Next Article in Journal
Wettability of the Plant Growth Regulator 28-HB on Pepper Leaves at Different Developmental Stages
Next Article in Special Issue
Biocontrol Potential of Bacillus amyloliquefaciens PP19 in Alleviating Watermelon Continuous Cropping Obstacles
Previous Article in Journal
Integrative Genomic and Cytogenetic Analyses Reveal the Landscape of Typical Tandem Repeats in Water Hyacinth
Previous Article in Special Issue
Characterization of Plant Defensin (PDF) Genes in Banana (Musa acuminata) Reveals the Antifungal Ability of MaPDF2.2 to Fusarium Wilt Pathogens
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biocontrol Mechanisms of Trichoderma longibrachiatum SMF2 Against Lanzhou Lily Wilt Disease Caused by Fusarium oxysporum and Fusarium solani

1
College of Architecture, Yantai University, Yantai 264005, China
2
Institute of Pomology, Jiangsu Key Laboratory for Horticultural Crop Genetic Improvement, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China
3
Key Laboratory of Landscaping Agriculture, Ministry of Agriculture and Rural Affairs, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, China
4
College of Agriculture and Biology, Liaocheng University, Liaocheng 252059, China
5
State Key Laboratory of Microbial Technology, Marine Biotechnology Research Center, Shandong University, Qingdao 266237, China
6
College of Life Sciences and Medicine, Zhejiang Sci-Tech University, Hangzhou 310018, China
7
Engineering Technology Research Center of Anti-Aging Chinese Herbal Medicine, Biology and Food Engineering College, Fuyang Normal University, Fuyang 236037, China
8
Vegetable Research Institute, Gansu Academy of Agricultural Sciences, Lanzhou 730070, China
9
College of Medicine, Shandong Xiehe University, Jinan 250109, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Horticulturae 2025, 11(6), 660; https://doi.org/10.3390/horticulturae11060660
Submission received: 23 April 2025 / Revised: 3 June 2025 / Accepted: 7 June 2025 / Published: 10 June 2025

Abstract

Lanzhou lily is a plant native to China with high edible, medicinal, and ornamental value that is relatively susceptible to Fusarium wilt. In this study, the application of Trichoderma longibrachiatum SMF2 (TlSMF2) effectively controlled Lanzhou lily wilt disease caused by Fusarium oxysporum and F. solani. TlSMF2 and the antimicrobial peptaibols trichokonins (TKs) produced by TlSMF2 inhibited the mycelial growth and spore germination of these two pathogens. Transcriptome analysis revealed that the TKs-induced defense responses of Lanzhou lily were mainly related to the production of plant hormones and defense enzymes. In detail, TKs treatment increased the levels of salicylic acid (SA) and jasmonic acid (JA) and the expression of their related genes and upregulated the activities of chitinase and phenylalanine ammonia-lyase (PAL). Moreover, TKs caused the induction of LzWRKY26 and LzWRKY75, which is highly homologous to LrWRKY3 that positively regulates Lilium regale resistance to F. oxysporum. LzWRKY26 expression was also induced by SA and MeJA treatments and F. oxysporum infection, which was consistent with the findings that many cis-acting elements associated with phytohormones and stress responses are present in the promoter region of LzWRKY26. Therefore, the biocontrol mechanisms of TlSMF2 against Lanzhou lily wilt disease involve substrate competition and toxicity against pathogens, as well as the induction of systemic resistance in plants. Our results highlight a promising biological control agent for soil-borne fungal diseases and offer deeper insights into the biocontrol mechanisms of TlSMF2.

1. Introduction

As an indigenous Chinese species, Lanzhou lily (Lilium davidii var. unicolor) is a well-known plant of remarkable edible, medicinal, and ornamental value that contributes substantially to agro-landscaping systems and rural revitalization. In recent years, Lanzhou lily plants have been reported to exhibit severe wilt symptoms characterized by root, bulb, and stem rot, accompanied by the progressive yellowing and wilting of leaves, originating from the base [1]. Wilt disease (also known as root and bulb rot or basal rot) has caused significant damage to bulb yield and landscape quality, especially in soil with succession cropping or a high moisture content. In previous studies, Fusarium oxysporum, F. solani, and F. graminearum were identified as pathogens of Lanzhou lily wilt [2], of which Fusarium oxysporum f. sp. lilii is the main type. We first reported that F. redolens causes wilt disease in Lanzhou lilies in China [1]. Using resistant germplasm is the most effective means of controlling lily Fusarium wilt. Some wild species, such as L. regale, L. dauricum, L. henryi, and L. pumilum are highly resistant to this disease and are widely used in resistance breeding [3,4]. Among the lily cultivars, most Asiatic hybrids are highly resistant, while most Oriental hybrids are susceptible [3]. As it is a soil- and bulb-borne disease, measures such as diseased crop residue removement, soil solarization, soil and bulb sterilization, soil fertility balance, crop rotation, and flood fallowing can reduce Fusarium wilt disease severity [5,6]. At present, chemical control is the main measure used to control lily wilt, including soil and bulb sterilization and fungicide root irrigation. Lily root rot is effectively controlled by bulb soaking in dimethachlon solution [7]. However, the disadvantages of chemical control include the development of pathogen resistance and environmental pollution. Therefore, biological control using fungal and bacterial antagonists is the preferred choice. Irrigation with Bacillus amyloliquefaciens BF1 and B. subtilis Y37 in lily bulbs results in the mitigation of Fusarium wilt disease symptoms in plants [8]. B. velezensis GX1 significantly decreases the disease severity index of lily bulb rot caused by F. commune [9]. The antifungal peptide BVAP produced by B. velezensis increases the permeability of the F. solani mycelial membrane, brings about swelling at the tips of hyphae, and elicits an abnormal accumulation of nucleic acids and chitin at the sites of swelling [10]. It is mainly biocontrol bacteria that regulate the lily defense response to Fusarium spp. infection; biocontrol fungi are rarely reported on. Trichoderma spp. are widely recognized as important biological control agents (BCAs) for plant disease management [11,12]. T. harzianum T22 can biocontrol against wilt disease caused by the F. oxysporum f. sp. lactucae strain 365.07 in water-stressed lettuce plants [13]. The severity of Fusarium wilt disease is decreased by the application of T. atroviride and T. longibrachiatum in tomato [14]. One of the regulation mechanisms involves the peptaibols produced by Trichoderma spp., which are able to inhibit the growth of fungal pathogens, improve the growth of the host, or trigger a defense response [15,16,17]. Trichokonins (TKs) are peptaibols isolated from T. longibrachiatum SMF2, which demonstrate broad-spectrum antimicrobial activity against bacterial, fungal, and viral pathogens [18,19,20,21] and induce systemic resistance to Botrytis cinerea in Phalaenopsis aphrodite and to Pectobacterium carotovorum subsp. carotovorum in Brassica rapa pekinensis [15,22]. However, the molecular control mechanisms of TKs against plant disease are rarely reported on. Transcriptome sequencing analysis revealed that several pathways are involved in the response of L. pumilum to F. oxysporum, including phenylpropanoid biosynthesis, plant hormone signal transduction, flavonoid biosynthesis, and WRKYs [23]. The transcription factors (TFs) WRKY, MYB, AP2/ERF-ERF, and bHLH are highly activated in decayed lily bulbs due to F. oxysporum [24]. Jasmonic acid (JA) and salicylic acid (SA) are essential for the induced systemic resistance (ISR) and systemic acquired resistance (SAR) in plants, respectively [25,26,27]. WRKY transcription factors act as the key regulators of JA- and SA-mediated plant immune responses. The overexpression of WRKY8-1 in Chrysanthemum morifolium decreases the expressed levels of SA-related genes and the endogenous SA content, resulting in reduced resistance to F. oxysporum infection [28]. VvWRKY5 improves grape white-rot resistance via the regulation of JA biosynthesis and signal transduction [29]. WRKYs have also been reported to modulate the lily response to the root-rot pathogen F. oxysporum through the JA and SA pathways. Compared with wild-type tobacco, Lilium regale LrWRKY3 transgenic tobacco lines with higher transcriptional levels of genes related to JA biosynthesis and SA signal transduction show greater resistance to F. oxysporum [30]. LrWRKY2 has been identified as an important positive regulator against F. oxysporum stress by activating the expression of LrCHI2, which encodes a chitinase [31]. As an important glycoside hydrolase, this chitinase can catalyze chitin hydrolysis, leading to enhanced plant resistance against chitin-containing pathogens [32]. The resistance of apple to F. solani is regulated by the MdWRKY20-MdPR1 module [33]. Integrated transcriptomic and metabolomic analyses imply that the phenylpropanoid biosynthesis pathway is critical in the resistance of Longya lily to bulb rot [24]. The activity of phenylalanine ammonia-lyase (PAL) is of great importance for the biosynthesis of lignin and flavonoids, which are defense-related secondary metabolites derived from the phenylpropanoid pathway in plants [34,35,36,37,38]. OsWRKY36 negatively modulates rice tolerance to multiple pathogens via the transcriptional repression of PALs, which inhibits lignin biosynthesis [37]. The upregulation of the key genes encoding chitinase and PAL partially accounts for the improved enzymatic activity, which further confers the plant with Fusarium wilt resistance.
In this study, the antagonistic ability of TlSMF2 against Lanzhou lily Fusarium wilt pathogens was measured in vitro and in vivo. Subsequently, the ISR and SAR evoked by TKs were determined by combining physiological and gene expression analyses.

