef] [PubMed]
- Hanks, S.K.; Quinn, A.M.; Hunter, T. The protein kinase family: Conserved features and deduced phylogeny of the catalytic domains. Science 1988, 241, 42–52. [Google Scholar] [CrossRef] [PubMed]
- Manning, G.; Whyte, D.B.; Martinez, R.; Hunter, T.; Sudarsanam, S. The protein kinase complement of the human genome. Science 2002, 298, 1912–1934. [Google Scholar] [CrossRef] [PubMed]
- Damizia, M.; Moretta, G.M.; De Wulf, P. The RioK1 network determines p53 activity at multiple levels. Cell Death Discov. 2023, 9, 410. [Google Scholar] [CrossRef]
- Messling, J.E.; Peña-Rømer, I.; Moroni, A.S.; Bruestl, S.; Helin, K. RIO-kinase 2 is essential for hematopoiesis. PLoS ONE 2024, 19, e0300623. [Google Scholar] [CrossRef]
- Li, Q.; Xie, L.; Pan, J.; He, Y.; Wang, E.; Wu, H.; Xiao, J.; Feng, H. Black carp RIOK3 suppresses MDA5-mediated IFN signaling in the antiviral innate immunity. Dev. Comp. Immunol. 2023, 149, 105059. [Google Scholar] [CrossRef]
- Chen, Y.W.; Ko, W.C.; Chen, C.S.; Chen, P.L. RIOK-1 Is a Suppressor of the p38 MAPK Innate Immune Pathway in Caenorhabditis elegans. Front. Immunol. 2018, 9, 774. [Google Scholar] [CrossRef]
- Ghandadi, M.; Dobi, A.; Malhotra, S.V. A role for RIO kinases in the crosshair of cancer research and therapy. Biochim. Biophys. Acta Rev. Cancer 2024, 1879, 189100. [Google Scholar] [CrossRef]
- Lei, W.Q.; Lok, J.B.; Yuan, W.; Zhang, Y.Z.; Stoltzfus, J.D.; Gasser, R.B.; He, S.Y.; Zhou, H.; Zhou, R.; Zhao, J.L.; et al. Structural and developmental expression of Ss-riok-2, an RIO protein kinase encoding gene of Strongyloides stercoralis. Sci. Rep. 2017, 7, 8693. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.; De Jesus, P.D.; Su, V.; Han, S.; Gong, D.; Wu, N.C.; Tian, Y.; Li, X.; Wu, T.T.; Chanda, S.K.; et al. RIOK3 is an adaptor protein required for IRF3-mediated antiviral type I interferon production. J. Virol. 2014, 88, 7987–7997. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Dan, C.; Gong, X.Y.; Li, Y.L.; Qu, Z.L.; Sun, H.Y.; An, L.L.; Guo, W.H.; Mei, J.; Gui, J.F.; et al. Yellow catfish RIO kinases (RIOKs) negatively regulate fish interferon-mediated antiviral response. Dev. Comp. Immunol. 2023, 142, 104656. [Google Scholar] [CrossRef] [PubMed]
- Feng, H.; Zhang, Y.-B.; Zhang, Q.-M.; Li, Z.; Zhang, Q.-Y.; Gui, J.-F. Zebrafish IRF1 Regulates IFN Antiviral Response through Binding to IFNϕ1 and IFNϕ3 Promoters Downstream of MyD88 Signaling. J. Immunol. 2015, 194, 1225–1238. [Google Scholar] [CrossRef]
- Zhao, X.; Gong, X.-Y.; Li, Y.-L.; Dan, C.; Gui, J.-F.; Zhang, Y.-B. Characterization of DNA Binding and Nuclear Retention Identifies Zebrafish IRF11 as a Positive Regulator of IFN Antiviral Response. J. Immunol. 2020, 205, 237–250. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.; Zhao, X.; Gong, X.-Y.; Wang, Y.; Gui, J.-F.; Zhang, Y.-B. FTRCA1, a Species-Specific Member of finTRIM Family, Negatively Regulates Fish IFN Response through Autophage-Lysosomal Degradation of TBK1. J. Immunol. 2019, 202, 2407–2420. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.-Y.; Zhang, Q.-M.; Zhao, X.; Li, Y.-L.; Qu, Z.-L.; Li, Z.; Dan, C.; Gui, J.-F.; Zhang, Y.-B. LGP2 is essential for zebrafish survival through dual regulation of IFN antiviral response. iScience 2022, 25, 104821. [Google Scholar] [CrossRef] [PubMed]
- Marsili, G.; Perrotti, E.; Remoli, A.L.; Acchioni, C.; Sgarbanti, M.; Battistini, A. IFN Regulatory Factors and Antiviral Innate Immunity: How Viruses Can Get Better. J. Interferon Cytokine Res. 2016, 36, 414–432. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Dan, C.; Gong, X.Y.; Li, Y.L.; Qu, Z.L.; Sun, H.Y.; An, L.L.; Guo, W.H.; Gui, J.F.; Zhang, Y.B. Zebrafish MARCH8 downregulates fish IFN response by targeting MITA and TBK1 for protein degradation. Dev. Comp. Immunol. 2022, 135, 104485. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Wu, M. Pattern recognition receptors in health and diseases. Signal Transduct. Target. Ther. 2021, 6, 291. [Google Scholar] [CrossRef] [PubMed]
