Bioassessment of Phylogenetic Relatedness and Plant Growth Enhancement of Endophytic Bacterial Isolates from Cowpea (Vigna unguiculata) Plant Tissues

Abstract

Cowpea is of great importance to people in most tropical countries of the world. It is the preeminent indigenous African legume and a frontline option for meeting the nutritional protein demands of people and livestock. The use of an eco-friendly alternative to synthetic fertilizers and agro-pesticides has, in recent times, become an attractive research theme. Therefore, bioprospecting for effective endophytic bacteria isolates as potential bioinoculants for enhancing cowpea productivity makes this research a priority. In this study, cowpea tissues were used to isolate and characterize endophytic bacterial strains through morpho-genotypic techniques and then assessed for their in vitro growth promotion, as well as their in planta growth potential in chamber experiments. In all, 33 endophytic bacterial strains were authenticated by sequencing the 16S rRNA and through further bioinformatics analysis. Also, plant-growth promoting (PGP) genes and seed germination percentage improvements were confirmed in the endophytic bacteria isolates. The research findings highlight that the bacterial strains are molecularly diverse and some of the authenticated endophytic bacteria isolates are potential bioinoculants that can be applied in further studies to improve the agronomic productivity of cowpea plant.

1. Introduction

The bioprospecting investigation of endophytic microbiota from both unusual and challenging to otherwise normal ecological niches in order to identify and characterize strains with unique attributes for supporting and enhancing sustainable agricultural productivity has been on the rise [1,2]. In fact, endophytic microbiota-formulated bioinoculating agents are the foundation of a new Green Revolution; one that will help to achieve agroecological sustainability. Endophytic and rhizospheric microbiota and other microbial agents have demonstrated efficacy as renewable and sustainable natural microbial resources that are cheaper to produce and that can be used as field inoculants in the form of biofertilizers, biopesticidal agents and biostimulating agents to achieve enhanced outputs of agroproducts and environmental balance [3,4,5,6]. Therefore, they can be used in crop production as complementary to or an alternative to synthetic agrochemicals.

The versatility of endophytic microbiota in tackling abiotic and biotic stresses in plants through diverse mechanistic actions, such as the secretion of vital metabolites, the expression of beneficial gene responses and antagonistic actions, thereby optimizing agricultural outputs, is reported [7,8]. The plant-growth-stimulating and plant productivity enhancement traits of endophytic microbiota genera like Bacillus, Pseudomonas, Rhizobium, Serratia, Paenibacillus, Brevundimonas and Staphylococcus, among others, are achieved through diverse mechanisms that include the ability to convert or fix atmospheric nitrogen, to convert insoluble phosphates to soluble phosphates, to produce vital enzymes and important phyto-metabolites and to suppress or inhibit microbial pathogens and pests [9,10].

The firm establishment of endophytic microbiota in the colonized innermost tissues of plants confers multiple beneficial traits that aid in promoting plant growth. Endophytic microbiota constitute a goldmine of bioactive metabolites, influencing their actions, acting as immune boosters, stimulating growth, helping in the biocontrol of pests and microbial pathogens and enabling plants to cope with environmental stressors [11,12,13].

However, endophytic microbial research has lately proven promising as an alternative option or complement to synthetic agrochemicals in achieving, in a sustainable manner, the optimization of agri-system outputs [14,15,16].

Endophytic bacteria are the inhabitants of the innermost tissues of plants [17,18]. They confer beneficial support as a result of the symbiotic associations with their plant host in diverse ecological niches and under varying environmental conditions. Numerous studies have confirmed the growth-stimulating potency of bacteria endophytes on planted crops, thereby alluding to their potential as bioinoculating agents that can enhance the sustainability of agricultural productivity [19,20,21]. The mechanisms used by these beneficial endophytic microbiota include the conferral of an appropriate stress response and the production of vital nutrients and bioactive metabolites, thus inducing, amongst others, allelopathic effects on plants [22,23].

Vigna unguiculata (L.) Walp. is better known as cowpea. It is among the foremost African leguminous crops and is of great importance in terms of its nutritional, economic and environmental attributes [24]. It is grown primarily in the warmer regions of Africa and in other semi-arid zones worldwide. It is an annual crop and a diploid with 2n = 2x = 22. The genomic size of cowpea is estimated at 620 million base pairs [25].

Cowpea is a vital source of dietary nutrients for humans and provides fodder for livestock. Moreso, a key trait of cowpea is its role in maintaining soil-ecological balance by fixing atmospheric nitrogen in symbiotic association with nodulating bacteria [26]. Cowpea is strategically valuable to Africa in terms of the economy of scale associated with its production [27]. The protein and essential amino acid content of cowpea is between 23% and 32% [28].

Cowpea provides an alternative means of ensuring a balanced diet in most African countries, in that it provides a cheaper way of accessing necessary dietary nutrients and by positively influencing the health and well-being of the populace [29].

All the parts of the cowpea plant are valuable: from the leaves, that can be used as vegetables, to the haulms (cowpea pod walls, stems and leaves), that are used as livestock fodder for animals. Thus, the cowpea plant contributes to generating an income for farmers [30].