2. Materials and Methods

2.1. Dual Cultures of TlSMF2 Against F. oxysporum or F. solani

F. oxysporum and F. solani were isolated from field-infected Lanzhou lily plants in the Qilihe district in Lanzhou city, China, and identified as pathogens of wilt disease at Liaocheng University, China. The biocontrol fungus TlSMF2 (CCTCC No. 209031) was acquired from the State Key Laboratory of Microbial Technology in Shandong University, China.
The inhibitory effect of TlSMF2 against F. oxysporum and F. solani was tested using a dual-culture method in potato dextrose agar (PDA) medium (20% potato, 2% glucose, and 2% agar). Mycelial plugs (5 mm in diameter) of F. oxysporum or F. solani and TlSMF2 were placed on the opposite sides of a PDA plate, 25 mm from the edge. F. oxysporum or F. solani grown on a PDA plate served as the control. After inoculation at 25 °C for 6.5 d in the dark, the growth distances of the pathogen in the treatment and the control groups were measured. The inhibition rate was calculated using the following formula:
Inhibition   rate   ( % ) = A v e r a g e   d i a m e t e r s   o f   t h e   c o n t r o l A v e r a g e   d i a m e t e r s   o f   t h e   t r e a t m e n t A v e r a g e   d i a m e t e r s   o f   t h e   c o n t r o l 5 × 100

2.2. Indoor Toxicity Test of TKs on F. oxysporum and F. solani

The antagonistic activity of TKs against F. oxysporum and F. solani was determined. The biofungicide matrine and the chemical fungicide hymexazol were designated as the control fungicides. Stock solutions containing a total of 5 mg/mL TKs were obtained according to Luo’s method [21]. For this study, 0.3% matrine (Hebei Fuji Biotech Co., Ltd. Shijiazhuang, China) and 99% hymexazol (Oasis Chemical Co., Ltd. Yanbian, China)were purchased from the market.
To investigate the inhibitory effect of the three fungicides on the mycelial growth of pathogens, F. oxysporum and F. solani were grown on the PDA medium at 25 °C for 6 days. Then, a mycelial plug (7 mm in diameter) cut from the colony margin was placed in the center of the PDA medium containing the different fungicides at various concentrations (Table 1). The colony diameter of the pathogen was measured after inoculation at 25 °C for 6.5 d in the dark. The experiment was repeated three times, with three replications for each repetition. The calculation formula for the mycelial growth inhibition rate was as follows.
Inhibition   rate   ( % ) =   D i a m e t e r   o f   t h e   c o n t r o l D i a m e t e r   o f   t h e   t r e a t m e n t D i a m e t e r   o f   t h e   c o n t r o l 7 × 100
To investigate the inhibitory effect of the three fungicides on the spore germination of pathogens, F. oxysporum and F. solani were grown on the PDA medium at 25 °C for 10 days. Then, the conidia were washed with sterile water to make a spore suspension (1 × 107 spores/mL) containing 0.1% Tween 80. The spore suspension was filtered through Whatman filter paper (No. 1) to remove the mycelia. The suspension was then mixed with potato dextrose broth (PDB) medium and the fungicide solution, resulting in the final concentration of each fungicide (Table 1). A mixture containing an equal amount of sterile water instead of fungicide solution was used as the control. The F. oxysporum and F. solani cultures were incubated in a shaking incubator (BOXUN BSD-150, Shanghai, China) at 25 °C, 120 r·min−1 in darkness for 72 h and 96 h, respectively. The spores were counted under a microscope (OLYMPUS BX51, Tokyo, Japan), and the inhibition rate was determined based on the following formula:
Inhibition   rate   ( % ) =   G e r m i n a t i o n r a t e   o f   t h e   c o n t r o l G e r m i n a t i o n   r a t e   o f   t h e   t r e a t m e n t G e r m i n a t i o n   r a t e   o f   t h e c o n t r o l × 100
The half maximal effective concentration (EC50) for the mycelial growth and spore germination was calculated from dose–response curves using the software SPSS 18.0.

2.3. Control Efficiency of TlSMF2 Against Wilt Disease in Potting Experiments

Healthy Lanzhou lily bulbs of similar size and with similar cultivation substrates (sphagnum peat and sand; v:v = 1:1) were treated with mancozeb. The bulbs were potted until budding occurred, and then the underground part of the plants was drenched with 50 mL of a 1 × 107 spores/mL TlSMF2 solution. An equivalent sterile-water treatment served as the control. After treatment for 7 d, the roots of both the TlSMF2-treated and control plants were treated with 50 mL of a 1 × 106 spores/mL F. oxysporum or F. solani solution, and the pathogenic spore inoculation treatments were conducted again after 7 days. Each treatment comprised three replicates, with twelve individual plants constituting one replicate. Using He’s method with modifications [39], the disease grading standards were determined by the leaf-withering degree, which was assessed by the proportion of withered leaves relative to the total foliage of the plant. According to the disease level (Table 2), the disease index (DI) was determined on day 30 after treatment using the following formula:
DI (%) = [Σ (number of diseased plants × disease level)/(total number of plants investigated × the highest disease level)] × 100

2.4. Transcriptome Analysis from TKs-Treated Lanzhou Lily Plants

The Lanzhou lily plants were root-irrigated with 2 mg/L TKs for 12 and 24 h, while the control plants were exposed to distilled-water irrigation. Leaf sample collection, RNA sequencing, and transcriptome analysis were executed as described previously [40]. GO enrichment and KEGG enrichment analyses were performed using the Omic Share platform “https://www.omicshare.com/ (accessed on 13 February 2025)”. The project number of the sequencing data is PRJNA1119648 in the NCBI.

2.5. Measurement of Defense-Related Physiological Indicators

The treatments for the Lanzhou lily plants were the same as described above. The middle leaves of the plants were collected for the determination of JA and SA contents and chitinase and PAL activities.
SA and JA were quantified using established protocols with modifications [41]. Leaf tissue samples (500 mg) were frozen in liquid nitrogen and then ground into a fine powder for phytohormone extraction. Extraction was implemented twice with acetonitrile, followed by purification with a Poroshell 120 SB-C18 column. The SA and JA levels were determined by high-performance liquid chromatography–electrospray ionization–tandem mass spectrometry (HPLC-ESI-MS/MS) using Agilent 1260 HPLC paired with 6420A MS (Agilent Technologies Inc., Santa Clara, CA, USA).
Chitinase (EC 3.2.1.14) activity was detected using an assay kit (Solarbio, Beijing, China). A single unit of chitinase activity is defined as the production of 1 μmol of N-acetylglucosamine per gram of tissue per hour at 37 °C. A PAL (EC 4.3.1.5) assay kit (Jiancheng, Nanjing, China) was employed to determine its activity. One unit of PAL activity is standardized as the catalytic capacity required to induce a 0.01 increase in absorbance at 290 nm per minute in a 1 mL reaction system containing 1 g tissue.

2.6. Determination of Immune-Related Genes Expression by Quantitative Real-Time PCR (qPCR)

RNA extraction and cDNA synthesis were carried out according to existing protocols [42]. qPCR was used to determine the expression levels of the LzICS1, LzNPR1, LzPR1, LzJAR1, LzAOS, LzMYC2, LzChi2, LzPAL2, LzWRKY75, and LzWRKY26 genes using the SYBR Green Supermix (Takara, Dalian, China) on a Roche LightCycler 480 II (Roche, Basel, Switzerland). Lily 18S rRNA served as the internal control for normalization, and the relative gene expression level was calculated using the 2−ΔΔCt method [43]. The primers used in the qPCR analysis are shown in Table 3.

2.7. Isolation of the LzWRKY26 Promoter and Cis-Element Analysis

The sequence 1999 bp upstream of the initiation codon (ATG) of LzWRKY26 was obtained from the Lanzhou lily genome [44]. Subsequently, potential cis-acting elements in the promoter region were identified using the PlantCARE database “http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 5 June 2025)”.

2.8. Statistical Analysis

The data were calculated and analyzed using Microsoft Excel 2019 and SPSS 18.0. The statistical significance among the EC50 or DIs was evaluated by the Kruskal–Wallis test together with the Dunn test, and the other data were assessed by Student’s t-test or Duncan’s test. A p value < 0.05 was considered to be statistically significant.

3. Results

3.1. In Vitro Colony Growth Inhibition of TlSMF2 Against F. oxysporum and F. solani

The antiblastic effects of TlSMF2 on F. oxysporum and F. solani were tested using paired cultures. The inhibitory rates of TlSMF2 against F. oxysporum and F. solani were 73.1% and 61.5% on day 6.5, respectively (Figure 1). Remarkably, TlSMF2 suppressed the colony growth of F. oxysporum and F. solani. The antimicrobial activity level of TlSMF2 against F. oxysporum was higher than that against F. solani.

3.2. Indoor Toxicity Effect of TKs on F. oxysporum and F. solani

TKs are the antimicrobial peptaibols generated by TlSMF2. Here, the inhibitory effects of TKs and the other two fungicides on the mycelial growth and spore germination of F. oxysporum and F. solani were determined (Table 4 and Figure 2). The EC50 values of TKs on the mycelial growth of F. oxysporum and F. solani were 31.3 and 57.3 mg/L, respectively. The EC50 values of TKs on the spore germination of F. oxysporum and F. solani were 32.5 and 12.6 mg/L, respectively. These results suggest that the inhibitory effect of TKs on the mycelial growth of F. oxysporum was superior to that on F. solani, while the inhibitory effect of TKs on the spore germination of F. oxysporum was inferior to that on F. solani. The relative toxicity of TKs on both F. oxysporum and F. solani was higher than that of the chemical fungicide hymexazol but lower than that of the biofungicide matrine.

