Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains, Plasmids, and Cultivation Conditions
2.2. Construction of Mutant Strains
2.3. Determination and Analytical Methods
2.3.1. Biomass and AD Yield Determination
2.3.2. Intracellular Reactive Oxygen Species (ROS) and Cell Viability Assay
3. Results and Discussion
3.1. FadA5 Is a Key Enzyme in AD Synthesis
3.2. MSP Phytosterol Metabolism Is Affected by Redox Potential
3.3. FadA5 Modification Can Improve the Adaptability of Strains to Oxidation and Reduction
3.4. Evaluation of Production Performance of MSP-fA5C87A/ΔfA5
3.5. Co-Expression of VHb and PrpR Enhances AD Production Performance of MSP-fA5C87A/ΔfA5
3.6. Conversion of Phytosterols Through Repeated Batch Fermentation
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Zhao, A.; Zhang, X.; Li, Y.; Wang, Z.; Lv, Y.; Liu, J.; Alam, M.A.; Xiong, W.; Xu, J. Mycolicibacterium Cell Factory for the Production of Steroid-Based Drug Intermediates. Biotechnol. Adv. 2021, 53, 107860. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Ke, J.; Luo, Z.-K.; Xiong, L.-B.; Dong, Y.-G.; Wei, D.-Z.; Wang, F.-Q. Driving the Conversion of Phytosterol to 9α-Hydroxy-4-Androstene-3,17-Dione in Mycolicibacterium Neoaurum by Engineering the Supply and Regeneration of Flavin Adenine Dinucleotide. Biotechnol. Biofuels 2023, 16, 98. [Google Scholar] [CrossRef] [PubMed]
- Ke, X.; Cui, J.-H.; Ren, Q.-J.; Zheng, T.; Wang, X.-X.; Liu, Z.-Q.; Zheng, Y.-G. Rerouting Phytosterol Degradation Pathway for Directed Androst-1,4-Diene-3,17-Dione Microbial Bioconversion. Appl. Microbiol. Biotechnol. 2024, 108, 186. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Xiao, P.; Pan, D.; Zhou, X. New Insights into the Modification of the Non-Core Metabolic Pathway of Steroids in Mycolicibacterium and the Application of Fermentation Biotechnology in C-19 Steroid Production. Int. J. Mol. Sci. 2023, 24, 5236. [Google Scholar] [CrossRef] [PubMed]
- Su, Z.; Zhang, Z.; Yu, J.; Yuan, C.; Shen, Y.; Wang, J.; Su, L.; Wang, M. Combined Enhancement of the Propionyl-CoA Metabolic Pathway for Efficient Androstenedione Production in Mycolicibacterium neoaurum. Microb. Cell Factories 2022, 21, 218. [Google Scholar] [CrossRef]
- Fernández-Cabezón, L.; Galán, B.; García, J.L. New Insights on Steroid Biotechnology. Front. Microbiol. 2018, 9, 958. [Google Scholar] [CrossRef]
- Yuan, C.; Ma, Z.; Li, Y.; Zhang, J.; Liu, X.; Han, S.; Du, G.; Shi, J.; Sun, J.; Zhang, B. Production of 21-Hydroxy-20-Methyl-Pregna-1,4-Dien-3-One by Modifying Multiple Genes in Mycolicibacterium. Appl. Microbiol. Biotechnol. 2023, 107, 1563–1574. [Google Scholar] [CrossRef]
- Hansen, J.; Kolbe, K.; König, I.R.; Scherließ, R.; Hellfritzsch, M.; Malm, S.; Müller-Loennies, S.; Zallet, J.; Hillemann, D.; Wiesmüller, K.-H.; et al. Lipobiotin-Capture Magnetic Bead Assay for Isolation, Enrichment and Detection of Mycobacterium Tuberculosis from Saliva. PLoS ONE. 2022, 17, e0265554. [Google Scholar] [CrossRef]