- Xiong, L.M.; Zhang, L.; Long, Z.; Zhao, X.; Ying, Y.R.; Xiao, T.Y.; Xiong, S.T. TBK1 upregulates the interferon response against virus by the TBK1-IRF3/7 axis in yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 2024, 144, 109272. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhu, C.; Jia, S.; Deng, H.; Tang, J.; Sun, X.; Zeng, X.; Chen, X.; Wang, Z.; Liu, W.; et al. Dual modifying of MAVS at lysine 7 by SIRT3-catalyzed deacetylation and SIRT5-catalyzed desuccinylation orchestrates antiviral innate immunity. Proc. Natl. Acad. Sci. USA 2024, 121, e2314201121. [Google Scholar] [CrossRef] [PubMed]
- LaRonde-LeBlanc, N.; Wlodawer, A. The RIO kinases: An atypical protein kinase family required for ribosome biogenesis and cell cycle progression. Biochim. Biophys. Acta 2005, 1754, 14–24. [Google Scholar] [CrossRef] [PubMed]
- Handle, F.; Puhr, M.; Gruber, M.; Andolfi, C.; Schäfer, G.; Klocker, H.; Haybaeck, J.; De Wulf, P.; Culig, Z. The Oncogenic Protein Kinase/ATPase RIOK1 Is Up-Regulated via the c-myc/E2F Transcription Factor Axis in Prostate Cancer. Am. J. Pathol. 2023, 193, 1284–1297. [Google Scholar] [CrossRef] [PubMed]
- Simpson, K.J.; Selfors, L.M.; Bui, J.; Reynolds, A.; Leake, D.; Khvorova, A.; Brugge, J.S. Identification of genes that regulate epithelial cell migration using an siRNA screening approach. Nat. Cell Biol. 2008, 10, 1027–1038. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (5′–3′) |
---|---|
EPC-β-actin-RT-F | CAGATCATGTTTGAGACC |
EPC-β-actin-RT-R | ATTGCCAATGGTGATGAC |
EPC-mx-F | GGCTGGAGCAGGTGTTGGTATC |
EPC-mx-R | TCCACCAGGTCCGGCTTTGTTAA |
EPC-ifn-F | ATGAAAACTCAAATGTGGACGTA |
EPC-ifn-R | GATAGTTTCCACCCATTTCCTTAA |
EPC-viperin-F | AGCGAGGCTTACGACTTCTG |
EPC-viperin-R | GCACCAACTCTCCCAGAAAA |
SVCV-N-F | GGTGCGAGTAGAAGACATCCCCG |
SVCV-N-R | GTAATTCCCATCATTGCCCCAGAC |
SVCV-L-F | CAAGTTCACAATCGGGAAGACGC |
SVCV-L-R | CCAGTTGCTTGTTGGCTTATCCG |
SVCV-G-F | CCATTCTGTTCATTTGGAGCCGTA |
SVCV-G-R | AATTTCATTCGACAAGACCCCC |
Pfriok2-RT-F | GGAAACCAAATGGGTGTCGGC |
Pfriok2-RT-R | GTCCACTGGCTTTGGAACAGG |
Pfriok1-RT-F | CTAAACGCTACGCTGCGATGC |
Pfriok1-RT-R | CCACCGTCGCTCTATCAGAC |
PfRIOK1-EcoRV-F | GTGGAATTCTGCAGATATGTCTCAGATTGTCCTGGG |
PfRIOK1-EcoRV-R | GCCACTGTGCTGGATTCTTCCTTTCTTCATCTTGGC |
PfRIOK2-EcoRV-F | GTGGAATTCTGCAGATATGGGGAAGTTAAACGTCGTT |
PfRIOK2-EcoRV-R | GCCACTGTGCTGGATTCCCCAGAACTGGGCTGC |
PfTBK1-F | GTGGAATTCTGCAGATATGCAGAGTACGGCCAATTA |
PfTBK1-R | CGCCACTGTGCTGGATTCACATCCGCTCCACTGTCC |
PfRIOK1-BamHI-F | CTTGTTCTTTTTGCAGATGTCTCAGATTGTCCTGGG |
PfRIOK1-BamHI-R | GCGCCACTAGTGGATCCTCTTCCTTTCTTCATCTTGGC |
PfRIOK2-BamHI-F | CTTGTTCTTTTTGCAGATGGGGAAGTTAAACGTCGTTG |
PfRIOK2-BamHI-R | GCGCCACTAGTGGATCCTCCCCAGAACTGGGCTGCTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, K.; Huang, J.; Gui, Y.; Li, Q.; Zhang, L.; Xiong, S. RIOK1/2 Negatively Regulates the Antiviral Response by Targeting TBK1 in Yellow Catfish (Pelteobagrus fulvidraco). Fishes 2025, 10, 6. https://doi.org/10.3390/fishes10010006
Liu K, Huang J, Gui Y, Li Q, Zhang L, Xiong S. RIOK1/2 Negatively Regulates the Antiviral Response by Targeting TBK1 in Yellow Catfish (Pelteobagrus fulvidraco). Fishes. 2025; 10(1):6. https://doi.org/10.3390/fishes10010006
Chicago/Turabian StyleLiu, Kejun, Jiayang Huang, Yuting Gui, Qian Li, Lei Zhang, and Shuting Xiong. 2025. "RIOK1/2 Negatively Regulates the Antiviral Response by Targeting TBK1 in Yellow Catfish (Pelteobagrus fulvidraco)" Fishes 10, no. 1: 6. https://doi.org/10.3390/fishes10010006
APA StyleLiu, K., Huang, J., Gui, Y., Li, Q., Zhang, L., & Xiong, S. (2025). RIOK1/2 Negatively Regulates the Antiviral Response by Targeting TBK1 in Yellow Catfish (Pelteobagrus fulvidraco). Fishes, 10(1), 6. https://doi.org/10.3390/fishes10010006