Pleurotus ostreatus: Nutritional Enhancement and Antioxidant Activity Improvement Through Cultivation on Spent Mushroom Substrate and Roots of Leafy Vegetables
Abstract
1. Introduction
2. Materials and Methods
2.1. Mushroom Cultivation Process
2.2. Analytical Methods
2.2.1. Intra-Cellular Polysaccharide (IPS) Content and Profile
2.2.2. Total Lipid, Fatty Acid and Protein Determination
2.2.3. Total Phenolic Compounds, Total Flavonoid Content, Total Triterpene Content and Antioxidant Activity
2.3. Isolation and Recovery of Proteins and Polysaccharides from Mushroom Samples
2.4. In Vitro Digestion Protocol
2.5. Culturing THP-1 Cells
2.6. Quantification of Gene Expression
2.7. Statistical Analysis
3. Results and Discussion
3.1. The Effect of Substrate Composition on Mycelial Growth Rate and Mushroom Cultivation
3.2. Analysis of Nutritional Components in P. ostreatus
3.3. Quantification of Total Phenolic Compounds (TPC), Total Triterpene Content (Tr) and Antioxidant Activity
3.4. Total Flavonoid Content (TFC)
3.5. The Effect of Protein and Carbohydrate Extracts on Expression of Antioxidant Genes
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hamza, A.; Mandari, V.; Santhosh Kumar, D. Efficient Production of Biomass and Exopolysaccharide from P. ostreatus and Physio-Chemical Characterization of Biomass Powder. Food Biosci. 2023, 55, 103073. [Google Scholar] [CrossRef]
- Hamza, A.; Khalad, A.; Kumar, D.S. Enhanced Production of Mycelium Biomass and Exopolysaccharides of Pleurotus ostreatus by Integrating Response Surface Methodology and Artificial Neural Network. Bioresour. Technol. 2024, 399, 130577. [Google Scholar] [CrossRef] [PubMed]
- Corrêa, R.C.G.; Brugnari, T.; Bracht, A.; Peralta, R.M.; Ferreira, I.C.F.R. Biotechnological, Nutritional and Therapeutic Uses of Pleurotus spp. (Oyster Mushroom) Related with Its Chemical Composition: A Review on the Past Decade Findings. Trends Food Sci. Technol. 2016, 50, 103–117. [Google Scholar] [CrossRef]
- Bellettini, M.B.; Fiorda, F.A.; Maieves, H.A.; Teixeira, G.L.; Ávila, S.; Hornung, P.S.; Júnior, A.M.; Ribani, R.H. Factors Affecting Mushroom Pleurotus spp. Saudi J. Biol. Sci. 2019, 26, 633–646. [Google Scholar] [CrossRef] [PubMed]
- Hamza, A.; Mylarapu, A.; Krishna, K.V.; Kumar, D.S. An Insight into the Nutritional and Medicinal Value of Edible Mushrooms: A Natural Treasury for Human Health. J. Biotechnol. 2024, 381, 86–99. [Google Scholar] [CrossRef] [PubMed]
- Jaramillo Mejía, S.; Albertó, E. Heat Treatment of Wheat Straw by Immersion in Hot Water Decreases Mushroom Yield in Pleurotus ostreatus. Rev. Iberoam. Micol. 2013, 30, 125–129. [Google Scholar] [CrossRef] [PubMed]
- Kües, U.; Liu, Y. Fruiting Body Production in Basidiomycetes. Appl. Microbiol. Biotechnol. 2000, 54, 141–152. [Google Scholar] [CrossRef]
- Singh, M.; Pandey, V.K.; Pandey, A.K.; Srivastava, A.; Vishvakarma, N.; Singh, V.K. Production of Xylanase by White Rot Fungi on Wheat Straw. Asian J. Microbiol. Biotechnol. Environ. Sci. 2008, 10, 859–862. [Google Scholar]
- Prado-Acebo, I.; Cubero-Cardoso, J.; Lu-Chau, T.A.; Eibes, G. Integral Multi-Valorization of Agro-Industrial Wastes: A Review. J. Waste Manag. 2024, 183, 42–52. [Google Scholar] [CrossRef]
- Philippoussis, A.; Diamantopoulou, P.; Papadopoulou, K.; Lakhtar, H.; Roussos, S.; Parissopoulos, G.; Papanikolaou, S. Biomass, Laccase and Endoglucanase Production by Lentinula edodes during Solid State Fermentation of Reed Grass, Bean Stalks and Wheat Straw Residues. World J. Microbiol. Biotechnol. 2011, 27, 285–297. [Google Scholar] [CrossRef]
- Bertoldi, F.C.; Sant’Anna, E.; Barcelos-Oliveira, J.L. Chlorella vulgaris Cultivated in Hydroponic Wastewater. Acta Hortic. 2009, 843, 203–210. [Google Scholar] [CrossRef]
- Kumar, R.R.; Cho, J.Y. Reuse of Hydroponic Waste Solution. Environ. Sci. Pollut. Res. 2014, 21, 9569–9577. [Google Scholar] [CrossRef]
- Diamantis, I.; Dedousi, M.; Melanouri, E.-M.; Dalaka, E.; Antonopoulou, P.; Adelfopoulou, A.; Papanikolaou, S.; Politis, I.; Theodorou, G.; Diamantopoulou, P. Impact of Spent Mushroom Substrate Combined with Hydroponic Leafy Vegetable Roots on Pleurotus citrinopileatus Productivity and Fruit Bodies Biological Properties. Microorganisms 2024, 12, 1807. [Google Scholar] [CrossRef] [PubMed]
- Philippoussis, A.; Zervakis, G.; Diamantopoulou, P. Bioconversion of Agricultural Lignocellulosic Wastes through the Cultivation of the Edible Mushrooms Agrocybe aegerita, Volvariella volvacea and Pleurotus spp. World J. Microbiol. Biotechnol. 2001, 17, 191–200. [Google Scholar] [CrossRef]