- Traag, B.A.; Driks, A.; Stragier, P.; Bitter, W.; Broussard, G.; Hatfull, G.; Chu, F.; Adams, K.N.; Ramakrishnan, L.; Losick, R. Do Mycobacteria Produce Endospores? Proc. Natl. Acad. Sci. USA 2009, 107, 878–881. [Google Scholar] [CrossRef]
- Anbazhagan, P.; Harijan, R.K.; Kiema, T.R.; Janardan, N.; Murthy, M.R.N.; Michels, P.A.M.; Juffer, A.H.; Wierenga, R.K. Phylogenetic Relationships and Classification of Thiolases and Thiolase-like Proteins of Mycobacterium Tuberculosis and Mycobacterium Smegmatis. Tuberculosis 2014, 94, 405–412. [Google Scholar] [CrossRef]
- Schaefer, C.M.; Lu, R.; Nesbitt, N.M.; Schiebel, J.; Sampson, N.S.; Kisker, C. FadA5 a Thiolase from Mycobacterium Tuberculosis: A Steroid-Binding Pocket Reveals the Potential for Drug Development against Tuberculosis. Structure 2015, 23, 21–33. [Google Scholar] [CrossRef] [PubMed]
- Yuan, C.-Y.; Ma, Z.-G.; Zhang, J.-X.; Liu, X.-C.; Du, G.-L.; Sun, J.-S.; Shi, J.-P.; Zhang, B.-G. Production of 9,21-Dihydroxy-20-Methyl-Pregna-4-En-3-One from Phytosterols in Mycobacterium Neoaurum by Modifying Multiple Genes and Improving the Intracellular Environment. Microb. Cell Factories 2021, 20, 229. [Google Scholar] [CrossRef] [PubMed]
- Thomas, S.T.; Yang, X.; Sampson, N.S. Inhibition of the M. Tuberculosis 3β-Hydroxysteroid Dehydrogenase by Azasteroids. Bioorg. Med. Chem. Lett. 2011, 21, 2216–2219. [Google Scholar] [CrossRef] [PubMed]
- Yao, K.; Wang, F.Q.; Zhang, H.C.; Wei, D.Z. Identification and Engineering of Cholesterol Oxidases Involved in the Initial Step of Sterols Catabolism in Mycobacterium Neoaurum. Metab. Eng. 2013, 15, 75–87. [Google Scholar] [CrossRef]
- Child, S.A.; Ghith, A.; Bruning, J.B.; Bell, S.G. A Comparison of Steroid and Lipid Binding Cytochrome P450s from Mycobacterium Marinum and Mycobacterium Tuberculosis. J. Inorg. Biochem. 2020, 209, 111116. [Google Scholar] [CrossRef]
- Niu, Y.; Ge, F.; Yang, Y.; Ren, Y.; Li, W.; Chen, G.; Wen, D.; Liu, F.; Xiong, L. Biochemical Characterization of Acyl-Coenzyme A Synthetases Involved in Mycobacterial Steroid Side-Chain Catabolism and Molecular Design: Synthesis of an Anti-Mycobacterial Agent. 3 Biotech 2019, 9, 169. [Google Scholar] [CrossRef]
- Wipperman, M.F.; Sampson, N.S.; Thomas, S.T. Pathogen Roid Rage: Cholesterol Utilization by Mycobacterium tuberculosis. Crit. Rev. Biochem. Mol. Biol. 2014, 49, 269–293. [Google Scholar] [CrossRef]
- Xiao, P.; Pan, D.; Li, F.; Liu, Y.; Huang, Y.; Zhou, X.; Zhang, Y. Effect of TetR Family Transcriptional Regulator PccD on Phytosterol Metabolism of Mycolicibacterium. Microorganisms 2024, 12, 2349. [Google Scholar] [CrossRef]
- Van der Geize, R.; Yam, K.; Heuser, T.; Wilbrink, M.H.; Hara, H.; Anderton, M.C.; Sim, E.; Dijkhuizen, L.; Davies, J.E.; Mohn, W.W.; et al. A Gene Cluster Encoding Cholesterol Catabolism in a Soil Actinomycete Provides Insight into Mycobacterium tuberculosis Survival in Macrophages. Proc. Natl. Acad. Sci. USA 2007, 104, 1947–1952. [Google Scholar] [CrossRef]
