Anti-Inflammatory Effects of Sword Bean (Canavalia gladiata) and Its Lacticaseibacillus paracasei SKH 003-Fermented Extracts in LPS-Stimulated RAW 264.7 Macrophages
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. Cell Viability Assay
2.4. Nitric Oxide Measurement
2.5. Real-Time PCR
2.6. Enzyme-Linked Immunosorbent Assay (ELISA)
2.7. Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. Cell Viability and Biocompatibility
3.2. Inhibition of NO and PGE2 Secretion
3.3. Downregulation of iNOS and COX-2 Expression
3.4. Downregulation of Pro-Inflammatory Cytokines and Chemokines
3.5. Attenuation of Pro-Inflammatory Mediator Secretion
3.6. Inhibition of NF-κB and MAPK Signaling Pathways
4. Discussion
5. Conclusions
6. Patents
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Hotamisligil, G.S. Inflammation and metabolic disorders. Nature 2006, 444, 860–867. [Google Scholar] [CrossRef] [Scilit]
- Golia, E.; Limongelli, G.; Natale, F.; Fimiani, F.; Maddaloni, V.; Pariggiano, I.; Bianchi, R.; Crisci, M.; D’Acierno, L.; Giordano, R.; et al. Inflammation and cardiovascular disease: From pathogenesis to therapeutic target. Curr. Atheroscler. Rep. 2014, 16, 435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Furman, D.; Campisi, J.; Verdin, E.; Carrera-Bastos, P.; Targ, S.; Franceschi, C.; Ferrucci, L.; Gilroy, D.W.; Fasano, A.; Miller, G.W.; et al. Chronic inflammation in the etiology of disease across the life span. Nat. Med. 2019, 25, 1822–1832. [Google Scholar] [CrossRef] [Scilit]
- Pahwa, R.; Goyal, A.; Jialal, I. Chronic Inflammation. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2024. [Google Scholar]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [Scilit]
- Lawrence, T. The nuclear factor NF-κB pathway in inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mogensen, T.H. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 2009, 22, 240–273. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guha, M.; Mackman, N. LPS induction of gene expression in macrophages. Cell. Signal. 2001, 13, 85–94. [Google Scholar] [CrossRef] [Scilit]
- Murray, P.J.; Wynn, T.A. Protective and pathogenic functions of macrophage subsets. Nat. Rev. Immunol. 2011, 11, 723–737. [Google Scholar] [CrossRef] [Scilit]
- Medzhitov, R. Origin and physiological roles of inflammation. Nature 2008, 454, 428–435. [Google Scholar] [CrossRef] [Scilit]
- Domper Arnal, M.J.; Hijos-Mallada, G.; Lanas, A. Gastrointestinal and cardiovascular adverse events associated with NSAIDs. Expert Opin. Drug Saf. 2022, 21, 373–384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jang, Y.H.; Choi, E.-Y.; Lee, H.; Woo, J.; Park, S.; Noh, Y.; Jeon, J.-Y.; Yoo, E.-Y.; Shin, J.-Y.; Lee, Y.W. Long-Term Use of Oral Corticosteroids and Safety Outcomes for Patients with Atopic Dermatitis. JAMA Netw. Open. 2024, 7, e2423563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Newman, D.J.; Cragg, G.M. Natural products as sources of new drugs from 1981 to 2014. J. Nat. Prod. 2016, 79, 629–661. [Google Scholar] [CrossRef] [Scilit]