- Alananbeh, K.M.; Bouqellah, N.A.; Al Kaff, N.S. Cultivation of Oyster Mushroom Pleurotus ostreatus on Date-Palm Leaves Mixed with Other Agro-Wastes in Saudi Arabia. Saudi J. Biol. Sci. 2014, 21, 616–625. [Google Scholar] [CrossRef]
- Melanouri, E.-M.; Dedousi, M.; Diamantopoulou, P. Cultivating Pleurotus ostreatus and Pleurotus eryngii Mushroom Strains on Agro-Industrial Residues in Solid-State Fermentation. Part II: Effect on Productivity and Quality of Carposomes. Carbon Resour. Convers. 2022, 5, 52–60. [Google Scholar] [CrossRef]
- Dedousi, M.; Melanouri, E.-M.; Diamantopoulou, P. Carposome Productivity of Pleurotus ostreatus and Pleurotus eryngii Growing on Agro-Industrial Residues Enriched with Nitrogen, Calcium Salts and Oils. Carbon Resour. Convers. 2023, 6, 150–165. [Google Scholar] [CrossRef]
- Dedousi, M.; Melanouri, E.-M.; Karayannis, D.; Kaminarides, E.-I.; Diamantopoulou, P. Utilization of Spent Substrates and Waste Products of Mushroom Cultivation to Produce New Crops of Pleurotus ostreatus, Pleurotus eryngii and Agaricus bisporus. Carbon Resour. Convers. 2024, 7, 100196. [Google Scholar] [CrossRef]
- Diamantopoulou, P.; Fourtaka, K.; Melanouri, E.M.; Dedousi, M.; Diamantis, I.; Gardeli, C.; Papanikolaou, S. Examining the Impact of Substrate Composition on the Biochemical Properties and Antioxidant Activity of Pleurotus and Agaricus Mushrooms. Fermentation 2023, 9, 689. [Google Scholar] [CrossRef]
- Singh, M.P.; Singh, V.K. Yield Performance and Nutritional Analysis of Pleurotus citrinopileatus on Different Agrowastes and Vegetable Wastes. In Proceedings of the 7th International Conference on Mushroom Biology and Mushroom Products, Arcachon, France, 4–7 October 2011; Volume 1, pp. 4–7. [Google Scholar]
- Ahmed, M.; Abdullah, N.; Nuruddin, M. Yield and Nutritional Composition of Oyster Mushrooms: An Alternative Nutritional Source for Rural People. Sains Malays. 2016, 45, 1609–1615. [Google Scholar]
- Kakon, A.; Choudhury, M.B.K.; Saha, S. Mushroom Is an Ideal Food Supplement. J. Dhaka Natl. Med. Coll. Hosp. 2012, 18, 58–62. [Google Scholar] [CrossRef]
- Ganesan, K.; Xu, B. Anti-Obesity Effects of Medicinal and Edible Mushrooms. Molecules 2018, 23, 2880. [Google Scholar] [CrossRef]
- Sande, D.; de Oliveira, G.P.; e Moura, M.A.F.; de Almeida Martins, B.; Lima, M.T.N.S.; Takahashi, J.A. Edible Mushrooms as a Ubiquitous Source of Essential Fatty Acids. Food Res. Int. 2019, 125, 108524. [Google Scholar] [CrossRef] [PubMed]
- Halliwell, B. Free Radicals and Antioxidants: Updating a Personal View. Nutr. Rev. 2012, 70, 257–265. [Google Scholar] [CrossRef]
- Meng, M.; Huo, R.; Wang, Y.; Ma, N.; Shi, X.; Shen, X.; Chang, G. Lentinan Inhibits Oxidative Stress and Alleviates LPS-Induced Inflammation and Apoptosis of BMECs by Activating the Nrf2 Signaling Pathway. Int. J. Biol. Macromol. 2022, 222, 2375–2391. [Google Scholar] [CrossRef] [PubMed]
- Ryter, S.W. Heme Oxgenase-1, a Cardinal Modulator of Regulated Cell Death and Inflammation. Cells 2021, 10, 515. [Google Scholar] [CrossRef]
- Herath, H.M.L.P.B.; Wickramasinghe, P.D.S.U.; Bathige, S.D.N.K.; Jayasooriya, R.G.P.T.; Kim, G.-Y.; Park, M.A.; Kim, C.; Lee, J. Molecular Identification and Functional Delineation of a Glutathione Reductase Homolog from Disk Abalone (Haliotis discus discus): Insights as a Potent Player in Host Antioxidant Defense. Fish Shellfish Immunol. 2017, 60, 355–367. [Google Scholar] [CrossRef]
- Philippoussis, A.; Diamantopoulou, P.A.; Zervakis, G. Monitoring of Mycelium Growth and Fructification of Lentinula edodes on Several Agricultural Residues. In Mushroom Biology and Mushroom Products; UAEM: Cuernavaca, Mexico, 2002. [Google Scholar]
- Philippoussis, A.; Diamantopoulou, P.; Zervakis, G. Correlation of the Properties of Several Lignocellulosic Substrates to the Crop Performance of the Shiitake Mushroom Lentinula edodes. World J. Microbiol. Biotechnol. 2003, 19, 551–557. [Google Scholar] [CrossRef]
- Diamantopoulou, P.; Papanikolaou, S.; Komaitis, M.; Aggelis, G.; Philippoussis, A. Patterns of Major Metabolites Biosynthesis by Different Mushroom Fungi Grown on Glucose-Based Submerged Cultures. Bioprocess. Biosyst. Eng. 2014, 37, 1385–1400. [Google Scholar] [CrossRef]
- Liang, Y.; Sarkany, N.; Cui, Y.; Blackburn, J.W. Batch Stage Study of Lipid Production from Crude Glycerol Derived from Yellow Grease or Animal Fats through Microalgal Fermentation. Bioresour. Technol. 2010, 101, 6745–6750. [Google Scholar] [CrossRef]
- Miller, G.L. Use of Dinitrosalicylic Acid Reagent for Determination of Reducing Sugar. Anal. Chem. 1959, 31, 426–428. [Google Scholar] [CrossRef]