- Jaiswal, A.K.; Husaini, S.H.A.; Kumar, A.; Subbarao, N. Designing Novel Inhibitors against Mycobacterium Tuberculosis FadA5 (Acetyl-CoA Acetyltransferase) by Virtual Screening of Known Anti-Tuberculosis (Bioactive) Compounds. Bioinformation 2018, 14, 327–336. [Google Scholar] [CrossRef]
- Nesbitt, N.M.; Yang, X.; Fontán, P.; Kolesnikova, I.; Smith, I.; Sampson, N.S.; Dubnau, E. A Thiolase of Mycobacterium tuberculosis Is Required for Virulence and Production of Androstenedione and Androstadienedione from Cholesterol. Infect. Immun. 2010, 78, 275–282. [Google Scholar] [CrossRef] [PubMed]
- Song, S.; He, J.; Gao, M.; Huang, Y.; Cheng, X.; Su, Z. Loop Pathways Are Responsible for Tuning the Accumulation of C19- and C22-Sterol Intermediates in the Mycobacterial Phytosterol Degradation Pathway. Microb. Cell Factories 2023, 22, 19. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.Q.; Liu, Y.J.; Yao, K.; Liu, H.H.; Tao, X.Y.; Wang, F.Q.; Wei, D.Z. Unraveling and Engineering the Production of 23,24-Bisnorcholenic Steroids in Sterol Metabolism. Sci. Rep. 2016, 6, 21928. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, H.F.; Lennox, B.J.; Mossman, C.D.; Carle, W.C. The Relation of Acyl Transfer to the Overall Reaction of Thiolase I from Porcine Heart. J. Biol. Chem. 1981, 256, 7371–7377. [Google Scholar] [CrossRef] [PubMed]
- Lu, R.; Schaefer, C.M.; Nesbitt, N.M.; Kuper, J.; Kisker, C.; Sampson, N.S. Catabolism of the Cholesterol Side Chain in Mycobacterium tuberculosis Is Controlled by a Redox-Sensitive Thiol Switch. ACS Infect. Dis. 2017, 3, 666–675. [Google Scholar] [CrossRef]
- Han, S.; Liu, X.; He, B.; Zhai, X.; Yuan, C.; Li, Y.; Lin, W.; Wang, H.; Zhang, B. Efficient Production of 9,22-Dihydroxy-23,24-Bisnorchol-4-Ene-3-One from Phytosterols by Modifying Multiple Genes in Mycobacterium Fortuitum. Int. J. Mol. Sci. 2024, 25, 3579. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhou, X.; Yao, Y.; Xu, Q.; Shi, H.; Wang, K.; Feng, W.; Shen, Y. Coexpression of VHb and MceG Genes in Mycobacterium Sp. Strain LZ2 Enhances Androstenone Production via Immobilized Repeated Batch Fermentation. Bioresour. Technol. 2021, 342, 125965. [Google Scholar] [CrossRef]
- Zhou, X.; Zhang, Y.; Shen, Y.; Zhang, X.; Xu, S.; Shang, Z.; Xia, M.; Wang, M. Efficient Production of Androstenedione by Repeated Batch Fermentation in Waste Cooking Oil Media through Regulating NAD+/NADH Ratio and Strengthening Cell Vitality of Mycobacterium Neoaurum. Bioresour. Technol. 2019, 279, 209–217. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhou, X.; Wang, X.; Wang, L.; Xia, M.; Luo, J.; Shen, Y.; Wang, M. Improving Phytosterol Biotransformation at Low Nitrogen Levels by Enhancing the Methylcitrate Cycle with Transcriptional Regulators PrpR and GlnR of Mycobacterium Neoaurum. Microb. Cell Factories 2020, 19, 13. [Google Scholar] [CrossRef]