- Ben Ammar, R. Potential Effects of Plant-Derived Bioactive Compounds on Cancer and Inflammation-Related Diseases: A Review of the Recent Research Findings. Molecules 2023, 28, 3669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, J.-Y.; Rhee, J.-K. Roasting and Cryogenic Grinding Enhance the Antioxidant Property of Sword Beans (Canavalia gladiata). J. Microbiol. Biotechnol. 2020, 30, 1706–1719. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, H.-J.; Park, J.U.; Guo, R.H.; Kang, B.Y.; Park, I.-K.; Kim, Y.R. Anti-Inflammatory Effects of Canavalia gladiata in Macrophage Cells and DSS-Induced Colitis Mouse Model. Am. J. Chin. Med. 2019, 47, 1571–1588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hwang, K.-A.; Heo, W.; Hwang, H.-J.; Han, B.K.; Song, M.C.; Kim, Y.J. Anti-Inflammatory Effect of Immature Sword Bean Pod (Canavalia gladiata) in Lipopolysaccharide-Induced RAW264.7 Cells. J. Med. Food 2020, 23, 1183–1191. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Hong, J.; Wang, L.; Cai, C.; Mo, H.; Wang, J.; Fang, X.; Liao, Z. Effect of Lactic Acid Bacteria Fermentation on Plant-Based Products. Fermentation 2024, 10, 48. [Google Scholar]
- Marco, M.L.; Sanders, M.E.; Gänzle, M.; Arrieta, M.C.; Cotter, P.D.; De Vuyst, L.; Hill, C.; Holzapfel, W.; Lebeer, S.; Merenstein, D.; et al. The International Scientific Association for Probiotics and Prebiotics (ISAPP) consensus statement on fermented foods. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 196–208. [Google Scholar] [CrossRef] [Scilit]
- Şanlier, N.; Gökcen, B.B.; Sezgin, A.C. Health benefits of fermented foods. Crit. Rev. Food Sci. Nutr. 2019, 59, 506–527. [Google Scholar] [CrossRef] [Scilit]
- Bermudez-Brito, M.; Plaza-Díaz, J.; Muñoz-Quezada, S.; Gómez-Llorente, C.; Gil, A. Probiotic mechanisms of action. Ann. Nutr. Metab. 2012, 61, 160–174. [Google Scholar] [CrossRef] [Scilit]
- Weinberg, J.B. Nitric oxide synthase 2 and cyclooxygenase 2 interactions in inflammation. Immunol. Res. 2000, 22, 319–341. [Google Scholar] [CrossRef] [Scilit]
- Xie, Q.-W.; Nathan, C. The high-output nitric oxide pathway: Role and regulation. J. Leukoc. Biol. 1994, 56, 576–582. [Google Scholar] [CrossRef] [Scilit]
- Lee, A.K.; Sung, S.H.; Kim, Y.C.; Kim, S.G. Inhibition of lipopolysaccharide-inducible nitric oxide synthase, TNF-α and COX-2 expression by sauchinone effects on I-κBα phosphorylation, C/EBP and AP-1 activation. Br. J. Pharmacol. 2003, 139, 11–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.-K.; Kim, Y.; Na, K.-M.; Surh, Y.-J.; Kim, T.-Y. [6]-Gingerol prevents UVB-induced ROS production and COX-2 expression. Free Radic. Res. 2007, 41, 603–614. [Google Scholar] [CrossRef] [Scilit]
- Dinarello, C.A.; Donath, M.Y.; Mandrup-Poulsen, T. Role of IL-1β in type 2 diabetes. Curr. Opin. Endocrinol. Diabetes Obes. 2010, 17, 314–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, W.; Hodge, D.R.; Wang, L.; Yang, X.; Zhang, X.; Farrar, W.L. NF-κB activates IL-6 expression through cooperation with c-Jun and IL6-AP1 site, But is independent of its IL6-NFκB regulatory site in autocrine human multiple myeloma cells. Cancer Biol. Ther. 2004, 3, 1007–1017. [Google Scholar] [CrossRef] [Scilit]
- Arend, W.P.; Malyak, M.; Guthridge, C.J.; Gabay, C. Interleukin-1 receptor antagonist: Role in biology. Annu. Rev. Immunol. 1998, 16, 27–55. [Google Scholar] [CrossRef] [Scilit]
- Serhan, C.N.; Savill, J. Resolution of inflammation: The beginning programs the end. Nat. Immunol. 2005, 6, 1191–1197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gerszten, R.E.; Garcia-Zepeda, E.A.; Lim, Y.-C.; Yoshida, M.; Ding, H.A.; Gimbrone, M.A., Jr.; Luster, A.D.; Luscinskas, F.W.; Rosenzweig, A. MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium. Nature 1999, 398, 718–723. [Google Scholar] [CrossRef] [Scilit]