Vigna unguiculata L. Walp is a key legume in the tropics and arid regions of the world [31]. Importantly, it is useful in agro-ecological conservation. In terms of relevance, cowpea production contributes significantly to economic productivity and environmental sustainability in Africa [32,33].

In contrast to the huge benefits and potential of cowpea, its productivity is limited in Africa and its status as an under-utilized leguminous crop persists. Thus, the task ahead is to find a way out of these dire circumstances by maximizing the potential use of natural resource such as endophytic microbiota in an efficient and agro-ecologically sustainable manner to enhance cowpea productivity.

Therefore, this research aims at circumventing the low productivity constraints of cowpea production in North West Province, South Africa, by bioprospecting endophytic bacterial isolates with effective plant probiotic-promoting traits; these isolates could then be deployed as potential bioinoculants to improve cowpea production.

2. Materials and Methods

2.1. Cowpea (Vigna unguiculata L. Walps) Sampling/Collection

Prior to the start of this research, healthy cowpea plant samples, including roots, stems and leaves, with no external symptoms of disease, were already available, having been collected from cowpea farms in Mafikeng and its environs. The samples were kept in cold conditions in plastic bags at 4 °C before being processed for isolation and characterization.

However, the cowpea seeds used in this study were collected from the Agricultural Research Council (ARC) in Pretoria. The locations of the sampling and experimentation sites are indicated by the (25°47′19.1″ S 25°37′05.1″ E) GPS coordinates.

2.1.1. Isolation of Endophytic Microbiota from Leaves, Seeds and Near Root Tissue Zones of Cowpea

Healthy cowpea seeds and aerial tissue, from both below and above the surface, were rinsed under running tap water to remove the attached debris. Further surface sterilization was carried out by washing the cowpea plant samples with 70% ethanol and then 3% sodium hypochlorite for three minutes. This was followed by sterilizing the samples with 70% ethanol once again and then washing it thoroughly three times with sterilized water to remove epiphytic microorganisms from it. The efficacy of the surface sterilization was assessed by plating the final rinse water on growth media. The surface sterilized cowpea plant tissues, as well as further processed cowpea tissues that were appropriately crushed with mortar and pestle and diluted using a phosphate buffer saline, were subsequently plated on varied microbiological growth media. The Petri-plates were replicated and incubated according to standard microbiological protocol. Further purification of the putative isolated endophytes was achieved through several subculturing processes, with the pure isolates finally being stored for further analysis on storage media incorporating 20% glycerol.

2.1.2. Genomic DNA Extraction, PCR of Plant Growth Promoting (PGP) Genes and 16S rRNA Gene Sequencing

Following the manufacturer’s instructions, the total genomic DNA of the pure culture endophytic bacterial isolates was extracted using Zymoclean kits (Zymoclean Research Corporation, Irvine, CA, USA) for bacteria and fungi. Purity was assessed on 0.8% agarose using UV-visual gel documentation (Gel Doc 2000, Bio-Rad, Hercules, CA, USA).

The conserved 16S rRNA genes of the bacterial isolates were amplified by applying PCR using universal primers 341 forward and 907 reverse for bacterial identification [34]. For the Plant Growth Promoting (PGP) genes amplification by PCR, genes specific primers for 1-Aminocyclopropane-1-carboxylic acid deaminase (ACDS), Indopyruvate decarboxylase (IPDC), Acid posphatase (ACPHO) and Glucose dehyrogenase (GCD) were used.

The PCR reaction cocktails of 25 µL volume contained the following: 2X Master Mix 12.5 µL; molecular grade water 8.5; forward and reverse primers of one µL each. The PCR cycling conditions, using a Biorad 1000 thermocycler USA, included an initial denaturing at 95 °C for five minutes, followed by 34 cycles of denaturing at 95 °C for 30 s, annealing at 59 °C for one minute, an extension at 72 °C for 45 s and a final extension at 72 °C for seven minutes.

Note: Following the gradient PCR protocol, the annealing temperature for the optimized PCR amplification of DNA of the different microbial isolates varied from 50 °C to 59 °C. The various primers used for the PCR experiments are shown in

Table 1. Primers (16S and PGP genes) used for the identification of endophytic bacterial isolates.

Target Gene	Primer Name	Primer Sequence (5′→3′)	Product Size (bp)	Reference
16S	341-F 907-R	AGAGTTTGATCCTGGCTCAG AAGGAGGTGATCCAGCCGCA	1300–1500	[34]
1-Aminocyclopropane-1-carboxylic acid deaminase (ACDS)	ACDS-F3 ACDS-R3	ATCGGCGGCATCCAGWSNAAYCANAC GTGCATCGACTTGCCCTCRTANACNGGRT	800–950	[35]
Indo-pyruvate decarboxylase (IPDC)	IPDC-F IPDC-R	CAYTTGAAAACKCAMTATACTG AAGAATTTGYWKGCCGAATCT	1715–1809	[36]
Acid phosphatase (ACPHO)	ACPHO-F ACPHO-R	AAGAGGGGCATTACCACTTTATTA CGCCTTCCCAATCRCCATACAT	828	[36]
Glucose dehydrogenase (GCD)	GCD-F GCD-R	GACCTGTGGGACATGGACGT GTCCTTGCCGGTGTAGSTCATC	875	[37]

.