3.3. Biocontrol Effect of TlSMF2 Against Lanzhou Lily Fusarium Wilt In Vivo

The control efficiency of TlSMF2 against wilt disease caused by F. oxysporum and F. solani was evaluated via a potting experiment. Severe wilt symptoms with DIs as high as 63.9% and 68.3% were observed in the plants infected with F. oxysporum and F. solani, respectively (Figure 3). In the plants treated with TlSMF2, the DIs decreased by 31.3% and 34.1% in the F. oxysporum and F. solani infection groups, respectively (Figure 3). Consequently, TlSMF2 exhibited high biocontrol efficacy against Fusarium wilt in Lanzhou lily.

3.4. Functional Enrichment Analysis of DEGs in Response to TKs Treatment

Can TKs induce systemic resistance in Lanzhou lily, thereby contributing to the Fusarium wilt disease management by TlSMF2? Here, this theory was investigated using the transcriptome data from the TKs-treated Lanzhou lilies. GO and KEGG enrichment analyses were performed to study the functions of the DEGs responding to the TKs treatment.
The top 25 GO enrichment terms are shown in Figure 4A,B. In the 12 h and 24 h TKs treatments, the functions of the DEGs are mainly concentrated in the “membrane (GO:0016020)”, the “membrane part (GO:0044425)”, the “intrinsic component of membrane (GO:0031224)”, and the “integral component of membrane (GO:0016021)” in relation to the category of Cellular Component; the “oxidoreductase activity (GO:0016491)” and the “hydrolase activity, acting on glycosyl bonds (GO:0016798)” in regard to Molecular Function; and the “carbohydrate metabolic process (GO:0005975)” and the “single-organism catabolic process (GO:0044712)” in terms of Biological Process.
In the KEGG enrichment analysis of the 12 h TKs treatment, the following terms were the most enriched: “metabolic pathways (ko01100)”, “biosynthesis of secondary metabolites (ko01110)”, and “carbon metabolism (ko01200)” in relation to Metabolism; “protein processing in endoplasmic reticulum (ko04141) ” in regard to Genetic Information Processing; “plant-pathogen interaction (ko04626) ” in terms of Organismal Systems; and “plant hormone signal transduction (ko04075)” in reference to Environmental Information Processing (Figure 4C). For the 24 h TKs treatment, the top three enrichment terms in the Metabolism category and the top enrichment term in the Organismal Systems category were the same as those of the 12 h TKs treatment. The other two most commonly enriched terms were the “MAPK signaling pathway—plant (ko04016)” in regard to Environmental Information Processing and “peroxisome (ko04146)” in terms of Cellular Processes (Figure 4D).
These results imply that the TKs treatment induced an immune response in Lanzhou lily. Subsequently, we focused on plant hormones and defense enzymes that are closely related to plant immunity.

3.5. TKs Treatment Induced JA and SA Accumulation to Regulate Lanzhou Lily Fusarium Wilt Resistance

The functional enrichment of DEGs suggested that phytohormones, which are considered to be important regulators in plant immunity, especially reacted to the TKs treatment. JA is a signaling molecule implicated in plant ISR, while SA is associated with the induction of plant SAR. We further tested the levels of JA and SA and the activities of their related genes in the TKs-treated plants. The treatment with TKs significantly increased the SA content at 24 h and the JA content at 12 h (Figure 5A,C). The expression levels of LzICS1, encoding an SA biosynthesis enzyme, and LzNPR1 and LzPR1 in the SA signaling pathway were elevated by the 24 h TKs treatment (Figure 5B). The LzAOS and LzJAR1 genes, encoding key enzymes in the JA synthesis pathway, and LzMYC2 in the JA signaling pathway were up-regulated under the 12 h TKs treatment (Figure 5D).
These results indicate that the TKs treatments resulted in the upregulation of key genes in the synthesis of SA and JA, which was partly responsible for the increase in SA and JA contents. Furthermore, the increase in SA and JA levels might induce signal transduction genes to trigger the Lanzhou lily defense response to Fusarium wilt.

3.6. TKs Treatment Increased the Activity Levels of Chitinase and PAL

The functional enrichment of DEGs implied that glycoside hydrolase was involved in the defense response triggered by TKs in Lanzhou lily. Thus, the expression levels of the gene encoding chitinase and the activity of chitinase in the Lanzhou lily plants responding to TKs were determined. The activity level of chitinase in the TKs-treated plants over 24 h was significant higher than that of the control group (Figure 6A), especially at 12 h. Correspondingly, the chitinase-encoding gene LzChi2 was obviously induced by the TKs treatment after 12 h (Figure 6B).
Functional characterization of the DEGs showed that the enrichment of the biosynthesis of secondary metabolites was induced by TKs. PAL is a primary and key enzyme in the phenylalanine metabolism pathway for the production of phenylpropanoids, which are secondary metabolites closely involved in the plant biotic stress response. Hence, PAL activity and its encoding gene expression in response to TKs were measured. TKs application increased the level of PAL activity at 24 h (Figure 6C), where the expression of the marker gene LzPAL2 encoding PAL can be seen to be significantly upregulated (Figure 6D).

3.7. LzWRKY75 and LzWRKY26 Were Induced by TKs Treatment

The expression pattern of WRKY genes in response to the TKs treatment was explored. Most of the WRKYs were down-regulated, while several WRKYs, including LzWRKY2, LzWRKY22, LzWRKY26, LzWRKY49, LzWRKY69, LzWRKY70, and LzWRKY75, were up-regulated by the 24 h TKs treatment, based on the transcriptome analysis (Figure 7A). LzWRKY75 shows high-level sequence similarity (98.3%) to LrWRKY3, which is a key regulator of F. oxysporum tolerance in L. regale [30]. The expression of LzWRKY26 and LzWRKY75 was further detected using the qPCR method. The TKs treatment induced LzWRKY75 and LzWRKY26 expression at 24 h. Additionally, LzWRKY26 expression was induced by SA, MeJA, and F. oxysporum infection (Figure 7B). Subsequently, the 1999 bp sequences upstream of the LzWRKY26 gene were obtained, and the cis-regulatory elements on the promoter region were predicted. Diverse cis-acting elements were found in the promoter (Table S1 and Figure 7C), such as light- (G-box, Box 4, I-box, Gap-box, AE-box, Sp1, ACE, MRE, GA-motif, GATA- motif, TCT-motif, GT1-motif, and 3-AF1 binding site), hormone- (ABA, GA, SA, and MeJA responsiveness), and stress-responsive elements (DRE core, MBS, ARE, STRE, LTR, WRE3, and WUN-motif); the TATA-box for transcription initiation; and the CAAT-box as an enhancer. Several hormone response elements are for MeJA (CGTCA- and TGACG-motifs) and SA (as-1), which are probably responsible for the gene upregulation induced by exogenous MeJA and SA.
The expression patterns of the LzWRKY genes in reaction to the TKs treatment were variable, of which those of LzWRKY75 and LzWRKY26 were potentially correlated with the TKs-mediated antifungal defense response in Lanzhou lily.