- Sarantou, S.; Stoforos, N.G.; Kalantzi, O.; Papanikolaou, S. Biotechnological Valorization of Biodiesel-Derived Glycerol: Trials with the Non-Conventional Yeasts Yarrowia lipolytica and Rhodosporidium sp. Carbon Resour. Convers. 2021, 4, 61–75. [Google Scholar] [CrossRef]
- Fakas, S.; Papanikolaou, S.; Galiotou-Panayotou, M.; Komaitis, M.; Aggelis, G. Organic Nitrogen of Tomato Waste Hydrolysate Enhances Glucose Uptake and Lipid Accumulation in Cunninghamella echinulata. J. Appl. Microbiol. 2008, 105, 1062–1070. [Google Scholar] [CrossRef]
- León-Guzmán, M.F.; Silva, I.; López, M.G. Proximate Chemical Composition, Free Amino Acid Contents, and Free Fatty Acid Contents of Some Wild Edible Mushrooms from Querétaro, México. J. Agric. Food Chem. 1997, 45, 4329–4332. [Google Scholar] [CrossRef]
- Singleton, V.L.; Rossi, J.A. Colorimetry of Total Phenolics with Phosphomolybdic-Phosphotungstic Acid Reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. [Google Scholar] [CrossRef]
- Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant Activity Applying an Improved ABTS Radical Cation Decolorization Assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef] [PubMed]
- Boonsong, S.; Klaypradit, W.; Wilaipun, P. Antioxidant Activities of Extracts from Five Edible Mushrooms Using Different Extractants. Agric. Nat. Resour. 2016, 50, 89–97. [Google Scholar] [CrossRef]
- Benzie, I.F.F.; Strain, J.J. The Ferric Reducing Ability of Plasma (FRAP) as a Measure of “Antioxidant Power”: The FRAP Assay. Anal. Biochem. 1996, 239, 70–76. [Google Scholar] [CrossRef] [PubMed]
- Barreira, J.; Ferreira, I.; Oliveira, M.; Pereira, J. Antioxidant Activities of the Extracts from Chestnut Flower, Leaf, Skins and Fruit. Food Chem. 2008, 107, 1106–1113. [Google Scholar] [CrossRef]
- Fan, J.-P.; He, C.-H. Simultaneous Quantification of Three Major Bioactive Triterpene Acids in the Leaves of Diospyros Kaki by High-Performance Liquid Chromatography Method. J. Pharm. Biomed. Anal. 2006, 41, 950–956. [Google Scholar] [CrossRef]
- González, A.; Nobre, C.; Simões, L.S.; Cruz, M.; Loredo, A.; Rodríguez-Jasso, R.M.; Contreras, J.; Texeira, J.; Belmares, R. Evaluation of Functional and Nutritional Potential of a Protein Concentrate from Pleurotus ostreatus Mushroom. Food Chem. 2021, 346, 128884. [Google Scholar] [CrossRef]
- Gardeli, C.; Mela, N.; Dedousi, M.; Kandyliari, A.; Kaparakou, E.; Diamantopoulou, P.; Pappas, C.; Mallouchos, A. The Influence of Substrate and Strain on Protein Quality of Pleurotus ostreatus. Appl. Sci. 2024, 14, 4040. [Google Scholar] [CrossRef]
- Li, X.; Zhao, R.; Zhou, H.L.; Wu, D.H. Deproteinization of Polysaccharide from the Stigma Maydis by Sevag Method. Adv. Mater. Res. 2011, 340, 416–420. [Google Scholar] [CrossRef]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Dalaka, E.; Politis, I.; Theodorou, G. Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after in Vitro Simulated Gastrointestinal Digestion. Antioxidants 2023, 12, 1676. [Google Scholar] [CrossRef]
- Brodkorb, A.; Egger, L.; Alminger, M.; Alvito, P.; Assunção, R.; Ballance, S.; Bohn, T.; Bourlieu-Lacanal, C.; Boutrou, R.; Carrière, F.; et al. INFOGEST Static in Vitro Simulation of Gastrointestinal Food Digestion. Nat. Protoc. 2019, 14, 991–1014. [Google Scholar] [CrossRef]
- Minekus, M.; Alminger, M.; Alvito, P.; Ballance, S.; Bohn, T.; Bourlieu, C.; Carrière, F.; Boutrou, R.; Corredig, M.; Dupont, D.; et al. A Standardised Static in Vitro Digestion Method Suitable for Food—An International Consensus. Food Funct. 2014, 5, 1113–1124. [Google Scholar] [CrossRef] [PubMed]
- Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase Relative Quantification Framework and Software for Management and Automated Analysis of Real-Time Quantitative PCR Data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef]
- Templeton, G. A Two-Step Approach for Transforming Continuous Variables to Normal: Implications and Recommendations for IS Research. Commun. Assoc. Inf. Syst. 2011, 28, 4. [Google Scholar] [CrossRef]
- Economou, C.; Diamantopoulou, P.; Philippoussis, A. Valorization of Spent Oyster Mushroom Substrate and Laccase Recovery through Successive Solid State Cultivation of Pleurotus, Ganoderma, and Lentinula Strains. Appl. Microbiol. Biotechnol. 2017, 101, 5213–5222. [Google Scholar] [CrossRef]
- Melanouri, E.M.; Papanikolaou, S.; Diamantopoulou, P. Mortierella ramanniana Lipid Fermentation Wastewater as an Innovative Maceration Liquid Medium for Sustainable Solid-State Cultivation of Higher Fungi. Waste Biomass Valori. 2024, 15, 6903–6925. [Google Scholar] [CrossRef]