- Baldwin, A.S., Jr. The NF-κB and IκB proteins: New discoveries and insights. Annu. Rev. Immunol. 1996, 14, 649–681. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; May, M.J.; Kopp, E.B. NF-κB and Rel proteins: Evolutionarily Conserved Mediators of Immune Responses. Annu. Rev. Immunol. 1998, 16, 225–260. [Google Scholar] [CrossRef] [Scilit]
- Eferl, R.; Wagner, E.F. AP-1: A double-edged sword in tumorigenesis. Nat. Rev. Cancer 2003, 3, 859–868. [Google Scholar] [CrossRef] [Scilit]
- Dérijard, B.; Hibi, M.; Wu, I.-H.; Barrett, T.; Su, B.; Deng, T.; Karin, M.; Davis, R.J. JNK1: A protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 1994, 76, 1025–1037. [Google Scholar] [CrossRef] [Scilit]
- Chuang, Y.-C.; Cheng, M.-C.; Lee, C.-C.; Chiou, T.-Y. Effect of ethanol extract from Lactobacillus plantarum TWK10-fermented soymilk on wound healing in streptozotocin-induced diabetic rat. AMB Expr. 2019, 9, 163. [Google Scholar] [CrossRef] [Scilit]






| Target Gene | Primer Sequences (5′→3′) | GenBank Accession |
|---|---|---|
| IL-6 | F: CCTCTGGTCTTCTGGAGTACC | NM_001314054.1 |
| R: ACTCCTTCTGTGACTCCAGC | ||
| iNOS | F: AATGAGGTACTCAGCGTGCT | NM_001313922.1 |
| R: TCTTCCACCTGCTCCTCGCT | ||
| COX-2 | F: TGGACGAGGTTTTTCCACCAG | NM_011198.5 |
| R: CAAAGGCCTCCATTGACCAGA | ||
| TNF-α | F: ATGAGCACAGAAAGCATGA | NM_001278601.1 |
| R: AGTAGACAGAAGAGCGTGGT | ||
| IL-1β | F: CCTTCCAGGATGAGGACATGA | NM_008361.4 |
| R: TGAGTCACAGAGGATGGGCTC | ||
| IL-1Ra | F: GAAGATGTGCCTGTCCTGTGT | XM_021194071.1 |
| R: CGCTCAGGTCAGTGATGTTAA | ||
| MCP-1 | F: CCCAATGAGTAGGCTGGAGA | NM_011333.3 |
| R: TCTGGACCCATTCCTTCTTG | ||
| CXCL10 | F: GACGGTCCGCTGCAACTG | XM_021161764.2 |
| R: CTTCCCTATGGCCCTCATTCT | ||
| GAPDH | F: GTATTGGGCGCCTGGTCACC | NM_001411843.1 |
| R: CGCTCCTGGAAGATGGTGATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Kwon, G.T.; Kim, S.M.; Jung, J.I.; Park, C.Y.; Hwang, H.; Kang, I.-J. Anti-Inflammatory Effects of Sword Bean (Canavalia gladiata) and Its Lacticaseibacillus paracasei SKH 003-Fermented Extracts in LPS-Stimulated RAW 264.7 Macrophages. Fermentation 2026, 12, 234. https://doi.org/10.3390/fermentation12050234
Kwon GT, Kim SM, Jung JI, Park CY, Hwang H, Kang I-J. Anti-Inflammatory Effects of Sword Bean (Canavalia gladiata) and Its Lacticaseibacillus paracasei SKH 003-Fermented Extracts in LPS-Stimulated RAW 264.7 Macrophages. Fermentation. 2026; 12(5):234. https://doi.org/10.3390/fermentation12050234
Chicago/Turabian StyleKwon, Gyoo Taik, So Mi Kim, Jae In Jung, Cho Yeon Park, Hyeji Hwang, and Il-Jun Kang. 2026. "Anti-Inflammatory Effects of Sword Bean (Canavalia gladiata) and Its Lacticaseibacillus paracasei SKH 003-Fermented Extracts in LPS-Stimulated RAW 264.7 Macrophages" Fermentation 12, no. 5: 234. https://doi.org/10.3390/fermentation12050234
APA StyleKwon, G. T., Kim, S. M., Jung, J. I., Park, C. Y., Hwang, H., & Kang, I.-J. (2026). Anti-Inflammatory Effects of Sword Bean (Canavalia gladiata) and Its Lacticaseibacillus paracasei SKH 003-Fermented Extracts in LPS-Stimulated RAW 264.7 Macrophages. Fermentation, 12(5), 234. https://doi.org/10.3390/fermentation12050234