The success of the amplification protocol was assessed through electrophoresis using a 1.2% agarose gel in a TAE buffer, stained with ethidium bromide, run at 80 volts for one hour in the same TAE buffer and finally visualized using UV gel documentation. The amplicons were directly sequenced in both directions using universal primers 341-F and 907-R for bacteria by Inqaba Biotech, Pretoria, South Africa.

2.1.3. Molecular Authentication and Phylogenetic Assessment

Investigation of the molecular authenticity of the isolated bacteria endophytes that were sequenced was performed using different Bioinformatics tools, including chromas-lite for sequence trimming and Bioedit for sequence editing and alignment. The correctly trimmed, edited and aligned sequences were subjected to blasting using the National Centre for Biotechnological Information’s (NCBI) nucleotide blast platform for the identification and authentification of the isolates and for referencing with similar strains in the Genbank database. The Molecular Evolutionary Genetics Analysis software (MEGA7) [38] was used to identify, through phylogenetic analyses, the relatedness of endophytic bacterial strains and other closely related bacterial strains in Genbank. The maximum likelihood method was deployed for the construction of a phylogenetic tree.

2.1.4. An In Vitro Assay of the Endophytic Bacterial Plant Growth-Stimulating Attributes

Potency for Solubilizing Inorganic Phosphate

Based on Nautiyal [39] protocols, the ability of the endophytic bacterial isolates to solubilize phosphate was assessed. After adjusting the concentration of insoluble calcium tri-phosphate to 0.5, endophytic cultures freshly grown in Luria Bertani (LB) broth were used as an aliquot to inoculate the National Botanical Research Institute’s Phosphate (NBRIP) solubilization agar plate containing the insoluble calcium tri-phosphate. The plates were replicated thrice and incubated for 7 days at 30 °C. A positive phosphate solubilizing potential is indicated by a transparent clearance-zone around bacteria colony on Petri-plate.

Potency of Bacterial Isolates to Produce Indole Acetic Acid

The ability of the endophytic bacterial isolates to produce indole acetic acid was assessed using the assay protocol devised by Matsuda et al. 2018 [40]. Overnight cultures of the endophytic bacterial isolates were used to inoculate peptone water that contained five mM L-tryptophan and the liquid media were incubated on a rotary shaker at 150 rpm for 48 h at 30 °C. Thereafter, the cultures were processed and centrifuged to obtain a supernatant. Salkowski reagent was then added to the supernatant in a ratio of 2:1 and the resultant solution was incubated in the dark for 30 min before the absorbance was measured with the aid of a spectrophotometer (Spectronic 200, Thermo Fisher Scientific, JHB, South Africa) at 530 nm. A standard curve of IAA was plotted using various concentrations of indole acetic acid in order to quantify the amount of IAA produced by the endophytic isolates.

Potency of Endophytic Bacterial Isolates to Produce Siderophore

The ability of the endophytic bacterial isolates to produce siderophore was assessed qualitatively on chrome azural (CAS) agar plates [41]. An overnight culture of bacterial strains in (LB) growth-medium was adjusted at OD600 to obtain a 0.5 concentration and serves as the inoculum. Then, a diffusible disc was placed on a newly prepared CAS-blue agar petri-plate. Thereafter, 10 µL aliquots of each endophytic culture were inoculated onto the plate and incubated for 72 h. A positive siderophore production potential is indicated by yellowish-orange halo zone around the bacteria colony.

Potency of Endophytic Bacteria Isolates to Promote ACC Deaminase Activity (ACCD)

The assay protocol described by Glick et al. [42] was used to assess the potential of the endophytic bacterial isolates to promote ACC deaminase activity. A fresh culture was grown on a minimal salt medium overnight and then used as the inoculum by harvesting and centrifuging the broth culture to obtain a culture pellet. Thereafter, previously sterilized saline water was used to wash the pellet thoroughly and then re-suspended in saline water before spot inoculation on three (3) mM ACC, incorporating minimal media petri-plates. A minimal media plate that had been incorporated with ammonium sulphate was used as the positive control, while the minimal media plates without any nitrogenous source served as the negative control. All plates were in triplicate and cultured for 72 h at 30 °C. The growth of the endophytic bacteria on the three (3) mM ACC incorporating minimal media Petri-plates indicated the potential of the endophytic bacterial isolates to promote ACC deaminase activity.

Potency of Endophytic Bacteria Isolates to Promote Ammonia Production

The endophytic isolates were assessed for their ability to produce ammonia [43]. This involved using a freshly grown overnight culture of endophytic isolates to inoculate 10 mL sterilized peptone water in test tubes and the incubation of peptone liquid medium on a rotary incubator for 48 h at 30 °C. The development of yellowish to brownish colouration after the addition of Nessler’s reagent (0.5 mL) was a positive indication of the potential of the isolates to produce ammonia.