- Melanouri, E.-M.; Dedousi, M.; Diamantopoulou, P. Cultivating Pleurotus ostreatus and Pleurotus eryngii Mushroom Strains on Agro-Industrial Residues in Solid-State Fermentation. Part I: Screening for Growth, Endoglucanase, Laccase and Biomass Production in the Colonization Phase. Carbon Resour. Convers. 2022, 5, 61–70. [Google Scholar] [CrossRef]
- Curvetto, N.R.; Figlas, D.; Devalis, R.; Delmastro, S. Growth and Productivity of Different Pleurotus ostreatus Strains on Sunflower Seed Hulls Supplemented with N–NH4+ and/or Mn(II). Bioresour. Technol. 2002, 84, 171–176. [Google Scholar] [CrossRef]
- Kaal, E.E.J.; Field, J.A.; Joyce, T.W. Increasing Ligninolytic Enzyme Activities in Several White-Rot Basidiomycetes by Nitrogen-Sufficient Media. Bioresour. Technol. 1995, 53, 133–139. [Google Scholar] [CrossRef]
- Baysal, E.; Peker, H.; Yalinkiliç, M.K.; Temiz, A. Cultivation of Oyster Mushroom on Waste Paper with Some Added Supplementary Materials. Bioresour. Technol. 2003, 89, 95–97. [Google Scholar] [CrossRef] [PubMed]
- Chang, S.-T.; Miles, P.G. Edible Mushrooms and Their Cultivation; CRC: Boca Raton, FL, USA, 1989. [Google Scholar]
- Kortei, N.K.; Odamtten, G.T.; Obodai, M.; Wiafe-Kwagyan, M.; Narh Mensah, D.L. Correlations of Cap Diameter (Pileus Width), Stipe Length and Biological Efficiency of Pleurotus ostreatus (Ex.Fr.) Kummer Cultivated on Gamma-Irradiated and Steam-Sterilized Composted Sawdust as an Index of Quality for Pricing. Agric. Food Secur. 2018, 7, 35. [Google Scholar] [CrossRef]
- Hoa, H.T.; Wang, C.-L.; Wang, C.-H. The Effects of Different Substrates on the Growth, Yield, and Nutritional Composition of Two Oyster Mushrooms (Pleurotus ostreatus and Pleurotus cystidiosus). Mycobiology 2015, 43, 423–434. [Google Scholar] [CrossRef]
- Patra, A.K.; Pani, B.K. Evaluation of Banana Leaf as a New Alternate Substrate to Paddy Straw for Oyster Mushroom Cultivation. J. Phytol. 1995, 8, 145–148. [Google Scholar]
- Kurt, S.; Buyukalaca, S. Yield Performances and Changes in Enzyme Activities of Pleurotus spp. (P. ostreatus and P. sajor-caju) Cultivated on Different Agricultural Wastes. Bioresour. Technol. 2010, 101, 3164–3169. [Google Scholar] [CrossRef]
- Liang, Z.-C.; Wu, C.-Y.; Shieh, Z.-L.; Cheng, S.-L. Utilization of Grass Plants for Cultivation of Pleurotus citrinopileatus. Int. J. Biodegrad. Bioremediat. 2009, 63, 509–514. [Google Scholar] [CrossRef]
- Ulziijargal, E.; Mau, J.-L. Nutrient Compositions of Culinary-Medicinal Mushroom Fruiting Bodies and Mycelia. Int. J. Med. Mushrooms 2011, 13, 343–349. [Google Scholar] [CrossRef] [PubMed]
- Baeva, E.; Bleha, R.; Lavrova, E.; Sushytskyi, L.; Čopíková, J.; Jablonsky, I.; Klouček, P.; Synytsya, A. Polysaccharides from Basidiocarps of Cultivating Mushroom Pleurotus ostreatus: Isolation and Structural Characterization. Molecules 2019, 24, 2740. [Google Scholar] [CrossRef]
- Economou, C.N.; Philippoussis, A.N.; Diamantopoulou, P.A. Spent Mushroom Substrate for a Second Cultivation Cycle of Pleurotus Mushrooms and Dephenolization of Agro-Industrial Wastewaters. FEMS Microbiol. Lett. 2020, 367, fnaa060. [Google Scholar] [CrossRef] [PubMed]
- Günç Ergönül, P.; Akata, I.; Kalyoncu, F.; Ergönül, B. Fatty Acid Compositions of Six Wild Edible Mushroom Species. Sci. World J. 2013, 2013, 163964. [Google Scholar] [CrossRef] [PubMed]
- Bengu, A.S. The Fatty Acid Composition in Some Economic and Wild Edible Mushrooms in Turkey. Prog. Nutr. 2020, 22, 185–192. [Google Scholar]
- Kalač, P. Chemical Composition and Nutritional Value of European Species of Wild Growing Mushrooms: A Review. Food Chem. 2009, 113, 9–16. [Google Scholar] [CrossRef]
- Yamagishi, K.; Folsom, A.R.; Steffen, L.M.; ARIC Study Investigators. Plasma Fatty Acid Composition and Incident Ischemic Stroke in Middle-Aged Adults: The Atherosclerosis Risk in Communities (ARIC) Study. Cerebrovasc. Dis. 2013, 36, 38–46. [Google Scholar] [CrossRef]
- Floret, C.; Monnet, A.-F.; Micard, V.; Walrand, S.; Michon, C. Replacement of Animal Proteins in Food: How to Take Advantage of Nutritional and Gelling Properties of Alternative Protein Sources. Crit. Rev. Food Sci. Nutr. 2023, 63, 920–946. [Google Scholar] [CrossRef]
- Dedousi, M.; Melanouri, E.M.; Diamantis, I.; Papanikolaou, S.; Diamantopoulou, P. Biochemical, Functional and Antioxidant Potential of Higher Fungi Cultivated on Agro-Industrial Residues. Part II: Cultures on Mixtures of Spent Mushroom Substrates and Mushroom Cropping By-Products. Resour. Chem. Mater. 2024, 3, 175–187. [Google Scholar] [CrossRef]
- Dedousi, M.; Melanouri, E.M.; Panagopoulou, I.; Gardeli, C.; Papanikolaou, S.; Diamantopoulou, P. Biochemical, Functional and Antioxidant Dynamics Potential of Higher Fungi Cultivated on Agro-Industrial Residues. Part I: Cultures on Media Supplemented with Yeast Extract, Gypsum and Commodity Vegetable Oils. Resour. Chem. Mater. 2024, S2772443324000199. [Google Scholar] [CrossRef]