- Xie, R.; Shen, Y.; Qin, N.; Wang, Y.; Su, L.; Wang, M. Genetic Differences in ksdD Influence on the ADD/AD Ratio of Mycobacterium neoaurum. J. Ind. Microbiol. Biotechnol. 2015, 42, 507–513. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, J.; Yuan, C.; Du, G.; Han, S.; Shi, J.; Sun, J.; Zhang, B. Improving the Production of 9α-Hydroxy-4-Androstene-3,17-Dione from Phytosterols by 3-Ketosteroid-Δ1-Dehydrogenase Deletions and Multiple Genetic Modifications in Mycobacterium Fortuitum. Microb. Cell Factories 2023, 22, 53. [Google Scholar] [CrossRef] [PubMed]
- Claudino, M.J.C.; Soares, D.; Van Keulen, F.; Marques, M.P.C.; Cabral, J.M.S.; Fernandes, P. Immobilization of Mycobacterial Cells onto Silicone—Assessing the Feasibility of the Immobilized Biocatalyst in the Production of Androstenedione from Sitosterol. Bioresour. Technol. 2007, 99, 2304–2311. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.-J.; Wang, L.; Liu, H.-H.; Liu, Y.-J.; Ren, Y.-H.; Wang, F.-Q.; Wei, D.-Z. Characterization and Engineering Control of the Effects of Reactive Oxygen Species on the Conversion of Sterols to Steroid Synthons in Mycobacterium Neoaurum. Metab. Eng. 2019, 56, 97–110. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; He, B.; Zhang, J.; Yuan, C.; Han, S.; Du, G.; Shi, J.; Sun, J.; Zhang, B. Phytosterol Conversion into C9 Non-Hydroxylated Derivatives through Gene Regulation in Mycobacterium Fortuitum. Appl. Microbiol. Biotechnol. 2023, 107, 7635–7646. [Google Scholar] [CrossRef]
- Olivera, E.R.; Luengo, J.M. Steroids as Environmental Compounds Recalcitrant to Degradation: Genetic Mechanisms of Bacterial Biodegradation Pathways. Genes 2019, 10, 512. [Google Scholar] [CrossRef]
- Thomas, S.T.; Sampson, N.S. Mycobacterium tuberculosisUtilizes a Unique Heterotetrameric Structure for Dehydrogenation of the Cholesterol Side Chain. Biochemistry 2013, 52, 2895–2904. [Google Scholar] [CrossRef]
- Su, L.; Shen, Y.; Xia, M.; Shang, Z.; Xu, S.; An, X.; Wang, M. Overexpression of Cytochrome P450 125 in Mycobacterium: A Rational Strategy in the Promotion of Phytosterol Biotransformation. J. Ind. Microbiol. Biotechnol. 2018, 45, 857–867. [Google Scholar] [CrossRef]
- Xiong, L.-B.; Liu, H.-H.; Xu, L.-Q.; Sun, W.-J.; Wang, F.-Q.; Wei, D.-Z. Improving the Production of 22-Hydroxy-23,24-Bisnorchol-4-Ene-3-One from Sterols in Mycobacterium Neoaurum by Increasing Cell Permeability and Modifying Multiple Genes. Microb. Cell Factories 2017, 16, 89. [Google Scholar] [CrossRef]
- Grimalt-Alemany, A.; Etler, C.; Asimakopoulos, K.; Skiadas, I.V.; Gavala, H.N. ORP Control for Boosting Ethanol Productivity in Gas Fermentation Systems and Dynamics of Redox Cofactor NADH/NAD+ under Oxidative Stress. J. CO2 Util. 2021, 50, 101589. [Google Scholar] [CrossRef]
- Dai, J.-J.; Cheng, J.-S.; Liang, Y.-Q.; Jiang, T.; Yuan, Y.-J. Regulation of Extracellular Oxidoreduction Potential Enhanced (R,R)-2,3-Butanediol Production by Paenibacillus Polymyxa CJX518. Bioresour. Technol. 2014, 167, 433–440. [Google Scholar] [CrossRef]