4. Discussion

F. oxysporum, F. solani, F. redolens, F. tricinctum, F. armeniacum, F. commune, F. moniliforme, F. proliferatum, and Rhizoctonia solani have been identified as pathogens causing wilt disease in lily [1,45,46,47,48], of which F. oxysporum is the main pathogenic fungus. We previously reported that F. oxysporum, F. solani, and F. redolens were causal agents of wilt disease in Lanzhou lily [1]. Because F. redolens accounts for a low proportion of isolated strains, F. oxysporum and F. solani were chosen as the target phytopathogens in this study. An increasing number of studies have reported that biocontrol applications enhance plant resistance to F. oxysporum and F. solani stress. Bacillus velezensis Lle-9 isolated from lily bulbs displays high antifungal activity levels against F. oxysporum [49]. T. harzianum ITEM 3636 inhibits the mycelial growth of F. solani through the synthesis of secondary metabolites, high-level enzymatic activity, and important modifications in the pathogenic hyphae [50]. The biofumigant allyl isothiocyanate can effectively alleviate the occurrence of Lanzhou lily wilt disease under high-temperature and high-humidity conditions [39]. The bioactive compound niphimycin C extracted from Streptomyces yongxingensis sp. nov. exhibits strong antifungal activity against Fusarium oxysporum f. sp. cubense tropical race 4, which is characterized by the functional loss of mitochondria and a metabolism disorder in the pathogen cells [51]. Furthermore, niphimycin C represses root infection and reduces the DI in banana plantlets [51]. As the key BCAs against fungal pathogens, Trichoderma spp. are common inhabitants of soil, root, foliar, and rotten wood environments. The mechanisms employed by Trichoderma spp. in the biological control of plant diseases include competition, antibiosis, antagonism, and mycoparasitism against pathogens and growth promotion and systemic resistance induction in plants [52,53,54,55,56,57,58,59]. T. harzianum, T. reesei, T. viride, T. longibrachiatum, T. brevicompactum, T. asperellum, and T. virens have been found to control soil-borne fungal diseases effectively. T. brevicompactum DTN19 can secrete antibiotics and destroy cell walls to inhibit the propagation of F. oxysporum causing corm rot in saffron and produce IAA and iron carriers to promote plant growth [60]. T. longibrachiatum TL13 effectively controls Fusarium root rot on snow pea by inhibiting the growth of F. solani and F. avenaceum, encouraging seedling growth and antioxidative enzyme activity and activating plant defense mechanisms [61]. Peptaibols are among the most important antimicrobial secondary metabolites secreted by Trichoderma species, and are non-ribosomally synthesized linear peptides having from five to twenty amino acid residues. Peptaibols, such as trichorzianines, trichorzins, longibrachins, harzianines, tricholongins, and trichotoxins, show antimicrobial activity against a number of phythopathogens and induce plant defense responses to biotic stress [53,62]. Earlier investigations by our team uncovered that T. longibrachiatum SMF2 is a promising BCA with strong antibiotic action against bacterial and fungal phytopathogens. An antagonistic mechanism is the action of peptaibol TKs produced by TlSMF2, which are able to inhibit the growth of pathogens [18,19]. The mycelial growth and sporulation of B. cinerea causing gray mold on moth orchid are significantly inhibited by TKs [15]. Similar results were observed in this research, which showed that TKs had remarkable inhibitory effect on the mycelial growth and spore germination of F. oxysporum and F. solani. It was also found that the relative toxicity of TKs was stronger than that of the chemical fungicide hymexazol but weaker than that of the biofungicide matrine. Substrate competition is another fungicidal mechanism of Trichoderma strains. The paired cultures conducted in this study revealed the significant inhibitory effect of TlSMF2 against the two pathogens, reflecting the dual effect of competition by TlSMF2 and the toxicity of TKs. The inhibitory in vitro activity level of TlSMF2 on F. oxysporum was higher than that on F. solani. TKs have been reported to be an inducer of plant disease resistance [15,21,22]. However, the induction mechanism involved in the plant transcriptome response to TKs treatment has rarely been reported. In this study, transcriptome analysis revealed that several pathways are implicated in the TKs-elicited immune response in Lanzhou lily, including plant hormone signal transduction, oxidoreductase and hydrolase activities, and plant–pathogen interactions. Phytohormones, such as ABA, SA, JA, and ET, play important roles in the plant biotic stress response [25,63]. SA is essential for plant immunity by enhancing resistance in the infected tissues and eliciting the SAR in the uninfected tissues [64]. SA biosynthesis is induced during PTI (pattern-triggered immunity) and ETI (effector-triggered immunity) through two distinct pathways mediated by ICS and PAL, respectively [65]. The defense response to Rhizopus stolonifer in peach fruit primed with β-aminobutyric acid is associated with increased ICS1/2 expression and SA levels [66]. Silencing GmPALs or GmICSs in soybean leads to a reduction in SA biosynthesis and aborted resistance to Pseudomonas syringae pv. glycinea [67]. Similar findings were observed in this work, which showed that TKs treatment caused the upregulation of LzICS1 and LzPAL2 and the accumulation of SA. PAL is also essential for the phenylpropanoid pathway, which is a major route for the production of antimicrobial compounds containing catechins, isoflavonoids/flavonoids, anthocyanidins, lignin/lignans, etc. Enhancing tomato resistance against V. dahliae largely depends on the activities of PAL and the enzymes involved in defense-related secondary metabolism and cell-wall strengthening [34]. The knockdown of PALs in Brachypodium reduces PAL activity, leading to decreased lignin content, thereby enhancing susceptibility to F. culmorum [68]. Similar to these previous research studies, the increase in PAL activity triggered by TKs might strengthen Lanzhou lily immunity to Fusarium stress. It is well known that NPR1 is the predominant SA receptor, which interacts with TGA transcription factors to activate SA-responsive genes, such as PR genes [33,69,70]. Consistent with these results, the induction of LzNPR1 and LzPR1 might result from the elevation of SA levels generated by TKs. In general, JA and its derived compounds (“jasmonates”) participate in plant immune responses to necrotrophic pathogens via ISR [26]. The increase in JA production due to the activation of AOS genes encoding the key enzymes of JA synthesis is positively associated with F. circinatum resistance in pine and leaf scald disease resilience in sugarcane [71,72]. JA-Ile is rapidly synthesized in response to biotic stress and binds to the co-receptor COI1-JAZ complex in JA signaling, leading to the degradation of JAZ repressors and the liberation of MYC2 to induce JA-responsive genes [73,74,75]. Group IIc WRKY and BBX24 regulate the MYC2-mediated defense response to enhance F. oxysporum wilt resistance in cotton and sweet potatoes, respectively [35,76]. In this study, the increased JA content in the TKs-treated Lanzhou lilies might be, in part, a result of the upregulation of LzAOS and LzJAR1 expression. Further, the elevated JA levels might activate LzMYC2 to enhance the resilience of Lanzhou lily to Fusarium wilt. Chitinases are important glycoside hydrolases that catalyze the hydrolysis of chitin in the fungal cell wall to improve plant resistance against pathogenic fungi. TKs application promoted the activity of chitinase, which is a significant marker for resistance against F. oxysporum and B. elliptica in lily [31,77]. The upregulation of LzChi2 that was induced by TKs might be favorable to the enhancement in chitinase activity, although the Lanzhou lily genome contains many chitinase genes. In short, the Lanzhou lily resistance to Fusarium wilt disease might partly be attributed to the increases in SA and JA contents and chitinase and PAL activities caused by the TKs treatment.
A growing body of literature has reported that WRKY transcription factors play important roles in plant immunity by way of defense-related phytohormones and enzymes [78,79]. Flavonoid biosynthesis in cotton and lignin/lignan biosynthesis in L. regale activated by WRKYs both confer resistance to F. oxysporum [35,36]. Barley HvWRKY6 is downstream of NPR1 during SAR, and the exogenous expression of HvWRKY6 in wheat enhances resistance to Fusarium crown rot [80]. LrWRKY11 positively modulates resistance to F. oxysporum through SA- and JA-mediated defense responses in L. regale [36]. LrWRKY2 also acts as an important positive regulator in the defense against F. oxysporum invasion by inducing expression of the chitinase-encoding gene LrCHI2 [31]. Therefore, the expression patterns of the WRKY genes responding to the TKs treatment were investigated in this work. Among the TKs-induced WRKYs, LzWRKY75 is highly homologous with LrWRKY3, which positively regulates L. regale resistance to F. oxysporum [30]. LzWRKY26 was induced by TKs as well as by the SA, MeJA and F. oxysporum treatments. The promoter sequence of LzWRKY26 was characterized by cis-acting elements associated with stress containing the DRE core, MBS, ARE, STRE, LTR, the WUN-motif, and the MYC binding site and hormone-related elements, including the ABA, GA, SA, and MeJA response elements. These results suggest that LzWRKY26 might play a crucial role in TKs-induced resilience to Fusarium wilt via the SA and JA defense pathways, but functional analyses still need to be conducted.

5. Conclusions

In this investigation, TlSMF2 was demonstrated to be an effective BCA against wilt disease caused by F. oxysporum and F. solani in Lanzhou lily. The defense mechanisms involved the growth inhibition of TlSMF2 and TKs secreted by TlSMF2 against the pathogens, and the resistance induction in Lanzhou lily by TKs. The TKs-induced resistance of Lanzhou lily to Fusarium wilt was notably associated with increased levels of SA and JA, elevated activities of chitinase and PAL, and the upregulated expression of LzWRKY75 and LzWRKY26. In brief, our results provide a potential BCA against soil-borne fungal diseases and present a better insight into the biocontrol mechanisms of TlSMF2.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae11060660/s1, Table S1: Cis-regulatory elements on the LzWRKY26 promoter sequence.

Author Contributions

Conceptualization, X.Z., X.S., J.L., Z.W. and X.C. (Xing Cao); formal analysis, Z.W., M.Z., H.L., T.L., W.Y., Y.W., L.J. and Y.Z.; funding acquisition, X.S., X.C. (Xing Cao), X.Z., Y.Z. and X.C. (Xiulan Chen); investigation, X.C. (Xing Cao), J.L., M.Z., Y.Z., D.H. and J.S.; methodology, X.C. (Xing Cao), J.L., G.W., P.Z. and Z.W.; resources, X.C. (Xiulan Chen), X.S., D.H. and J.S.; supervision, X.Z. and X.S.; writing—original draft, X.C. (Xing Cao) and J.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32371727); the Shandong Provincial Natural Science Foundation (ZR2022MC048); the Visiting Scholar Program for Teaching Staff of Shandong Provincial Undergraduate College; the State Key Laboratory of Microbial Technology Open Projects Fund (M2023-04); and the Doctoral Research Initiation Fund of Yantai University (JZ22B12).