- Yu, Q.; Guo, M.; Zhang, B.; Wu, H.; Zhang, Y.; Zhang, L. Analysis of Nutritional Composition in 23 Kinds of Edible Fungi. J. Food Qual. 2020, 2020, 8821315. [Google Scholar] [CrossRef]
- Zhou, J.; Chen, M.; Wu, S.; Liao, X.; Wang, J.; Wu, Q.; Zhuang, M.; Ding, Y. A Review on Mushroom-Derived Bioactive Peptides: Preparation and Biological Activities. Food Res. Int. 2020, 134, 109230. [Google Scholar] [CrossRef] [PubMed]
- Tshinyangu, K.K.; Hennebert, G.L. Protein and Chitin Nitrogen Contents and Protein Content in Pleurotus ostreatus Var. columbinus. Food Chem. 1996, 57, 223–227. [Google Scholar] [CrossRef]
- Sadli, S.; Saleha, S.; Fiana, D.; Misrahanum, M. The Formulation of White Oyster Mushroom (Pleurotus ostreatus (Jacq.) P. Kumm) as Natural Flavoring and the Quality Test in Temperature and Drying Time Variations. IOP Conf. Ser. Earth Environ. Sci. 2021, 922, 012054. [Google Scholar] [CrossRef]
- Yamauchi, M.; Sakamoto, M.; Yamada, M.; Hara, H.; Mat Taib, S.; Rezania, S.; Mohd Fadhil, M.D.; Mohd Hanafi, F.H. Cultivation of Oyster Mushroom (Pleurotus ostreatus) on Fermented Moso Bamboo Sawdust. J. King Saud Univ. Sci. 2019, 31, 490–494. [Google Scholar] [CrossRef]
- Alam, N.; Amin, R.; Khan, A.; Ara, I.; Shim, M.-J.; Lee, M.-W.; Lee, T.-S. Nutritional Analysis of Cultivated Mushrooms in Bangladesh—Pleurotus ostreatus, Pleurotus sajor-caju, Pleurotus florida and Calocybe indica. Mycobiology 2008, 36, 228–232. [Google Scholar] [CrossRef]
- Cohen, N.; Cohen, J.; Asatiani, M.D.; Varshney, V.K.; Yu, H.-T.; Yang, Y.-C.; Li, Y.-H.; Mau, J.-L.; Wasser, S.P. Chemical Composition and Nutritional and Medicinal Value of Fruit Bodies and Submerged Cultured Mycelia of Culinary-Medicinal Higher Basidiomycetes Mushrooms. Int. J. Med. Mushrooms 2014, 16, 273–291. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Kaur, N.; Shri, R.; Singh, A.P.; Dhingra, G.S. Proximate Composition and Element Contents of Selected Species of Ganoderma with Reference to Dietary Intakes. Environ. Monit. Assess. 2020, 192, 270. [Google Scholar] [CrossRef]
- Palacios, I.; Lozano, M.; Moro, C.; D’Arrigo, M.; Rostagno, M.A.; Martínez, J.A.; García-Lafuente, A.; Guillamón, E.; Villares, A. Antioxidant Properties of Phenolic Compounds Occurring in Edible Mushrooms. Food Chem. 2011, 128, 674–678. [Google Scholar] [CrossRef]
- Becker, E.M.; Nissen, L.R.; Skibsted, L.H. Antioxidant Evaluation Protocols: Food Quality or Health Effects. Eur. Food Res. Technol. 2004, 219, 561–571. [Google Scholar] [CrossRef]
- Li, J.-J.; Hu, X.-Q.; Zhang, X.-F.; Liu, J.-J.; Cao, L.-S. Study on Variation of Main Ingredients from Spores and Fruiting Bodies of Ganoderma lucidum. Chin. J. Chin. Mater. Med. 2014, 39, 4246–4251. [Google Scholar]
- Boh, B.; Dolničar, D.; Pohleven, F. Isolation and Quantification of Triterpenoid Acids from Ganoderma applanatum of Istrian Origin. Food Technol. Biotechnol. 2000, 38, 11–18. [Google Scholar]
- Strapáč, I.; Kuruc, M.; Baranová, M. Determination of Antioxidant Parameters of Pleurotus Mushrooms Growing on Different Wood Substrates. Folia Vet. 2017, 61, 53–58. [Google Scholar] [CrossRef]
- Gil-Ramírez, A.; Pavo-Caballero, C.; Baeza, E.; Baenas, N.; Garcia-Viguera, C.; Marín, F.R.; Soler-Rivas, C. Mushrooms Do Not Contain Flavonoids. J. Funct. Foods 2016, 25, 1–13. [Google Scholar] [CrossRef]
- Arbaayah, H.; Umi Kalsom, Y. Antioxidant Properties in the Oyster Mushrooms (Pleurotus spp.) and Split Gill Mushroom (Schizophyllum commune) Ethanolic Extracts. Mycosphere 2013, 4, 661–673. [Google Scholar] [CrossRef]
- Sudha, G.; Vadivukkarasi, S.; Shree, R.B.I.; Lakshmanan, P. Antioxidant Activity of Various Extracts from an Edible Mushroom Pleurotus eous. Food Sci. Biotechnol. 2012, 21, 661–668. [Google Scholar] [CrossRef]
- Yeh, J.-Y.; Hsieh, L.-H.; Wu, K.-T.; Tsai, C.-F. Antioxidant Properties and Antioxidant Compounds of Various Extracts from the Edible Basidiomycete Grifola frondosa (Maitake). Molecules 2011, 16, 3197–3211. [Google Scholar] [CrossRef] [PubMed]
- Kalogeropoulos, N.; Yanni, A.E.; Koutrotsios, G.; Aloupi, M. Bioactive Microconstituents and Antioxidant Properties of Wild Edible Mushrooms from the Island of Lesvos, Greece. Food Chem. Toxicol. 2013, 55, 378–385. [Google Scholar] [CrossRef]
- Wang, S.; Liu, Z.; Wang, X.; Liu, R.; Zou, L. Mushrooms Do Produce Flavonoids: Metabolite Profiling and Transcriptome Analysis of Flavonoid Synthesis in the Medicinal Mushroom Sanghuangporus baumii. J. Fungi 2022, 8, 582. [Google Scholar] [CrossRef] [PubMed]