Potency of Endophytic Bacteria Isolates to Promote Exopolysaccharide Production

The ability of the endophytic isolates to produce exopolysaccharides was assessed using the methodology proposed by Khan and Bano [44] with some modifications. A 10% sucrose-supplemented (LB) agar was prepared and the pH of the medium was adjusted to seven before sterilization. Freshly grown overnight cultures of the endophytic isolates were used to impregnate sterile filter paper and placed carefully inside the LB medium plates before incubation for 48 h at 30 °C. The potential of the isolates to produce exopolysaccharide was indicated by the formation of a mucoid colony on the filter paper.

Potency of Endophytic Bacteria Isolates to Promote Hydrogen Cyanide Production

The ability of the isolated bacterial endophytes to produce hydrogen cyanide (HCN) was determined by the methodology proposed by Dinesh et al. [45]. The bacteria isolates were streaked on LB agar growth medium that was incorporated with (4.4 g/L) of glycine. Thereafter, sterilized filter paper was dipped into a solution of picric acid and carefully placed on the lid of the petri-plates and sealed up with parafilm before incubation for 96 h at 30 °C. The isolates proved positive for hydrogen cyanide production when, after incubation, the filter paper changed color from a yellowish to a reddish-brown.

2.1.5. Seed Germination and Seedling Growth

Two varieties of cowpea seeds (PAN 311 and Bechuana white) were used to perform this experiment. The seeds were surface sterilized through several steps of disinfection, including 3% sodium hypochlorite, sterile water, 70% ethanol and cleaning with sterile water, to remove any epiphytic microbes. Thereafter, seed germination assays were conducted for seven days using 10 seeds per plate with tissue toweled bioprimed endophytic treatment. The control seed plate was inoculated with distilled water and replications in the growth chamber were conducted thrice. Based on the calculated readings, the percentage germination rate and biomass results for shoot length, root length and weight were recorded.

For the growth assay of the seedlings in the growth chamber, previously sterilized cowpea seeds without any epiphytic microbial contaminants were bioprimed with endophytic inoculants and planted in a completely randomized manner in plastic pots for 2 weeks. The experiment was replicated three times, with the control pot receiving no endophytic inoculant treatment.

2.1.6. Potentials of Endophytic Bacterial Isolates to Inhibit Phytopathogenic Fungal Activity

The inhibitory activity of endophytic bacterial isolates against selected phytopathogenic organisms was assessed on petri-plates through a confrontational/dual assay protocol [46]. The phytopathogenic fungi were grown on PDA petri-plates at room temperature for five days. Thereafter, the overnight culture of endophytic bacterial isolates grown on the LB broth was streaked on a freshly prepared yeast malt extract agar plate at the periphery before confrontation with a five millimetre agar disc of phytopathogenic fungi placed perpendicular to the streaked bacterial isolates. (The control plate contained only the fungal pathogens on the yeast malt extract agar plates and not the bacterial endophytes). The plates were replicated three times and, after seven days of incubation, the percentage inhibitory potential was estimated using the formula $Control-treated÷control\times 100$.

The control represented the diameter of the phytopathogenic fungal growth on the yeast malt extract agar without the endophytic bacterial isolates; the treated represented the diameter of the phytopathogenic fungal that was confronted by the endophytic bacterial isolates on the yeast malt extract plate.

2.1.7. Potentials of Endophytic Bacterial Isolates to Tolerate Environmental Stress

For the external stress tolerance potential of the endophytic bacterial isolates, salinity induced with NaCl was deployed at (1%), (3%) and (5%), respectively. Temperature stress was determined at 40, 35 and 20, respectively, while the pH deployed was at (10), (7) and (5), respectively [47]. The endophytic bacterial isolates were incubated for 48 h and the experimental readings were replicated thrice.

3. Results

3.1. Morpho-Genotypical Authentication

Data obtained in this current study on the morphological and biochemical characteristics and the genotypical authentication of the isolated endophytic microbiota associated with the cowpea plant indicated that 33 diverse bacterial strains, consisting of 11 genera (Stenotrophomonas, Brevundimonas, Staphylococcus, Paenibacillus, Bacillus, Myroides, Lynsinibacillus, Pseudomonas, Mammalicoccus, Micrococcus and Ignatzscineria) had been isolated. The most common endophytic strains in terms of occurrence were found to be Staphylococcus strains (10), Bacillus strains (9), Brevundimonas strains (4), Stenotrophomonas strains (2) and Myroides strains (2), while Pseudomonas, Lysinibacillus, Paenibacillus, Ignatzscineria, Mammalicoccus and Micrococcus presented with only (1) strain each. Also, 24 of the isolated endophytic bacterial strains were found to be gram negative, while nine of the isolated bacterial strains were gram positive. The taxonomic phyla indicated that most of the endophytic strains were firmicutes, while others fell into the phyla-proteobacterial class, primarily the gammaproteobacterial class, and others belonged to the phyla high G + C and CFB classes. The microscopic shapes of the endophytic bacterial strains were found to be mainly cocci, slim rods, short rods and long rods. The distinct reactions of the isolated cowpea endophytic microbial strains to various forms of morphometric characterization for their morphological authentication are represented in Supplementary Table S1.