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Cao, X.; Zhang, M.S.; Zhang, X.S.; Yu, S.C.; Zhao, P.B.; Hou, D.; Zhou, Y.R.; Song, X.Y.; Zhang, Y.Z. First report of Fusarium redolens causing root and bulb rot disease on lanzhou lily (Lilium davidii var. unicolor) in China. Plant Dis. 2020, 104, 583. [Google Scholar] [CrossRef] [Scilit]
  2. Bian, X.R.; Shi, G.Y.; Liang, Q.L.; Sun, H.Q.; Fan, S.F.; Chen, J.L. Isolation and identification of wilt disease pathogen from Lanzhou lily and its pathogenicity. J. Gansu Agric. Univ. 2016, 51, 58–64. (In Chinese) [Google Scholar]
  3. Straathof, T.P.; van Tuyl, J.M. Genetic variation in resistance to Fusarium oxysporum f. sp. lilii in the genus Lilium. Ann. Appl. Biol. 1994, 125, 61–72. [Google Scholar] [CrossRef] [Scilit]
  4. Lim, J.H.; Rhee, H.K.; Kim, Y.J.; Lim, K.B.; van Tuyl, J.M. Resistance to Fusarium oxysporum f.sp. lilii in Lilium. Acta Hort 2003, 620, 311–318. [Google Scholar] [CrossRef] [Scilit]
  5. LaMondia, J.A. Fusarium wilt of tobacco. Crop Prot. 2015, 73, 73–77. [Google Scholar] [CrossRef] [Scilit]
  6. Cianchetta, A.N.; Davis, R.M. Fusarium wilt of cotton: Management strategies. Crop Prot. 2015, 73, 40–44. [Google Scholar] [CrossRef] [Scilit]
  7. An, Z.H.; Huang, D.Y.; Shi, Y.X.; Li, B.J. Studies on Fungicides Controlling Lily Root Fusarium oxysporum f.sp. lilii. China Veg. 2010, 18, 23–26. (In Chinese) [Google Scholar]
  8. Tu, J.; Zhao, X.; Yang, Y.R.; Yi, Y.J.; Wang, H.Y.; Wei, B.Y.; Zeng, L.B. Two Bacillus spp. Strains Improve the Structure and Diversity of the Rhizosphere Soil Microbial Community of Lilium brownii var. viridulum. Microorganisms 2023, 11, 1229. [Google Scholar] [CrossRef] [Scilit]
  9. Zhang, S.; Lou, T.; Wu, S.; Liu, S.G.; Pan, H.; Yang, J.; Su, Y.F.; Hu, W.; Xiang, W.; Pan, S.Y.; et al. Bacillus velezensis GX1 and its potential for the control of lily bulb rot. Biol. Control 2024, 198, 105616. [Google Scholar] [CrossRef] [Scilit]
  10. Wang, C.C.; Ye, X.J.; Ng, T.B.; Zhang, W.J. Study on the Biocontrol Potential of Antifungal Peptides Produced by Bacillus velezensis against Fusarium solani That Infects the Passion Fruit Passiflora edulis. J. Agr. Food Chem. 2021, 69, 2051–2061. [Google Scholar] [CrossRef] [Scilit]
  11. Howell, C.R. Mechanisms employed by Trichoderma species in the biological control of plant diseases: The history and evolution of current concepts. Plant Dis. 2003, 87, 4–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Liu, Y.; Shi, A.Q.; Chen, Y.; Xu, Z.H.; Liu, Y.X.; Yao, Y.L.; Wang, Y.M.; Jia, B.L. Beneficial microorganisms: Regulating growth and defense for plant welfare. Plant Biotechnol. J. 2025, 23, 986–998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Innocenti, G.; Roberti, R.; Piattoni, F. Biocontrol ability of Trichoderma harzianum strain T22 against Fusarium wilt disease on water-stressed lettuce plants. BioControl 2015, 60, 573–581. [Google Scholar] [CrossRef] [Scilit]
  14. Sallam, N.M.A.; Eraky, A.M.I.; Sallam, A. Effect of Trichoderma spp. on Fusarium wilt disease of tomato. Mol. Biol. Rep. 2019, 46, 4463–4470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Zhao, P.B.; Ren, A.Z.; Dong, P.; Sheng, Y.S.; Chang, X.; Zhang, X.S. The antimicrobial peptaibol trichokonin IV promotes plant growth and induces systemic resistance against Botrytis cinerea infection in moth orchid. J. Phytopathol. 2018, 166, 346–354. [Google Scholar] [CrossRef] [Scilit]
  16. Guzmán-Guzmán, P.; Kumar, A.; de los Santos-Villalobos, S.; Parra-Cota, F.I.; Orozco-Mosqueda, M.d.C.; Fadiji, A.E.; Hyder, S.; Babalola, O.O.; Santoyo, G. Trichoderma Species: Our Best Fungal Allies in the Biocontrol of Plant Diseases—A Review. Plants 2023, 12, 432. [Google Scholar] [CrossRef] [Scilit]
  17. Lv, H.; Zhang, S.W.; Ma, N.; Boamah, S.; Xu, B.L. Trichoderma longibrachiatum (T6) Peptaibols Inhibiting the Monilia yunnanensis Growth and Inducing Pear Fruit Resistance in Its Infection. Antioxidants 2024, 13, 1517. [Google Scholar] [CrossRef] [Scilit]
  18. Song, X.Y.; Shen, Q.T.; Xie, S.T.; Chen, X.L.; Sun, C.Y.; Zhang, Y.Z. Broad-spectrum antimicrobial activity and high stability of trichokonins from Trichoderma koningii SMF2 against plant pathogens. FEMS Microbiol. Lett. 2006, 260, 119–125. [Google Scholar]
  19. Zhang, Y.Q.; Zhang, S.; Sun, M.L.; Su, H.N.; Li, H.Y.; Liu, K.; Zhang, Y.Z.; Chen, X.L.; Cao, H.Y.; Song, X.Y. Antibacterial activity of peptaibols from Trichoderma longibrachiatum SMF2 against gram-negative Xanthomonas oryzae pv. oryzae, the causal agent of bacterial leaf blight on rice. Front. Microbiol. 2022, 13, 1034779. [Google Scholar]
  20. Shi, M.; Chen, L.; Wang, X.W.; Zhang, T.; Zhao, P.B.; Song, X.Y. Antimicrobial peptaibols from Trichoderma pseudokoningii induce programmed cell death in plant fungal pathogens. Microbiology 2012, 158, 166–175. [Google Scholar] [CrossRef] [Scilit]
  21. Luo, Y.; Zhang, D.D.; Dong, X.W.; Zhao, P.B.; Chen, L.L.; Song, X.Y.; Chen, X.L.; Shi, M.; Zhang, Y.Z. Antimicrobial peptaibols induce defense responses and systemic resistance in tobacco against tobacco mosaic virus. FEMS Microbiol. Lett. 2010, 313, 120–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Li, H.Y.; Luo, Y.; Zhang, X.S.; Shi, W.L.; Gong, Z.T.; Shi, M.; Chen, L.L.; Chen, X.L.; Zhang, Y.Z.; Song, X.Y. Trichokonins from Trichoderma pseudokoningii SMF2 induce resistance against gram-negative Pectobacterium carotovorum subsp. carotovorum in Chinese cabbage. FEMS Microbiol. Lett. 2014, 354, 75–82. [Google Scholar] [PubMed]
  23. He, X.; Li, W.; Zhang, W.; Jin, X.; Shenkute, A.G.; Aynalem, T.; Xu, S.; Wang, W. Transcriptome Sequencing Analysis Provides Insights Into the Response to Fusarium oxysporum in Lilium pumilum. Evol. Bioinform. 2019, 15, 1176934319838818. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Chang, N.N.; Zheng, L.L.; Xu, Y.; Wang, C.; Li, H.; Wang, Y. Integrated transcriptomic and metabolomic analysis reveals the molecular profiles of dynamic variation in Lilium brownii var. viridulum suffering from bulb rot. Front Genet. 2024, 15, 1432997. [Google Scholar]
  25. Di, X.T.; Takken, F.L.; Tintor, N. How Phytohormones Shape Interactions between Plants and the Soil-Borne Fungus Fusarium oxysporum. Front. Plant Sci. 2016, 7, 170. [Google Scholar] [CrossRef] [Scilit]
  26. Roychowdhury, R.; Hada, A.; Biswas, S.; Mishra, S.; Prusty, M.R.; Das, S.P.; Ray, S.; Kumar, A.; Sarker, U. Jasmonic acid (JA) in plant immune response: Unravelling complex molecular mechanisms and networking of defence signalling against pathogens. J. Plant Growth Regul. 2025, 44, 89–114. [Google Scholar] [CrossRef] [Scilit]
  27. Tian, H.N.; Xu, L.; Li, X.; Zhang, Y.L. Salicylic acid: The roles in plant immunity and crosstalk with other hormones. J. Integr. Plant Biol. 2024, 67, 773–785. [Google Scholar] [CrossRef] [Scilit]
  28. Miao, W.H.; Ge, L.J.; Wang, Y.A.; Li, S.; Sun, D.J.; Liu, Y.; Guan, Z.Y.; Chen, S.M.; Fang, W.M.; Chen, F.D.; et al. Overexpression of CmWRKY8-1–VP64 Fusion Protein Reduces Resistance in Response to Fusarium oxysporum by Modulating the Salicylic Acid Signaling Pathway in Chrysanthemum morifolium. Int. J. Mol. Sci. 2023, 24, 3499. [Google Scholar] [CrossRef] [Scilit]
  29. Zhang, Z.; Jiang, C.Y.; Cui, C.; Su, K.; Lin, H.; Zhao, Y.H.; Guo, Y.S. VvWRKY5 enhances white rot resistance in grape by promoting the jasmonic acid pathway. Hortic. Res. 2023, 10, uhad172. [Google Scholar] [CrossRef] [Scilit]
  30. Wang, Z.; Deng, J.; Liang, T.T.; Su, L.L.; Zheng, L.L.; Chen, H.J.; Liu, D.Q. Lilium regale Wilson WRKY3 modulates an antimicrobial peptide gene, LrDef1, during response to Fusarium oxysporum. BMC Plant Biol. 2022, 22, 257. [Google Scholar] [CrossRef] [Scilit]
  31. Li, S.; Hai, J.; Wang, Z.; Deng, J.; Liang, T.T.; Su, L.L.; Liu, D.Q. Lilium regale Wilson WRKY2 Regulates Chitinase Gene Expression During the Response to the Root Rot Pathogen Fusarium oxysporum. Front. Plant Sci. 2021, 12, 741463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Vaghela, B.; Vashi, R.; Rajput, K.; Joshi, R. Plant chitinases and their role in plant defense: A comprehensive review. Enzym. Microb. Technol. 2022, 159, 110055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Zhao, L.; Liu, Y.S.; Wang, M.; Xiang, L.; Wang, H.Y.; Chen, X.S.; Jiang, H.; Yin, C.M.; Mao, Z.Q. MdWRKY20-MdPR1 module mediates resistance of apple to Fusarium solani. Fruit. Res. 2025, 5, e001. [Google Scholar] [CrossRef] [Scilit]
  34. Hu, X.; Puri, K.D.; Gurung, S.; Klosterman, S.J.; Wallis, C.M.; Britton, M.; Durbin-Johnson, B.; Phinney, B.; Salemi, M.; Short, D.P.G.; et al. Proteome and metabolome analyses reveal differential responses in tomato-Verticillium dahliae-interactions. J. Proteom. 2019, 207, 103449. [Google Scholar] [CrossRef] [Scilit]
  35. Wang, L.J.; Guo, D.Z.; Zhao, G.D.; Wang, J.Y.; Zhang, S.X.; Wang, C.; Guo, X.Q. Group IIc WRKY transcription factors regulate cotton resistance to Fusarium oxysporum by promoting GhMKK2-mediated flavonoid biosynthesis. New Phytol. 2022, 236, 249–265. [Google Scholar] [CrossRef] [Scilit]
  36. Deng, J.; Wang, Z.E.; Li, W.Y.; Chen, X.H.; Liu, D.Q. WRKY11 up-regulated dirigent expression to enhance lignin/lignans accumulation in Lilium regale Wilson during response to Fusarium wilt. J. Integr. Agric. 2024, 23, 2703–2722. [Google Scholar] [CrossRef] [Scilit]
  37. Liu, D.M.; He, J.; Li, Q.; Zhang, X.; Wang, Y.S.; Sun, Q.G.; Wang, W.H.; Zhang, M.L.; Wang, Y.L.; Xu, H.S.; et al. A WRKY transcription factor confers broad-spectrum resistance to biotic stresses and yield stability in rice. Proc. Natl. Acad. Sci. USA 2025, 122, e2411164122. [Google Scholar] [CrossRef] [Scilit]
  38. Wang, R.; Wang, G.L.; Ning, Y. PALs: Emerging Key Players in Broad-Spectrum Disease Resistance. Trends Plant Sci. 2019, 24, 785–787. [Google Scholar] [CrossRef] [Scilit]