- Lesa, K.N.; Khandaker, M.U.; Mohammad Rashed Iqbal, F.; Sharma, R.; Islam, F.; Mitra, S.; Emran, T.B. Nutritional Value, Medicinal Importance, and Health-Promoting Effects of Dietary Mushroom (Pleurotus ostreatus). J. Food Qual. 2022, 2022, 2454180. [Google Scholar] [CrossRef]
- Golak-Siwulska, I.; Kałużewicz, A.; Spiżewski, T.; Siwulski, M.; Sobieralski, K. Bioactive Compounds and Medicinal Properties of Oyster Mushrooms (Pleurotus sp.). Folia Hortic. 2018, 30, 191–201. [Google Scholar] [CrossRef]
- Koutrotsios, G.; Kalogeropoulos, N.; Stathopoulos, P.; Kaliora, A.C.; Zervakis, G.I. Bioactive Compounds and Antioxidant Activity Exhibit High Intraspecific Variability in Pleurotus ostreatus Mushrooms and Correlate Well with Cultivation Performance Parameters. World J. Microbiol. Biotechnol. 2017, 33, 98. [Google Scholar] [CrossRef] [PubMed]
- Kozarski, M.; Klaus, A.; Jakovljevic, D.; Todorovic, N.; Vunduk, J.; Petrović, P.; Niksic, M.; Vrvic, M.M.; van Griensven, L. Antioxidants of Edible Mushrooms. Molecules 2015, 20, 19489–19525. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Sharma, A.; Tripathi, A. Biological Activities of Pleurotus spp. Polysaccharides: A Review. J. Food Biochem. 2021, 45, e13748. [Google Scholar] [CrossRef]
- Yin, Z.; Sun-Waterhouse, D.; Wang, J.; Ma, C.; Waterhouse, G.I.N.; Kang, W. Polysaccharides from Edible Fungi Pleurotus spp.: Advances and Perspectives. J. Future Foods 2021, 1, 128–140. [Google Scholar] [CrossRef]
- Bonatti, M.; Karnopp, P.; Soares, H.M.; Furlan, S.A. Evaluation of Pleurotus ostreatus and Pleurotus sajor-caju Nutritional Characteristics When Cultivated in Different Lignocellulosic Wastes. Food Chem. 2004, 88, 425–428. [Google Scholar] [CrossRef]
- Koutrotsios, G.; Patsou, M.; Mitsou, E.K.; Bekiaris, G.; Kotsou, M.; Tarantilis, P.A.; Pletsa, V.; Kyriacou, A.; Zervakis, G.I. Valorization of Olive By-Products as Substrates for the Cultivation of Ganoderma lucidum and Pleurotus ostreatus Mushrooms with Enhanced Functional and Prebiotic Properties. Catalysts 2019, 9, 537. [Google Scholar] [CrossRef]
- Elhusseiny, S.M.; El-Mahdy, T.S.; Awad, M.F.; Elleboudy, N.S.; Farag, M.M.S.; Aboshanab, K.M.; Yassien, M.A. Antiviral, Cytotoxic, and Antioxidant Activities of Three Edible Agaricomycetes Mushrooms: Pleurotus columbinus, Pleurotus sajor-caju, and Agaricus bisporus. J. Fungi 2021, 7, 645. [Google Scholar] [CrossRef]
- Petraglia, T.; Latronico, T.; Fanigliulo, A.; Crescenzi, A.; Liuzzi, G.M.; Rossano, R. Antioxidant Activity of Polysaccharides from the Edible Mushroom Pleurotus eryngii. Molecules 2023, 28, 2176. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Xu, X.; Chen, W. Antioxidant and Immunostimulatory Activities of Fermented Sour Soybean Milk Added with Polypeptides from Pleurotus eryngii. Front. Microbiol. 2022, 13, 750039. [Google Scholar] [CrossRef] [PubMed]
- Aursuwanna, T.; Noitang, S.; Sangtanoo, P.; Srimongkol, P.; Saisavoey, T.; Puthong, S.; Reamtong, O.; Karnchanatat, A. Investigating the Cellular Antioxidant and Anti-Inflammatory Effects of the Novel Peptides in Lingzhi Mushrooms. Heliyon 2022, 8, e11067. [Google Scholar] [CrossRef]
- Wu, S.; Chen, M.; Liao, X.; Huang, R.; Wang, J.; Xie, Y.; Hu, H.; Zhang, J.; Wu, Q.; Ding, Y. Protein Hydrolysates from Pleurotus geesteranus Obtained by Simulated Gastrointestinal Digestion Exhibit Neuroprotective Effects in H2O2-injured PC12 Cells. J. Food Biochem. 2022, 46, e13879. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; Li, X.; Tao, Q.; Hu, Q.; Yang, W.; Kimatu, B.M.; Ma, G. The Effect of in Vitro Digestion on the Interaction between Polysaccharides Derived from Pleurotus eryngii and Intestinal Mucus. Food Sci. Nutr. 2024, 12, 1318–1329. [Google Scholar] [CrossRef]
- Li, S.; Shah, N.P. Sulphonated Modification of Polysaccharides from Pleurotus eryngii and Streptococcus thermophilus ASCC 1275 and Antioxidant Activities Investigation Using CCD and Caco-2 Cell Line Models. Food Chem. 2017, 225, 246–257. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Zhou, C.; Huang, S.; Jiang, C. Selenium Polysaccharide SPMP-2a from Pleurotus geesteranus Alleviates H2O2-Induced Oxidative Damage in HaCaT Cells. BioMed Res. Int. 2017, 2017, 4940384. [Google Scholar] [CrossRef] [PubMed]






| Gene (Accession Number) | Primer Direction | Sequence (5′-3′) | Reaction Efficiency | Amplicon Size |
|---|---|---|---|---|
| B2M (NM_004048.4) | Forward | GCTATCCAGCGTACTCCA | 103 | 285 |
| Reverse | CTTAACTATCTTGGGCTGTGAC | |||
| RPS18 (NM_022551.3) | Forward | CTGAGGATGAGGTGGAACG | 98 | 240 |
| Reverse | CAGTGGTCTTGGTGTGCT | |||
| RPL37a (NM_000998.5) | Forward | AGTACACTTGCTCTTTCTGTGG | 106 | 119 |