In addition to their morphological characteristics, genotypical identification, based on 16S rRNA gene sequencing and further bioinformatics processing, resulted in a genotypical authentication composed of molecularly diverse bacterial strains, as shown in

Table 2. Molecular authentication of endophytic bacterial strains isolated from cowpea tissues.

S/N	Culture Code	Molecularly Identified Strains	Similarity (%)	Bacteria Phyla	GenBank Accession Number
1.	Be1	Stenotrophomonas maltophilia strain NwuBe01	100	Proteobacteria	OK050078
2.	Be2	Stenotrophomonas pavanii strain NwuBe02	100	Proteobacteria	OK050079
3.	Be3	Brevundimonas bullata strain NwuBe03	100	Proteobacteria	OK050080
4.	Be4	Bacillus wiedmannii strain NwuBe04	100	Firmicute	OK050081
5.	Be5	Bacillus anthracis strain NwuBe05	100	Firmicute	OK050082
6.	Be6	Micrococcus luteus strain NwuBe06	100	High G + C	OK050083
7.	Be7	Myroides pelagicus strain NwuBe07	100	CFB	OK050084
8.	Be8	Bacillus tropicus strain NwuBe08	100	Firmicute	OK050085
9.	Be9	Ignatzschineria indica strain NwuBe09	100	Proteobacteria	OK050086
10.	Be10	Bacillus thuringiensis strain NwuBe10	100	Firmicute	OK050087
11.	Be11	Staphylococcus saprophyticus strain NwuBe11	100	Firmicute	OK050088
12.	Be12	Staphylococcus edaphicus strain NwuBe12	100	Firmicute	OK050089
13.	Be13	Staphylococcus nepalensis strain NwuBe13	100	Firmicute	OK050090
14.	Be14	Staphylococcus xylosus strain NwuBe14	100	Firmicute	OK050091
15.	Be15	Staphylococcus cohnii strain NwuBe15	100	Firmicute	OK050092
16.	Be16	Mammaliicoccus stepanovicii strain NwuBe16	100	Firmicute	OK050093
17.	Be17	Staphylococcus succinus strain NwuBe17	100	Firmicute	OK050094
18.	Nwa1	Staphylococcus casei strain NwuBe18	100	Firmicute	OK050095
19.	Nwa2	Staphylococcus arlettae strain NwuBe19	100	Firmicute	OK050096
20.	Nwa3	Staphylococcus saprophyticus strain NwuBe20	100	Firmicute	OK050097
21.	Nwa5	Lysinibacillus xylanilyticus strain NwuBe21	100	Firmicute	OK050098
22.	Nwa6	Bacillus altitudinis strain NwuBe22	100	Firmicute	OK050099
23.	Nwa7	Paenibacillus illinoisensis strain NwuBe23	100	Firmicute	OK050100
24.	Nwa8	Brevundimonas bullata strain NwuBe24	100	Proteobacteria	OK050101
25.	Nwa9	Bacillus tropicus strain NwuBe25	100	Firmicute	OK050102
26.	Nwa11	Brevundimonas terrae strain NwuBe26	100	Proteobacteria	OK050103
27.	Nwa12	Myroides odoratimimus strain NwuBe27	100	CFB	OK050104
28.	Nwa13	Bacillus paramycoides strain NwuBe28	100	Firmicute	OK050105
29.	Nwa16	Brevundimonas bullata strain NwuBe29	100	Proteobacteria	OK050106
30.	Nwa17	Pseudomonas fluorescens strain NwuBe30	100	Proteobacteria	OK050107
31.	Nwa18	Bacillus cereus strain NwuBe31	100	Firmicute	OK050108
32.	Nwa21	Bacillus bingmayongensis strain NwuBe32	100	Firmicute	OK050109
33.	Nwa22	Staphylococcus kloosii strain NwuBe33	100	Firmicute	OK050110

. The phylogenetic relatedness of the endophytic bacterial strains with similar strains in the GenBank is presented in supplementary Figure S1. The phylogenetic inference indicates that the various endophytic strains are diverse but have ancestral linkages with similar species in the GenBank repository.

3.2. Plant Growth-Stimulating Attributes of Endophytic Bacterial Strains

The results of the growth-enhancing attributes of the isolated cowpea endophytic strains indicate that they are potent in promoting the growth of plants. All 33 of the isolates possess the ability to produce exopolysaccharide, IAA, ammonia and siderophore. The ability to solubilize phosphate into assimilable forms for plant utilization was identified in 70% of the isolated strains. The highlights of the growth-stimulating potential of the endophytic bacterial strains, including their production of hydrogen cyanide and their capacity to produce 1-aminocyclopropylane 1-carboxylate enzyme, are shown in

Table 3. Plant growth-promoting in-vitro attributes of endophytic bacterial isolates from cowpea tissue.