  39. He, T.T.; Shi, G.Y.; Su, G.L.; Yang, H.Y.; Li, M.Q.; Li, T.X. Function of allyl isothiocyanate esters in the control of Lanzhou lily wilt disease. J. Gansu Agric. Univ. 2024, 5, 93–101. (In Chinese) [Google Scholar]
  40. Cao, X.; Sui, J.J.; Li, H.Y.; Yue, W.X.; Liu, T.; Hou, D.; Liang, J.H.; Wu, Z. Enhancing heat stress tolerance in Lanzhou lily (Lilium davidii var. unicolor) with Trichokonins isolated from Trichoderma longibrachiatum SMF2. Front. Plant Sci. 2023, 14, 1182977. [Google Scholar]
  41. Liu, J.F.; Ding, J.; Yuan, B.F.; Feng, Y.Q. Magnetic solid phase extraction coupled with in situ derivatization for the highly sensitive determination of acidic phytohormones in rice leaves by UPLC-MS/MS. Analyst 2014, 139, 5605–5613. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Cao, X.; Ding, L.P.; Liang, J.H.; Zhou, Y.R.; Chen, X.L.; Li, H.Y.; Liu, T.; Yue, W.X.; Sui, J.J.; Jiang, L.B.; et al. LzSCL9, a Novel GRAS Transcription Factor in Lanzhou Lily (Lilium davidii var. unicolor), Participates in Regulation of Trichokonins-Primed Heat Stress Tolerance. Plants 2024, 13, 2330. [Google Scholar] [PubMed]
  43. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Xu, S.j.; Chen, R.Z.; Zhang, X.Q.; Wu, Y.F.; Yang, L.Y.; Sun, Z.Y.; Zhu, Z.T.; Song, A.P.; Wu, Z.; Li, T.; et al. The evolutionary tale of lilies: Giant genomes derived from transposon insertions and polyploidization. Innovation 2024, 5, 100726. [Google Scholar] [CrossRef] [Scilit]
  45. Li, Y.Y.; Wang, Y.J.; Xie, Z.K.; Wang, R.Y.; Qiu, Y.; Pan, H.Q.; Hu, J.C. First Report of Lily Blight and Wilt Caused by Fusarium tricinctum in China. Plant Dis. 2013, 97, 993. [Google Scholar] [CrossRef] [Scilit]
  46. Gao, J.L.; Sun, P.N.; Liang, J.H.; Yang, F.P.; Sun, J.G.; Wang, J.; Zhang, X.H.; Du, Y.P. First Report of Fusarium Wilt on lily (Lilium ‘Tresor’) Caused by Fusarium armeniacum in Jiangsu Province, China. Plant Dis. 2024, 108, 790. [Google Scholar] [CrossRef] [Scilit]
  47. Li, C.; Li, J.J.; Xue, C.S. Occurence of lily wilt and its control. Acta Phytophylacica Sin. 1994, 21, 135–139. (In Chinese) [Google Scholar]
  48. Xu, S.J.; Jing, Z.Q.; Guo, Z.J.; Sun, Q. First Report of Root and Bulb Rot Caused by Rhizoctonia solani AG-6 on Lanzhou Lily (Lilium davidii var. unicolor) in China. Plant Dis. 2024, 108, 2218. [Google Scholar] [CrossRef] [Scilit]
  49. Khan, M.S.; Gao, J.L.; Chen, X.Q.; Zhang, M.F.; Yang, F.P.; Du, Y.P.; Moe, T.S.; Munir, I.; Xue, J.; Zhang, X.H. The Endophytic Bacteria Bacillus velezensis Lle-9, Isolated from Lilium leucanthum, Harbors Antifungal Activity and Plant Growth-Promoting Effects. J. Microbiol. Biotechnol. 2020, 30, 668–680. [Google Scholar] [CrossRef] [Scilit]
  50. Erazo, J.G.; Palacios, S.A.; Pastor, N.; Giordano, F.D.; Rovera, M.; Reynoso, M.M.; Venisse, J.S.; Torres, A.M. Biocontrol mechanisms of Trichoderma harzianum item 3636 against peanut brown root rot caused by Fusarium solani rc 386. Biol. Control 2021, 164, 104774. [Google Scholar] [CrossRef] [Scilit]
  51. Chen, Y.F.; Wei, Y.Z.; Cai, B.Y.; Zhou, D.B.; Qi, D.F.; Zhang, M.Y.; Zhao, Y.K.; Li, K.; Wedge, D.E.; Pan, Z.Q.; et al. Discovery of Niphimycin C from Streptomyces yongxingensis sp. nov. as a Promising Agrochemical Fungicide for Controlling Banana Fusarium Wilt by Destroying the Mitochondrial Structure and Function. J. Agric. Food Chem. 2022, 70, 12784–12795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Asad, S.A. Mechanisms of action and biocontrol potential of Trichoderma against fungal plant diseases—A review. Ecol Complex. 2022, 49, 100978. [Google Scholar] [CrossRef] [Scilit]
  53. Yao, X.; Guo, H.L.; Zhang, K.X.; Zhao, M.Y.; Ruan, J.J.; Chen, J. Trichoderma and its role in biological control of plant fungal and nematode disease. Front. Microbiol. 2023, 14, 1160551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Dutta, P.; Mahanta, M.; Singh, S.B.; Thakuria, D.; Deb, L.; Kumari, A.; Upamanya, G.K.; Boruah, S.; Dey, U.; Mishra, A.K.; et al. Molecular interaction between plants and Trichoderma species against soil-borne plant pathogens. Front. Plant Sci. 2023, 14, 1145715. [Google Scholar] [CrossRef] [Scilit]
  55. Vinale, F.; Marra, R.; Scala, F.; Ghisalberti, E.L.; Lorito, M.; Sivasithamparam, K. Major Secondary Metabolites Produced by Two Commercial Trichoderma Strains Active against Different Phytopathogens. Lett. Appl. Microbiol. 2006, 43, 143–148. [Google Scholar] [CrossRef] [Scilit]
  56. Woo, S.L.; Scala, F.; Ruocco, M.; Lorito, M. The molecular biology of the interactions between Trichoderma spp., Phytopathogenic Fungi, and Plants. Phytopathology 2006, 96, 181–185. [Google Scholar] [CrossRef] [Scilit]
  57. Woo, S.L.; Ruocco, M.; Vinale, F.; Nigro, M.; Marra, R.; Lombardi, N.; Pascale, A.; Lanzuise, S.; Manganiello, G.; Lorito, M. Trichoderma-based products and their widespread use in agriculture. Open Mycol. J. 2014, 8, 71–126. [Google Scholar] [CrossRef] [Scilit]
  58. La Spada, F.; Stracquadanio, C.; Riolo, M.; Pane, A.; Cacciola, S.O. Trichoderma Counteracts the Challenge of Phytophthora nicotianae Infections on Tomato by Modulating Plant Defense Mechanisms and the Expression of Crinkler, Necrosis-Inducing Phytophthora Protein 1, and Cellulose-Binding Elicitor Lectin Pathogenic Effectors. Front. Plant Sci. 2020, 11, 583539. [Google Scholar]
  59. Stracquadanio, C.; Luz, C.; La Spada, F.; Meca, G.; Cacciola, S.O. Inhibition of Mycotoxigenic Fungi in Different Vegetable Matrices by Extracts of Trichoderma Species. J. Fungi 2021, 7, 445. [Google Scholar] [CrossRef] [Scilit]
  60. Tian, L.; Zhu, X.Y.; Guo, Y.Q.; Zhou, Q.J.; Wang, L.L.; Li, W.L. Antagonism of rhizosphere Trichoderma brevicompactum DTN19 against the pathogenic fungi causing corm rot in saffron (Crocus sativus L.) in vitro. Front. Microbiol. 2024, 15, 1454670. [Google Scholar] [CrossRef] [Scilit]
  61. Boakye, T.A.; Li, H.X.; Osei, R.; Boamah, S.; Min, Z.; Ni, C.H.; Wu, J.; Shi, M.M.; Qiao, W.Q. Antagonistic Effect of Trichoderma longibrachiatum (TL6 and TL13) on Fusarium solani and Fusarium avenaceum Causing Root Rot on Snow Pea Plants. J. Fungi 2022, 8, 1148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Tamandegani, P.R.; Marik, T.; Zafari, D.; Balázs, D.; Vágvölgyi, C.; Szekeres, A.; Kredics, L. Changes in Peptaibol Production of Trichoderma Species during In Vitro Antagonistic Interactions with Fungal Plant Pathogens. Biomolecules 2020, 10, 730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Verhage, A.; van Wees, S.C.; Pieterse, C.M. Plant immunity: It’s the hormones talking, but what do they say? Plant Physiol. 2010, 154, 536–540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Zhang, Y.L.; Li, X. Salicylic acid: Biosynthesis, perception, and contributions to plant immunity. Curr. Opin. Plant Biol. 2019, 50, 29–36. [Google Scholar] [CrossRef] [Scilit]
  65. Fang, X.; Xie, Y.; Yuan, Y.; Long, Q.; Zhang, L.; Abid, G.; Zhang, W.Q. The role of salicylic acid in plant defense responses against biotic stresses. Plant Horm. 2025, 1, e004. [Google Scholar] [CrossRef] [Scilit]
  66. Wang, K.T.; Li, C.H.; Cao, S.F.; Lei, C.Y.; Ji, N.N.; Zou, Y.Y.; Tan, M.L.; Wang, J.S.; Zheng, Y.H.; Gao, H.Y. VOZ-dependent priming of salicylic acid-dependent defense against Rhizopus stolonifer by β-aminobutyric acid requires the TCP protein TCP2 in peach fruit. Plant J. 2025, 121, e17176. [Google Scholar] [CrossRef] [Scilit]
  67. Shine, M.B.; Yang, J.W.; El-Habbak, M.; Nagyabhyru, P.; Fu, D.Q.; Navarre, D.; Ghabrial, S.; Kachroo, P.; Kachroo, A. Cooperative functioning between phenylalanine ammonia lyase and isochorismate synthase activities contributes to salicylic acid biosynthesis in soybean. New Phytol. 2016, 212, 627–636. [Google Scholar] [CrossRef] [Scilit]
  68. Cass, C.L.; Peraldi, A.; Dowd, P.F.; Mottiar, Y.; Santoro, N.; Karlen, S.D.; Bukhman, Y.V.; Foster, C.E.; Thrower, N.; Bruno, L.C.; et al. Effects of Phenylalanine Ammonia Lyase (PAL) knockdown on cell wall composition, biomass digestibility, and biotic and abiotic stress responses in Brachypodium. J. Exp. Bot. 2015, 66, 4317–4335. [Google Scholar] [CrossRef] [Scilit]
  69. Fan, W.H.; Dong, X.N. In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. Plant Cell 2002, 14, 1377–1389. [Google Scholar] [CrossRef] [Scilit]
  70. Ding, Y.L.; Sun, T.J.; Ao, K.; Peng, Y.J.; Zhang, Y.X.; Li, X.; Zhang, Y.L. Opposite Roles of Salicylic Acid Receptors NPR1 and NPR3/NPR4 in Transcriptional Regulation of Plant Immunity. Cell 2018, 173, 1454–1467.e15. [Google Scholar] [CrossRef] [Scilit]
  71. Hernandez-Escribano, L.; Morales Clemente, M.T.; Fariña-Flores, D.; Raposo, R.A. delayed response in phytohormone signaling and production contributes to pine susceptibility to Fusarium circinatum. BMC Plant Biol. 2024, 24, 727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Shi, M.T.; Zhang, T.J.; Fang, Y.; Pan, C.P.; Fu, H.Y.; Gao, S.J.; Wang, J.D. Nano-selenium enhances sugarcane resistance to Xanthomonas albilineans infection and improvement of juice quality. Ecotoxicol. Environ. Saf. 2023, 254, 114759. [Google Scholar] [CrossRef] [Scilit]
  73. Ghorbel, M.; Brini, F.; Sharma, A.; Landi, M. Role of jasmonic acid in plants: The molecular point of view. Plant Cell Rep. 2021, 40, 1471–1494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  74. Zhu, J.; Wang, W.S.; Yan, D.W.; Hong, L.W.; Li, T.T.; Gao, X.; Yang, Y.H.; Ren, F.; Lu, Y.T.; Yuan, T.T. CK2 promotes jasmonic acid signaling response by phosphorylating MYC2 in Arabidopsis. Nucleic Acids Res. 2023, 51, 619–630. [Google Scholar] [CrossRef] [Scilit]
  75. Zhao, P.Z.; Yang, H.; Sun, Y.W.; Zhang, J.Y.; Gao, K.X.; Wu, J.B.; Zhu, C.R.; Yin, C.C.; Chen, X.Y.; Liu, Q.; et al. Targeted MYC2 stabilization confers citrus Huanglongbing resistance. Science 2025, 388, 191–198. [Google Scholar] [CrossRef] [Scilit]