| Reverse | GGAAGTGGTATTGTACGTCCAG | |||
| NFE2L2 (NM_006164.5) | Forward | GATCTGCCAACTACTCCCA | 90 | 121 |
| Reverse | GCCGAAGAAACCTCATTGTC | |||
| SOD1 (NM_000454.5) | Forward | CGAGCAGAAGGAAAGTAATGG | 95 | 194 |
| Reverse | CCAAGTCTCCAACATGCC | |||
| CAT (NM_001752.4) | Forward | TGCCTATCCTGACACTCACC | 92 | 137 |
| Reverse | GAGCACCACCCTGATTGTC | |||
| HMOX1 (NM_002133.3) | Forward | GCTTCAAGCTGGTGATGG | 90 | 112 |
| Reverse | AGCTCTTCTGGGAAGTAGAC | |||
| GSR (NM_001195102.3) | Forward | CTTGCGTGAATGTTGGATGTG | 98 | 102 |
| Reverse | CACAACTTGGAAAGCCATAATCAG |
| Substrate | Substrate Composition (% w/w) | C (% d.w.) | N (% d.w.) | C/N | pH | EC (μS/cm) | Kr (mm/day) |
|---|---|---|---|---|---|---|---|
| SMS * 100% | SMS 100% | 27.2 ± 0.5 c,d,e,f,g ** | 0.8 ± 0.1 e | 35.2 ± 1.3 a | 6.9 ± 0.2 a,b | 473 ± 18 f,g | 5.6 ± 0.3 b,c,d |
| SMS 90% | SMS 90% | 29.5 ± 0.3 b | 1.1 ± 0.3 c,d,e | 27.8 ± 2.1 b | 6.9 ± 0.6 a,b | 574 ± 13 c,d,e | 5.2 ± 0.1 d,e |
| WB 5% | |||||||
| SF 5% | |||||||
| SMS 80% | SMS 80% | 29.9 ± 0.6 b | 1.4 ± 0.2 a,b,c,d | 23.4 ± 2.0 c,d,e | 6.7 ± 0.5 b | 506 ± 14 e,f | 5.2 ± 0.2 d,e |
| WB 15% | |||||||
| SF 5% | |||||||
| SMS 90%– RLV 10% | SMS 90% | 26.9 ± 0.2 d,e,f,g | 0.9 ± 0.0 d,e | 27.2 ± 1.4 b,c | 6.9 ± 0.9 a,b | 557 ± 22 d,e,f | 5.9 ± 0.1 b,c |
| RLV 10% | |||||||
| SMS 80%– RLV 10% | SMS 80% | 29.2 ± 1.2 b,c | 1.3 ± 0.1 b,c,d,e | 23.3 ± 0.9 c,d,e | 7.2 ± 0.8 a,b | 666 ± 31 b,c | 4.6 ± 0.1 f |
| RLV 10% | |||||||
| WB 5% | |||||||
| SF 5% | |||||||
| SMS 80%– RLV 20% | SMS 80% | 26.6 ± 0.9 e,f,g | 1.1 ± 0.2 c,d,e | 25.3 ± 0.7 b,c,d | 7.8 ± 0.5 a,b | 698 ± 32 b | 5.1 ± 0.1 d,e |
| RLV 20% | |||||||
| SMS 70%– RLV 20% | SMS 70% | 28.9 ± 0.2 b,c,d | 1.5 ± 0.3 a,b,c | 20.6 ± 1.1 e,f | 7.9 ± 0.4 a,b | 630 ± 24 b,c,d | 4.4 ± 0.1 f |
| RLV 20% | |||||||
| WB 5% | |||||||
| SF 5% | |||||||
| SMS 70%– RLV 30% | SMS 70% | 26.3 ± 0.5 f,g | 1.3 ± 0.1 b,c,d,e | 21.2 ± 0.8 d,e,f | 8.0 ± 0.4 a,b | 709 ± 33 b | 4.7 ± 0.1 e,f |
| RLV 30% | |||||||
| SMS 60%– RLV 30% | SMS 60% | 28.6 ± 0.4 b,c,d,e | 1.7 ± 0.1 a,b | 19.1 ± 1.4 f | 8.1 ± 0.1 a | 1059 ± 50 a | 5.4 ± 0.2 c,d |
| RLV 30% | |||||||
| WB 5% | |||||||
| SF 5% | |||||||
| SMS 60%– RLV 40% | SMS 60% | 26.0 ± 1.2 g | 1.5 ± 0.1 a,b,c | 19.9 ± 1.6 e,f | 8.0 ± 0.1 a,b | 1107 ± 48 a | 6.0 ± 0.2 a,b |
| RLV 40% | |||||||
| SMS 50%– RLV 40% | SMS 50% | 28.3 ± 0.8 b,c,d,e,f | 1.9 ± 0.1 a | 17.2 ± 2.2 f | 7.8 ± 0.5 a,b | 1109 ± 46 a | 5.9 ± 0.2 b |
| RLV 40% | |||||||
| WB 5% | |||||||
| SF 5% | |||||||
| WS | WS 80% | 33.3 ± 1.1 a | 1.3 ± 0.2 b,c,d,e | 25.1 ± 1.2 b,c,d | 7.7 ± 0.3 a,b | 409 ± 12 g | 6.5 ± 0.2 a |
| WB 15% | |||||||
| SF 5% |
| Substrate | Earliness (days) | BE (%) | Pileus Diameter (mm) | Stipe Length (mm) |
|---|---|---|---|---|
| SMS 100% | 30.0 ± 0.3 a * | 69.1 ± 1.2 d,e,f,g | 38.88 ± 2.7 f | 28.91 ± 1.4 a,b |
| SMS 90% | 30.0 ± 0.3 a | 72.3 ± 2.6 c,d,e | 47.11 ± 1.8 c,d,e | 25.03 ± 1.8 d |
| SMS 80% | 30.0 ± 0.3a | 71.1 ± 2.7 c,d,e,f | 49.30 ± 2.7 b,c | 28.44 ± 1.5 b,c |
| SMS 90%–RLV 10% | 30.0 ± 0.3 a | 63.6 ± 2.9 f,g | 48.32 ± 2.8 c,d | 27.31 ± 1.4 b,c,d |
| SMS 80%–RLV 10% | 26.0 ± 0.3 b | 85.4 ± 1.9 a,b | 48.85 ± 3.0 b,c | 25.36 ± 1.5 c,d |
| SMS 80%–RLV 20% | 26.0 ± 0.3 b | 79.3 ± 2.4 b,c | 56.62 ± 2.7 a,b | 27.32 ± 2.0 b,c,d |
| SMS 70%–RLV 20% | 24.0 ± 0.3 c | 73.3 ± 2.7 c,d | 48.15 ± 3.6 c,d | 25.51 ± 2.1 c,d |
| SMS 70%–RLV 30% | 24.0 ± 0.3 c | 64.8 ± 3.0 e,f,g | 35.48 ± 2.7 f,g | 25.35 ± 1.9 d |
| SMS 60%–RLV 30% | 30.0 ± 0.3 a | 75.9 ± 2.9 c,d | 31.04 ± 1.8 g | 25.15 ± 2.1 d |
| SMS 60%–RLV 40% | 24.0 ± 0.3 c | 61.2 ± 4.1 g | 40.06 ± 2.6 e,f | 18.89 ± 1.8 e |
| SMS 50%–RLV 40% | 30.0 ± 0.3 a | 45.6 ± 4.1 h | 63.26 ± 2.7 a | 19.56 ± 2.2 e |
| WS | 24.0 ± 0.3 c | 87.8 ± 2.3 a | 40.49 ± 2.3 d,e,f | 31.79 ± 2.0 a |
| Carbohydrates (% w/w of Total IPS) | |||
|---|---|---|---|
| Substrate | Glucose | Fructose | Mannose |
| SMS 100% | 63.3 ± 2.9 c,d * | 36.7 ± 1.2 b,c | nd ** |
| SMS 90% | 58.5 ± 1.5 d | 17.2 ± 0.6 g | 24.3 ± 0.9 a |
| SMS 80% | 53.0 ± 1.1 e | 38.2 ± 1.2 a,b,c | 8.8 ± 0.5 c |
| SMS 90%–RLV 10% | 78.7 ± 2.3 a | 21.3 ± 1.3 f | nd |
| SMS 80%–RLV 10% | 59.0 ± 2.2 d | 41.0 ± 1.4 a | nd |
| SMS 80%–RLV 20% | 64.7 ± 2.3 b,c | 35.3 ± 1.3 c | nd |
| SMS 70%–RLV 20% | 61.1 ± 1.8 c,d | 38.9 ± 1.1 a,b | nd |
| SMS 70%–RLV 30% | 69.0 ± 1.8 b | 31.0 ± 1.3 d | nd |
| SMS 60%–RLV 30% | 59.5 ± 1.7 c,d | 27.4 ± 1.1 e | 13.2 ± 0.5 b |
| SMS 60%–RLV 40% | 52.4 ± 1.1 e | 41.1 ± 1.2 a | 6.5 ± 0.5 d |
| SMS 50%–RLV 40% | 51.5 ± 1.2 e | 38.5 ± 1.1 a,b,c | 10.0 ± 0.7 c |
| WS | 60.5 ± 0.9 c,d | 39.5 ± 0.8 a,b | nd |