- Szentirmai, A. Microbial Physiology of Sidechain Degradation of Sterols. J. Ind. Microbiol. 1990, 6, 101–115. [Google Scholar] [CrossRef]






| Strain, Plasmid, or Primer | Significant Properties | Source or Purpose |
|---|---|---|
| Strain | ||
| Mycolicibacterium sp. LZ2 | Wild type | [27] |
| Escherichia coli DH5α | General cloning host | Transgen Biotech |
| MSP-261 | MSP carrying vector pMV261 | This work |
| MSP-fA5 | FadA5 overexpression in MSP | This work |
| MSPΔfA5 | FadA5 deletion mutant of MSP | This work |
| MSPΔfA5::fA5 | FadA5 overexpression in MSPΔfA5 | This work |
| MSP-fA5C87A | FadA5 mutant overexpression in MSP | This work |
| MSP-fA5C87A/ΔfA5 | FadA5 mutant overexpression in MSPΔfA5 | This work |
| MSP-fA5C87A-VP/ΔfA5 | VHb and PrpR co-expression in MSP-fA5C87A/ΔfA5 | This work |
| Plasmid | ||
| pMV261-fA5 | pMV261 carrying fadA5 | This work |
| pMV261-fA5C87A | pMV261 carrying fadA5C87A | This work |
| pMV261-vgb | pMV261 carrying vgb | [27] |
| pMV261-prpR | pMV261 carrying prpR | [29] |
| p2G19-fA5 | p2NIL carrying the homologous arms of fadA5 and the selection markers from pGOAL19 | This work |
| pMV261-vgb-prpR | pMV261 carrying vgb and prpR | This work |
| Primer | ||
| 2-fa5F | GGATCCAGCTGCAGAATTCATGGGTAATCCTGTCATCGT | fadA5 amplification |
| 2-fa5R | CGCTAGTTAACTACGTCGACTCAGATCCTTTCGATGATGG | fadA5 amplification |
| F5UP-F | ATAAACTACCGCATTAAAGCTTCGTTCCTTCTTGTAGAGCTC | fadA5 deletion |
| F5UP-R | GTCCATGTCGTACTGGGTGACGCAGCCGC | fadA5 deletion |
| F5DO-F | CCCAGTACGACATGGACAAGGTCAACGT | fadA5 deletion |
| F5DO-R | ATTTAGGTGACACTATAGAATACATAGGTCGCAGATCAGGATCGGGA | fadA5 deletion |
| MF5-F | CACCATCGACgcCCAGTGCGGCAGC | fadA5 mutation |
| MF5-R | GTGGCACCCACGTGCTCG | fadA5 mutation |
| 2-vpF | CAAGCCGTCGAGTGAGAGAGGTGACCACAACGACGC | prpR amplification |
| 2-vpR | GTCGATCGTACGCTAGTTTGATGCCTGGCAGTCGATCG | prpR amplification |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, X.; Liu, Y.; Li, F.; Huang, Y.; Xuan, H.; Zhang, Y. Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity. Fermentation 2024, 10, 627. https://doi.org/10.3390/fermentation10120627
Zhou X, Liu Y, Li F, Huang Y, Xuan H, Zhang Y. Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity. Fermentation. 2024; 10(12):627. https://doi.org/10.3390/fermentation10120627
Chicago/Turabian StyleZhou, Xiuling, Yuying Liu, Fuyi Li, Yang Huang, Hongzhuan Xuan, and Yang Zhang. 2024. "Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity" Fermentation 10, no. 12: 627. https://doi.org/10.3390/fermentation10120627
APA StyleZhou, X., Liu, Y., Li, F., Huang, Y., Xuan, H., & Zhang, Y. (2024). Enhancement of the Degradation of Phytosterol Side Chains in Mycolicibacterium by Eliminating the Redox Sensitivity of Key Thiolase and Augmenting Cell Activity. Fermentation, 10(12), 627. https://doi.org/10.3390/fermentation10120627