  76. Zhang, H.; Zhang, Q.; Zhai, H.; Gao, S.P.; Yang, L.; Wang, Z.; Xu, Y.T.; Huo, J.X.; Ren, Z.T.; Zhao, N.; et al. IbBBX24 Promotes the Jasmonic Acid Pathway and Enhances Fusarium Wilt Resistance in Sweet Potato. Plant Cell 2020, 32, 1102–1123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Du, W.T.; Chai, N.; Sun, Z.Q.; Wang, H.R.; Liu, S.X.; Sui, S.Z.; Luo, L.; Liu, D.F. Full-Length Transcriptome Characterization and Functional Analysis of Pathogenesis-Related Proteins in Lilium Oriental Hybrid ‘Sorbonne’ Infected with Botrytis elliptica. Int. J. Mol. Sci. 2022, 24, 425. [Google Scholar] [CrossRef] [Scilit]
  78. Wang, W.J.; Cao, H.H.; Wang, J.H.; Zhang, H.B. Recent advances in functional assays of WRKY transcription factors in plant immunity against pathogens. Front. Plant Sci. 2025, 15, 1517595. [Google Scholar] [CrossRef] [Scilit]
  79. Yang, L.; Fang, S.Y.; Liu, L.; Zhao, L.R.; Chen, W.Q.; Li, X.; Xu, Z.Y.; Chen, S.D.; Wang, H.P.; Yu, D.Q. WRKY transcription factors: Hubs for regulating plant growth and stress responses. J. Integr. Plant Biol. 2025, 67, 488–509. [Google Scholar] [CrossRef] [Scilit]
  80. Li, M.Y.; Zhao, S.Q.; Yang, J.Y.; Ren, Y.; Su, J.; Zhao, J.J.; Ren, X.P.; Wang, C.Y.; Chen, S.S.; Yu, X.M.; et al. Exogenous expression of barley HvWRKY6 in wheat improves broad-spectrum resistance to leaf rust, Fusarium crown rot, and sharp eyespot. Int. J. Biol. Macromol. 2022, 218, 1002–1012. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Antagonistic effects of TlSMF2 on F. oxysporum and F. solani colony growth after 6.5 days in the confrontation culture assay. (A) Front colony of F. oxysporum cultured for 6.5 days. (B,C) Front and reverse colonies of TlSMF2 and F. oxysporum in the confrontation culture. (D) Front colony of F. solani cultured for 6.5 days. (E,F) Front and reverse colonies of TlSMF2 and F. solani in the confrontation culture.
Figure 1. Antagonistic effects of TlSMF2 on F. oxysporum and F. solani colony growth after 6.5 days in the confrontation culture assay. (A) Front colony of F. oxysporum cultured for 6.5 days. (B,C) Front and reverse colonies of TlSMF2 and F. oxysporum in the confrontation culture. (D) Front colony of F. solani cultured for 6.5 days. (E,F) Front and reverse colonies of TlSMF2 and F. solani in the confrontation culture.
Horticulturae 11 00660 g001
Figure 2. Indoor toxicity effect of the three fungicides on the mycelial growth of F. oxysporum (A) and F. solani (B). Concentrations of hymexazol are 20, 40, 80, 160, and 320 mg/L from left to right. Concentrations of matrine are 2.5, 5, 10, 20, and 40 mg/L from left to right. Concentrations of trichokonins are 5, 10, 20, 40, and 80 mg/L from left to right.
Figure 2. Indoor toxicity effect of the three fungicides on the mycelial growth of F. oxysporum (A) and F. solani (B). Concentrations of hymexazol are 20, 40, 80, 160, and 320 mg/L from left to right. Concentrations of matrine are 2.5, 5, 10, 20, and 40 mg/L from left to right. Concentrations of trichokonins are 5, 10, 20, 40, and 80 mg/L from left to right.
Horticulturae 11 00660 g002
Figure 3. Biocontrol effects of TlSMF2 on F. oxysporum and F. solani DIs in Lanzhou lily plants. Means with different lowercase letters indicate significant differences at p < 0.05 according to the Kruskal–Wallis and Dunn tests.
Figure 3. Biocontrol effects of TlSMF2 on F. oxysporum and F. solani DIs in Lanzhou lily plants. Means with different lowercase letters indicate significant differences at p < 0.05 according to the Kruskal–Wallis and Dunn tests.
Horticulturae 11 00660 g003
Figure 4. GO and KEGG enrichment analyses of DEGs in response to TKs treatment. (A,B) represent the GO enrichment of DEGs following the 12 h and 24 h TKs treatments, respectively. (C,D) represent the KEGG enrichment of DEGs following the 12 h and 24 h TKs treatments, respectively.
Figure 4. GO and KEGG enrichment analyses of DEGs in response to TKs treatment. (A,B) represent the GO enrichment of DEGs following the 12 h and 24 h TKs treatments, respectively. (C,D) represent the KEGG enrichment of DEGs following the 12 h and 24 h TKs treatments, respectively.
Horticulturae 11 00660 g004
Figure 5. Effects of TKs on the contents of JA and SA and the relative expression of related genes in Lanzhou lily leaves. (A) SA content in Lanzhou lily plants with or without TKs treatment at 0, 12, and 24 h. (B) LzICS1, LzNPR1, and LzPR1 expression in leaves of Lanzhou lilies treated with TKs for 24 h. (C) JA content in Lanzhou lily plants with or without TKs treatment at 0, 12, and 24 h. (D) LzJAR1, LzAOS, and LzMYC2 expression in leaves of Lanzhou lilies treated with TKs for 12 h. * indicates statistically significant difference (p < 0.05).
Figure 5. Effects of TKs on the contents of JA and SA and the relative expression of related genes in Lanzhou lily leaves. (A) SA content in Lanzhou lily plants with or without TKs treatment at 0, 12, and 24 h. (B) LzICS1, LzNPR1, and LzPR1 expression in leaves of Lanzhou lilies treated with TKs for 24 h. (C) JA content in Lanzhou lily plants with or without TKs treatment at 0, 12, and 24 h. (D) LzJAR1, LzAOS, and LzMYC2 expression in leaves of Lanzhou lilies treated with TKs for 12 h. * indicates statistically significant difference (p < 0.05).
Horticulturae 11 00660 g005
Figure 6. Effects of TKs on chitinase and PAL activities and the relative expression of their encoding genes in Lanzhou lily leaves. (A) Chitinase activity in Lanzhou lily plants with or without TKs treatment at 0, 12, and 24 h. (B) LzChi2 expression in leaves of Lanzhou lilies treated with TKs for 12 h. (C) PAL activity in Lanzhou lily plants with or without TKs treatment at 0, 12, and 24 h. (D) LzPAL2 expression in leaves of Lanzhou lilies treated with TKs for 24 h. * indicates statistically significant difference (p < 0.05).
Figure 6. Effects of TKs on chitinase and PAL activities and the relative expression of their encoding genes in Lanzhou lily leaves. (A) Chitinase activity in Lanzhou lily plants with or without TKs treatment at 0, 12, and 24 h. (B) LzChi2 expression in leaves of Lanzhou lilies treated with TKs for 12 h. (C) PAL activity in Lanzhou lily plants with or without TKs treatment at 0, 12, and 24 h. (D) LzPAL2 expression in leaves of Lanzhou lilies treated with TKs for 24 h. * indicates statistically significant difference (p < 0.05).
Horticulturae 11 00660 g006
Figure 7. The expression patterns of several WRKYs and the analysis of cis-elements in the LzWRKY26 promoter region. (A) A heat map of up-regulated-WRKYs responding to TKs treatment based on the transcriptome data. (B) LzWRKY75 expression in response to TKs treatment for 24 h and LzWRKY26 expression in response to the TKs, SA, MeJA, and F. oxysporum treatments for 24 h. (C) The hormone- and stress-responsive cis-regulatory elements in the LzWRKY26 promoter sequence.
Figure 7. The expression patterns of several WRKYs and the analysis of cis-elements in the LzWRKY26 promoter region. (A) A heat map of up-regulated-WRKYs responding to TKs treatment based on the transcriptome data. (B) LzWRKY75 expression in response to TKs treatment for 24 h and LzWRKY26 expression in response to the TKs, SA, MeJA, and F. oxysporum treatments for 24 h. (C) The hormone- and stress-responsive cis-regulatory elements in the LzWRKY26 promoter sequence.
Horticulturae 11 00660 g007
Table 1. Concentrations of the three fungicides used in this article.
Table 1. Concentrations of the three fungicides used in this article.
FungicidesConcentrations (mg/L)
TKs5, 10, 20, 40, 80
matrine2.5, 5, 10, 20, 40
hymexazol20, 40, 80, 160, 320
Table 2. Disease grading criteria for Lanzhou lily Fusarium wilt.
Table 2. Disease grading criteria for Lanzhou lily Fusarium wilt.
Disease LevelsLeaf-Withering Degree
0<10%
110–20%
221–30%
331–50%
451–70%
571–100%
Table 3. The primers used for qPCR.
Table 3. The primers used for qPCR.
PrimersSequences (5′-3′)
LzICS1-FCTGCCGGGGTGTTACTTCTC
LzICS1-RTCCAGTCCTGCAAGCCAAA
LzNPR1-FCTTGATAAGTTCTTGGAGGACGAT
LzNPR1-RGATGTAGACGATGAGGACGATGAT
LzPR1-FGCCACTACACGCAGGTTGTG
LzPR1-RGCCTCTCGCCGACGTTATTC
LzJAR1-FCGTCGGAAGGATGGATTGGT
LzJAR1-RTCAAACCAACTGGCTCTGCT
LzAOS-FGCCTCCAGTGTGTCGGACTTC
LzAOS-RGGCAGCGGGAATGTGTGTAGA
LzMYC2-FCACTCCTTGGTGATGCCATCGC
LzMYC2-RCATTGCCCATGCCGCCGTTC
LzChi2-FTTTCCAGTTCTACGCCTATGCTG
LzChi2-RCGGTACTTGCTGAAGTGAAGCTC
LzPAL2-FCCTGTCACCAACCACGTTCAGAG
LzPAL2-RCACTGCCTCCGCTGTCTTCCT
LzWRKY75-FGATCCTCCGAAACCAATGCCA
LzWRKY75-RCAGCGATAGCCGTCGTCAAG
LzWRKY26-FAATACATCAGCAGCATAGG
LzWRKY26-RCTCCACCTTCTTCTTCATC
Table 4. Inhibitory effects of the three fungicides on the mycelial growth and spore germination of F. oxysporum and F. solani.
Table 4. Inhibitory effects of the three fungicides on the mycelial growth and spore germination of F. oxysporum and F. solani.
PathogensFungicidesMycelial GrowthSpore Germination
Regression Equation (Y=)Correlation Coefficient (r)EC50
(mg·L−1)
Regression Equation (Y=)Correlation Coefficient (r)EC50
(mg·L−1)
F. oxysporum99% hymexazol WP1.740x − 2.6020.98531.3 a1.622x − 3.1590.98588.5 a
0.3% matrine EC2.260x − 1.6670.8645.5 b3.342x − 3.0940.9648.4 c
0.5% trichokonins SL1.559x − 2.3320.94331.3 a1.370x − 2.0710.99332.5 b
F. solani99% hymexazol WP1.792x − 4.3360.941263.0 a2.053x − 3.1680.99834.9 a
0.3% matrine EC2.870x − 1.1000.9752.4 c2.913x − 1.5440.9723.4 c
0.5% trichokonins SL1.052x − 1.8500.98057.3 b1.907x − 2.1000.99812.6 b
Note: WP, wettable powder; EC, emulsifiable concentrate; SL, soluble concentrate. Means with different lowercase letters indicate significant differences at p < 0.05 according to the Kruskal–Wallis and Dunn tests.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cao, X.; Liang, J.; Wu, Z.; Zhang, M.; Li, H.; Liu, T.; Yue, W.; Wang, Y.; Jiang, L.; Wang, G.; et al. Biocontrol Mechanisms of Trichoderma longibrachiatum SMF2 Against Lanzhou Lily Wilt Disease Caused by Fusarium oxysporum and Fusarium solani. Horticulturae 2025, 11, 660. https://doi.org/10.3390/horticulturae11060660