| Substrate/FA % w/w | C16:0 | C16:1 | C18:0 | C18:1 | C18:2 | C20:0 | C20:2 | C22:0 | C22:1 | C22:6 | C24:1 | Other | Polyunsaturated | U.I. |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SMS 100% | 12.24 a * | 0.22 d | 0.65 g | 11.65 b | 57.05 c | 0.47 e,f | 0.53 b | 0.59 d | 1.15 b | 0.98 a | 0.84 b,c | 13.63 b,c | 72.42 b,c | 1.35 ns ** |
| SMS 90% | 11.39 a,b | 0.25 c,d | 1.44 c,d | 13.81 a | 60.91 a,b,c | 0.41 f | 0.24 d | 0.30 f | 0.62 d | 0.46 e | 1.45 a | 8.72 g | 77.74 a,b,c | 1.41 ns |
| SMS 80% | 10.19 b,c | 0.33 b | 0.89 f | 11.76 b | 61.40 a,b,c | 0.12 h | 0.24 d | 0.70 c | 0.71 c | 0.82 b | 0.60 d,e | 12.24 d,e | 75.86 a,b,c | 1.42 ns |
| SMS 90%– RLV 10% | 11.26 a,b | 0.46 a | 1.58 b | 9.67 d | 63.61 a,b,c | 0.23 g | 0.28 d | 0.35 f | 0.72 c | 0.86 b | 0.29 f,g | 10.69 f | 75.89 a,b,c | 1.44 ns |
| SMS 80%– RLV 10% | 9.61 c,d | 0.42 a | 0.86 f | 11.90 b | 67.99 a | 0.40 f | 0.12 e | 0.14 g | 0.20 g | 0.55 d | 0.13 g | 7.68 g | 81.31 a | 1.52 ns |
| SMS 80%– RLV 20% | 10.34 b,c | 0.29 b,c | 0.97 e,f | 9.61 d | 62.88 a,b,c | 0.62 b | 0.46 c | 0.12 g | 0.29 e,f | 0.79 b | 0.56 d,e | 13.07 c,d | 74.88 a,b,c | 1.42 ns |
| SMS 70%– RLV 20% | 10.64 b,c | 0.28 b,c | 1.33 d | 10.88 b,c | 57.62 c | 0.49 d,e | 0.44 c | 0.89 b | 1.34 a | 0.81 b | 0.44 e,f | 14.84 a,b | 71.81 c | 1.34 ns |
| SMS 70%– RLV 30% | 8.30 d | 0.42 a | 1.89 a | 9.92 c,d | 59.21 b,c | 0.84 a | 0.66 a | 1.05 a | 0.68 c,d | 1.03 a | 0.65 c,d | 15.35 a | 72.57 b,c | 1.38 ns |
| SMS 60%– RLV 30% | 11.43 a,b | 0.24 c,d | 1.08 e | 6.27 e | 66.53 a,b | 0.55 c,d | 0.64 a | 0.44 e | 0.37 e | 0.65 c | 0.43 e,f | 11.37 e,f | 75.13 a,b,c | 1.46 ns |
| SMS 60%– RLV 40% | 10.89 b,c | 0.33 b | 1.54 b,c | 10.85 b,c | 67.39 a | 0.55 c,d | 0.23 d | 0.75 c | 0.21 f,g | 0.22 f | 0.97 b | 6.07 h | 80.20 a,b | 1.49 ns |
| SMS 50%– RLV 40% | 11.03 a,b | 0.24 c,d | 1.36 d | 13.11 a | 58.23 c | 0.57 b,c | 0.53 b | 0.89 b | 0.29 e,f | 0.41 e | 1.29 a | 12.05 d,e | 74.10 a,b,c | 1.35 ns |
| WS | 11.23 a,b | 0.32 b | 0.96 e,f | 11.24 b | 62.57 a,b,c | 0.57 b,c | 0.27 d | 0.30 f | 0.25 f,g | 0.85 b | 1.00 b | 10.44 f | 76.50 a,b,c | 1.44 ns |
| Substrate | DPPH (mg trx/g) | ABTS (mg trx/g) | FRAP (mg trx/g) |
|---|---|---|---|
| SMS * 100% | 11.84 ± 0.03 b,c ** | 2.42 ± 0.01 ns | 12.25 ± 0.50 a |
| SMS 90% | 11.00 ± 0.26 d | 2.00 ± 0.64 ns | 6.29 ± 0.08 g |
| SMS 80% | 11.45 ± 0.01 c,d | 2.30 ± 0.87 ns | 9.51 ± 0.31 d,e |
| SMS 90%–RLV 10% | 4.23 ± 0.02 e | 2.23 ± 0.10 ns | 6.30 ± 0.11 g |
| SMS 80%–RLV 10% | 12.65 ± 0.45 a | 2.33 ± 0.10 ns | 10.46 ± 0.19 b,c,d |
| SMS 80%–RLV 20% | 12.65 ± 0.05 a | 2.05 ± 0.98 ns | 7.14 ± 0.31 f,g |
| SMS 70%–RLV 20% | 12.83 ± 0.24 a | 2.46 ± 0.19 ns | 11.40 ± 0.53 a,b |
| SMS 70%–RLV 30% | 12.64 ± 0.36 a | 2.17 ± 0.66 ns | 7.94 ± 0.11 f |
| SMS 60%–RLV 30% | 12.45 ± 0.25 a | 2.42 ± 0.21 ns | 9.19 ± 0.41 e |
| SMS 60%–RLV 40% | 11.50 ± 0.01 c,d | 2.46 ± 0.10 ns | 10.26 ± 0.21 c,d |
| SMS 50%–RLV 40% | 12.39 ± 0.20 a,b | 2.51 ± 0.06 ns | 10.04 ± 0.35 c,d,e |
| WS | 10.92 ± 0.03 d | 2.41 ± 0.23 ns | 10.86 ± 0.45 b,c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Melanouri, E.-M.; Diamantis, I.; Dedousi, M.; Dalaka, E.; Antonopoulou, P.; Papanikolaou, S.; Politis, I.; Theodorou, G.; Diamantopoulou, P. Pleurotus ostreatus: Nutritional Enhancement and Antioxidant Activity Improvement Through Cultivation on Spent Mushroom Substrate and Roots of Leafy Vegetables. Fermentation 2025, 11, 20. https://doi.org/10.3390/fermentation11010020
Melanouri E-M, Diamantis I, Dedousi M, Dalaka E, Antonopoulou P, Papanikolaou S, Politis I, Theodorou G, Diamantopoulou P. Pleurotus ostreatus: Nutritional Enhancement and Antioxidant Activity Improvement Through Cultivation on Spent Mushroom Substrate and Roots of Leafy Vegetables. Fermentation. 2025; 11(1):20. https://doi.org/10.3390/fermentation11010020
Chicago/Turabian StyleMelanouri, Eirini-Maria, Ilias Diamantis, Marianna Dedousi, Eleni Dalaka, Paraskevi Antonopoulou, Seraphim Papanikolaou, Ioannis Politis, Georgios Theodorou, and Panagiota Diamantopoulou. 2025. "Pleurotus ostreatus: Nutritional Enhancement and Antioxidant Activity Improvement Through Cultivation on Spent Mushroom Substrate and Roots of Leafy Vegetables" Fermentation 11, no. 1: 20. https://doi.org/10.3390/fermentation11010020
APA StyleMelanouri, E.-M., Diamantis, I., Dedousi, M., Dalaka, E., Antonopoulou, P., Papanikolaou, S., Politis, I., Theodorou, G., & Diamantopoulou, P. (2025). Pleurotus ostreatus: Nutritional Enhancement and Antioxidant Activity Improvement Through Cultivation on Spent Mushroom Substrate and Roots of Leafy Vegetables. Fermentation, 11(1), 20. https://doi.org/10.3390/fermentation11010020