Bacteria Code	ACDS Production	Ammonia Production	Auxin Production	Exopolysaccharide Production	HCN Production	Phosphate Solubilization	Siderophore Production
Be1	−	++	++	+	++	−	++
Be2	+	+++	+++	+	++	++++	++
Be3	+	+++	+++	+	++	++	++
Be4	+	++	++	+	++	−	++
Be5	+	++	+++	+	++	++	++
Be6	−	++	++	+	−	−	−
Be7	−	++	++	+	−	−	−
Be8	−	++	++	+	−	+++	++
Be9	−	++	++	+	−	−	-
Be10	+	+++	+++	+	++	++	++
Be11	−	++	++	+	++	−	++
Be12	+	+++	+++	+	+++	+++	++
Be13	−	++	++	+	++	−	−
Be14	+	+++	+++	+	+++	++	++
Be15	−	++	++	+	−	−	−
Be16	−	++	++	+	−	−	++
Be17	−	++	++	+	−	−	−
Nwa1	−	++	++	+	−	−	++
Nwa2	−	++	++	+	−	−	−
Nwa3	−	++	++	+	−	−	++
Nwa5	+	++	++++	+	++	++	++
Nwa6	+	+++	+++	+	++	++	−
Nwa7	+	+++	+++	+	++	++	++
Nwa8	−	++	++	+	−	−	++
Nwa9	+	+++	+++	+	++	−	−
Nwa11	−	++	++	+	−	−	−
Nwa12	−	++	++	+	−	−	++
Nwa13	+	+++	+++	+	−	−	−
Nwa16	−	++	++	+	−	−	−
Nwa17	+	+++	+++	+	++	++	++
Nwa18	+	+++	+++	+	++	++	++
Nwa21	+	+++	+++	+	++	++	++
Nwa22	−	++	++	+	−	++	++

.

3.3. Tolerance to Environmental Stress

In this study, the results obtained in relation to the environmental stress tolerance potential of the endophytic bacterial strains to salinity stress, temperature and pH varied. The temperature of growth at 30 °C and 35 °C supported the optimal growth of the endophytic strains, while at 40 °C, the growth responses varied. Likewise, as shown in

Table 4. Environmental stress tolerance of endophytic bacterial isolates to different pH levels.

S/N	Endophytic Bacteria Strains	pH 5	pH 7	pH 10
1	Stenotrophomonas maltophilia strain NwuBe01	++	+++	+
2	Stenotrophomonas pavanii strain NwuBe02	++	++	+
3	Brevundimonas bullata strain NwuBe03	+	++	+
4	Bacillus wiedmannii strain NwuBe04	+	++	+
5	Bacillus anthracis strain NwuBe05	++	++	+
6	Micrococcus luteus strain NwuBe06.	++	++	+
7	Myroides pelagicus strain NwuBe07	+	++	+
8	Bacillus tropicus strain NwuBe08	++	+++	++
9	Ignatzschineria indica strain NwuBe09	++	+	+
10	Bacillus thuringiensis strain NwuBe10	++	++	+
11	Staphylococcus saprophyticus strain NwuBe11	+	+	+
12	Staphylococcus edaphicus strain NwuBe12	++	+++	++
13	Staphylococcus nepalensis strain NwuBe13	+	+	+
14	Staphylococcus xylosus strain NwuBe14	++	+	+
15	Staphylococcus cohnii strain NwuBe15	+	++	+
16	Mammaliicoccus stepanovicii strain NwuBe16	+	+	+
17	Staphylococcus succinus strain NwuBe17	+	+	+
18	Staphylococcus casei strain NwuBe18	++	+	+
19	Staphylococcus arlettae strain NwuBe19	+	+	+
20	Staphylococcus saprophyticus strain NwuBe20	++	++	+
21	Lysinibacillus xylanilyticus strain NwuBe21	++	+++	++
22	Bacillus altitudinis strain NwuBe22	++	++	++
23	Paenibacillus illinoisensis strain NwuBe23	++	+++	++
24	Brevundimonas bullata strain NwuBe24	+	+	+
25	Bacillus tropicus strain NwuBe25	++	++	++
26	Brevundimonas terrae strain NwuBe26	+	+	+
27	Myroides odoratimimus strain NwuBe27	+	+	+
28	Bacillus paramycoides strain NwuBe28	++	++	+
29	Brevundimonas bullata strain NwuBe29	++	+	+
30	Pseudomonas fluorescens strain NwuBe30	++	+++	++
31	Bacillus cereus strain NwuBe31	++	++	+
32	Bacillus bingmayongensis strain NwuBe32	+	++	+
33	Staphylococcus kloosii strain NwuBe33	++	++	+

,

Table 5. Environmental stress tolerance of endophytic bacterial strains to varying salinity levels.

S/N	Endophytic Bacteria Strains	NaCl 1%	NaCl 3%	NaCl 5%
1	Stenotrophomonas maltophilia strain NwuBe01	+	+	+
2	Stenotrophomonas pavanii strain NwuBe02	++	+	+
3	Brevundimonas bullata strain NwuBe03	+	+	−
4	Bacillus wiedmannii strain NwuBe04	++	+	+
5	Bacillus anthracis strain NwuBe05	++	+	+
6	Micrococcus luteus strain NwuBe06	++	+	+
7	Myroides pelagicus strain NwuBe07	+	+	−
8	Bacillus tropicus strain NwuBe08	++	++	+
9	Ignatzschineria indica strain NwuBe09	++	+	−
10	Bacillus thuringiensis strain NwuBe10	++	+	+
11	Staphylococcus saprophyticus strain NwuBe11	+	+	−
12	Staphylococcus edaphicus strain NwuBe12	++	+	+
13	Staphylococcus nepalensis strain NwuBe13	+	+	−
14	Staphylococcus xylosus strain NwuBe14	++	+	−
15	Staphylococcus cohnii strain NwuBe15	++	+	−
16	Mammaliicoccus stepanovicii strain NwuBe16	+	+	−
17	Staphylococcus succinus strain NwuBe17	+	+	−
18	Staphylococcus casei strain NwuBe18	++	+	−
19	Staphylococcus arlettae strain NwuBe19	+	+	−
20	Staphylococcus saprophyticus strain NwuBe20	++	+	+
21	Lysinibacillus xylanilyticus strain NwuBe21	++	++	+
22	Bacillus altitudinis strain NwuBe22	++	+	+
23	Paenibacillus illinoisensis strain NwuBe23	++	+	+
24	Brevundimonas bullata strain NwuBe24	+	+	−
25	Bacillus tropicus strain NwuBe25	++	+	+
26	Brevundimonas terrae strain NwuBe26	+	+	−
27	Myroides odoratimimus strain NwuBe27	+	+	−
28	Bacillus paramycoides strain NwuBe28	++	+	−
29	Brevundimonas bullata strain NwuBe29	++	+	−
30	Pseudomonas fluorescens strain NwuBe30	++	++	+
31	Bacillus cereus strain NwuBe31	++	+	+
32	Bacillus bingmayongensis strain NwuBe32	++	+	+
33	Staphylococcus kloosii strain NwuBe33	++	+	−

and

Table 6. Environmental stress tolerance of endophytic bacterial strains to varying temperatures.

S/N	Endophytic Bacteria Strains	25 °C	30 °C	40 °C
1	Stenotrophomonas maltophilia strain NwuBe01	+	+	+
2	Stenotrophomonas pavanii strain NwuBe02	++	+	+
3	Brevundimonas bullata strain NwuBe03	+	+	−
4	Bacillus wiedmannii strain NwuBe04	++	+	+
5	Bacillus anthracis strain NwuBe05	++	+	+
6	Micrococcus luteus strain NwuBe06.	++	+	+
7	Myroides pelagicus strain NwuBe07	+	+	−
8	Bacillus tropicus strain NwuBe08	++	++	+
9	Ignatzschineria indica strain NwuBe09	++	+	−
10	Bacillus thuringiensis strain NwuBe10	++	+	+
11	Staphylococcus saprophyticus strain NwuBe11	+	+	−
12	Staphylococcus edaphicus strain NwuBe12	++	+	+
13	Staphylococcus nepalensis strain NwuBe13	+	+	−
14	Staphylococcus xylosus strain NwuBe14	++	+	−
15	Staphylococcus cohnii strain NwuBe15	++	+	−
16	Mammaliicoccus stepanovicii strain NwuBe16	+	+	−
17	Staphylococcus succinus strain NwuBe17	+	+	−
18	Staphylococcus casei strain NwuBe18	++	+	−
19	Staphylococcus arlettae strain NwuBe19	+	+	−
20	Staphylococcus saprophyticus strain NwuBe20	++	+	+
21	Lysinibacillus xylanilyticus strain NwuBe21	++	++	+
22	Bacillus altitudinis strain NwuBe22	++	+	+
23	Paenibacillus illinoisensis strain NwuBe23	++	+	+
24	Brevundimonas bullata strain NwuBe24	+	+	−
25	Bacillus tropicus strain NwuBe25	++	+	+
26	Brevundimonas terrae strain NwuBe26	+	+	−
27	Myroides odoratimimus strain NwuBe27	+	+	−
28	Bacillus paramycoides strain NwuBe28	++	+	−
29	Brevundimonas bullata strain NwuBe29	++	+	−
30	Pseudomonas fluorescens strain NwuBe30	++	++	+
31	Bacillus cereus strain NwuBe31	++	+	+
32	Bacillus bingmayongensis strain NwuBe32	++	+	+
33	Staphylococcus kloosii strain NwuBe33	++	+	−

, varied growth responses were also observed among all the endophytic strains at different salinity and pH levels.

3.4. Influence of Seed Biopriming of Endophytic Bacterial Strains on Cowpea Seed Germination

The growth chamber study of endophytic bacterial strains bio-primed with cowpea seeds indicated positive seed germination enhancement over the control (Figure 1). The best seed germination performance was recorded for the Pseudomonas fluorescens strain NWUBe30, Lysinibacillus xylanilyticus strain NWUBe21 and Bacillus cereus strain NWUBe31 (Figure 2).

3.5. Endophytic Bacterial Strains Inhibitory Action against Phytopathogenic Fungi

The results of endophytic bacterial strains inhibitory action against phytopathogenic fungi indicated positive inhibitory activity against some selected phytopathogens in a dual confrontational assay. The inhibitory action against Bortrytis cinerea and Fusarium graminearum is represented in Figure 3.

3.6. PCR of the PGP Genes

The results obtained when the genomic DNA of selected endophytic bacterial strains was used to amplify 16S rRNA genes and other PGP genes by PCR including GCD, ACPHO, IPDC and ACCD indicated that about 70% of the selected strains confirmed positive gene presence for both ACPHO and GCD genes at the expected band size. However, about 30% of the selected strains confirmed the positive possession of all four of the genes (ACCD, ACPHO, IPDC and GCD) is presented in supplementary (Figures S2 and S3).

4. Discussion

In recent times, endophytic microbial research studies have shown the remarkable role of endophytic bacterial isolates as important partners in the plant-microbiome interactions, with beneficial consequences in relation to plant growth, fitness and functionality. In studies that cover diverse plant types, numerous endophytic bacterial isolates have been shown to have beneficial attributes that enhance plant growth [48,49,50,51].

Thus, our study focused on bioprospecting endophytic bacterial strains from cowpea seeds and tissues as microbial agents that could be deployed in improving cowpea productivity as viable and sustainable substitutes to synthetic agrochemicals. Hence, using a cultivation-based approach, 33 endophytic bacterial isolates were isolated from cowpea tissues and morpho-genetically authenticated to be potent in enhancing plant growth. The taxonomy, phylogeny and metabolic functions indicated that the isolated endophytic bacterial strains are highly diverse and multifaceted.

The 33 characterized endophytic bacteria isolates are composed of 11 genera: Pseudomonas, Lysinibacillus, Bacillus, Paenibacillus, Stenotrophomonas, Brevundimonas, Staphylococcus, Micrococcus, Myroides, Ignatzscineria and Mammalicoccus. The results of the nucleotide blast and phylogenetic relatedness of the isolated endophytic bacterial strains indicated a 97% to 100% species similarity with related strains in the GenBank. Our findings in the present study agree with findings from [52,53,54,55,56,57,58,59,60,61], which reported that diverse endophytic bacterial strains can be isolated and characterized from the different tissues of plants, including leguminous crops.

The stimulation of plant growth has been achieved through a diversity of approaches to endophytic microbiota [62,63,64]. This study confirmed the efficacy of endophytic bacterial strains in achieving growth-stimulating activities in cowpea through multifarious metabolic traits that include phosphate solubilization, the production of indole acetic acid, siderophore, exopolysaccharide, ammonia and ACCD. All the 33 endophytic bacterial isolates possess at least three growth-improving traits. The effectiveness of the characterized endophytic bacterial strains in this study in eliciting PGP traits has been attributed to their growth-enhancing capacity through direct and indirect mechanistic approaches [65,66]. For instance, the siderophore-producing abilities of endophytic microbes makes for the chelating of iron from unavailable to usable forms for plant absorption, thus enhancing growth [67,68]. Likewise, the abilities of endophytic microbiota to solubilize phosphate, to produce auxin-like IAA, to regulate ethylene biosynthesis through the production of the ACC deaminase enzyme and to fix atmospheric nitrogen confer, amongst others, growth-promoting attributes on planted crops [69,70,71,72].

Endophyte-mediated phosphate solubilization via organic acid secretion is a means of making phosphorus available for plant uptake [73,74]. Also, endophytic microbial mediated phyto-hormonal production has been reported to stimulate growth in planted crops [75,76]. These positive attributes of endophytic microbiota are mediated through the beneficial regulation of the stressful conditions induced by ethylene, as well as through the signaling of molecules for positive plant-microbe interactions.

Generally, the improvement in the growth of planted crops results from endophytic microbe inoculation through different mechanistic approaches, such as the production of siderophore, IAA and the ACC deaminase enzyme, nitrogen fixation, biofilm formation and other growth-promoting traits. These benefits are the basis of various metabolic and physiological changes that are induced in the host plant and include phytohormonal production, the modification of plant root architecture to enhance water and nutrient uptake and retention, the antagonization and evasion of phytopathogens and the ability to alleviate abiotic stressors in the environment.

In addition to the data in the present study from the in vitro growth assessment assay, seed germination studies have indicated that all the endophytic bacterial strains possess multiple growth-improving traits that significantly enhance the seed germination percentage rate to a greater extent than those of the control plant. The enhancement in seed germination percentage of the cowpea plant that was observed in this study concurs with the previous report in the literature that supports bioinoculating microbial agents as a means of mediating physiological changes and growth improvement in planted crops [56,57,77].

5. Conclusions

The salient findings of this study affirm that all the 33 resident endophytic bacterial strains from cowpea plant tissue have the potential to improve cowpea productivity in vitro and in seed germination experiments. These diverse and efficient endophytic microbial isolates deployed different growth-promoting traits such as the secretion of siderophore and auxin, the ability to chelate iron, to solubilize phosphate, to produce ammonia, and to take action to inhibit the growth of phytopathogens and thus to improve cowpea growth. Therefore, these functions have shown good prospects for the endophytic bacterial isolates to improve the sustainability of cowpea production. However, these isolates need to be subjected to further strain improvement protocols, genomic exploration studies and multiple experimental trials in the field.