AMA Style

Cao X, Liang J, Wu Z, Zhang M, Li H, Liu T, Yue W, Wang Y, Jiang L, Wang G, et al. Biocontrol Mechanisms of Trichoderma longibrachiatum SMF2 Against Lanzhou Lily Wilt Disease Caused by Fusarium oxysporum and Fusarium solani. Horticulturae. 2025; 11(6):660. https://doi.org/10.3390/horticulturae11060660

Chicago/Turabian Style

Cao, Xing, Jiahui Liang, Ze Wu, Mingshun Zhang, Haiyan Li, Tao Liu, Wenxiu Yue, Yanan Wang, Liangbao Jiang, Guiqing Wang, and et al. 2025. "Biocontrol Mechanisms of Trichoderma longibrachiatum SMF2 Against Lanzhou Lily Wilt Disease Caused by Fusarium oxysporum and Fusarium solani" Horticulturae 11, no. 6: 660. https://doi.org/10.3390/horticulturae11060660

APA Style

Cao, X., Liang, J., Wu, Z., Zhang, M., Li, H., Liu, T., Yue, W., Wang, Y., Jiang, L., Wang, G., Zhao, P., Zhou, Y., Chen, X., Sui, J., Hou, D., Song, X., & Zhang, X. (2025). Biocontrol Mechanisms of Trichoderma longibrachiatum SMF2 Against Lanzhou Lily Wilt Disease Caused by Fusarium oxysporum and Fusarium solani. Horticulturae, 11(6), 660. https://doi.org/10.3390/horticulturae11060660

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop