Next Article in Journal
Development and Large-Scale Production of High-Oleic Acid Oil by Fermentation of Microalgae
Next Article in Special Issue
A Novel Wild-Type Lacticaseibacillus paracasei Strain Suitable for the Production of Functional Yoghurt and Ayran Products
Previous Article in Journal
Technical and Economic Analyses for the Implementation of a Biohydrogen Production System Using Bioelectricity from Vinasse Biogas of the Sugarcane and Alcohol Industry
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Stimulation of Hair Growth Effect by Fermented Ginsenosides Using Levilactobacillus brevis THK-D437

1
Graduate School of Biotechnology, Kyung Hee University, 1732 Deogyeong-daero, Giheung, Yongin 17104, Republic of Korea
2
Snowwhitefactory Co., Ltd., 184, Jungbu-daero, Giheung, Yongin 17905, Republic of Korea
3
Department of Dermatology, Graduate School, Kyung Hee University, 26 Kyungheedae-ro, Dong-daemun, Seoul 02447, Republic of Korea
4
Department of Biopharmaceutical Biotechnology, Graduate School, Kyung Hee University, 1732 Deogyeong-daero, Giheung, Yongin 17104, Republic of Korea
*
Author to whom correspondence should be addressed.
Fermentation 2024, 10(11), 565; https://doi.org/10.3390/fermentation10110565
Submission received: 30 September 2024 / Revised: 28 October 2024 / Accepted: 4 November 2024 / Published: 5 November 2024

Abstract

:
Hair growth is crucial for physiological functions and psychological well-being, leading to an increasing demand for research in this area. While low-molecular ginsenosides have been shown to promote hair growth in mice, studies on their effects are limited, and there is a lack of research examining the impact of ginsenoside fermentation products derived from lactic acid bacteria. This study investigated the hair-growth-promoting effect of fermented ginsenoside by fermentation of Levilactobacillus brevis THK-D437, which was isolated from the traditional Korean fermented food kimchi and features high β-glucosidase activity. In the cell-based MTT assay, the proliferation rate was increased by 25% in the fermented ginsenoside-treated group on human hair dermal papilla cells (HHDPCs). In the alopecia mouse model study (C57BL/6 mouse model), enhanced hair growth was observed in the fermented ginsenoside-treated mouse groups. Tissue histological analyses showed that the number of hair follicles and the thickness of the epidermis, respectively, were increased in the fermented ginsenoside-treated mouse groups. These results suggested that fermented ginsenoside has a promoting effect on hair growth and a retarding effect on the catagen stage. Therefore, fermented ginseng products might be a new potential therapeutic candidate for promoting hair growth.

1. Introduction

Hair growth plays a vital role not only in physiological functions but also in social identity and psychological well-being, with hair loss significantly impacting self-esteem and mental health. There is a consistent demand for research on hair growth that is driven by the need to enhance various dimensions of health and overall quality of life [1]. Hair growth is a complex and cyclically controlled process that is characterized by a period of active growth (anagen), a brief regression phase (catagen), and a resting period (telogen) [2]. Additionally, changes in the cycle of hair growth involve remodeling of both the epithelial and dermal parts of the hair follicle [3,4]. The dermal papilla, located in the hair follicle, is an essential component of the hair follicle and stimulates the production of new follicles and the maintenance of anagen phases [5,6]. Despite the critical importance of this process, only a limited number of regulatory mechanisms (e.g., genes and signaling pathways) governing the hair cycle have been identified, and many details remain poorly understood.
Panax ginseng (P. ginseng) C. A. Meyer, a staple herb in traditional oriental medicine, is renowned for its pharmacological and biological activities, which are primarily attributed to its major components, i.e., ginsenosides, which possess various beneficial properties, including anticancer effects, anti-inflammatory actions, and immune modulation aspects [7,8,9,10]. However, the large molecular glucoside, which is abundant in P. ginseng, is not absorbed in the human body without a degradation process [11]. To improve the bioavailability of ginsenosides, and thereby fully exploit their beneficial effects in humans, the production of low-molecular ginsenosides has garnered considerable attention.
Previous research on ginsenoside transformations involved almost chemical and physiological reactions, such as acid treatment and heating [12,13]. However, conventional methods for producing low-molecular-weight ginsenosides have been constrained by limited conversion pathways, resulting in the predominant generation of only a restricted set of low-molecular-weight ginsenosides, such as Rg3 or Rh2. For these reasons, studies on the biotransformation of ginsenosides through alternative microbial pathways have been conducted. As a result, it has been confirmed that biological conversion methods can produce low-molecular-weight ginsenosides, such as ginsenoside F2 and compound K, which are not obtainable through conventional means. Moreover, compound K, a low-molecular-weight ginsenoside produced through these biological conversion methods, has demonstrated therapeutic effects with rheumatoid arthritis, anti-inflammatory effects in collagen-induced arthritis (CIA) models, and mitigation of RANKL-induced osteoclastogenesis [14,15,16]. These findings underscore the necessity for further research aimed at increasing the production of compound K.
However, these microorganisms are primarily derived from soil, and most consist of strains that have limitations in terms of human applications, resulting in very low practical applicability in the food industry [17,18]. Therefore, there is a need for research on the biological conversion of ginsenosides using safer bacteria. As a result, various lactic acid bacteria such as Lactobacillus plantarum [19], Lactobacillus pentosus [20], and Leuconostoc citreum [21] were isolated from kimchi to study the biotransformation of ginsenosides. While these studies have verified the potential for low-molecular ginsenoside fermentation using kimchi-derived lactic acid bacteria, they still fall short of linking the fermentation products to functional studies. In previous research, low-molecular ginsenosides have been shown to promote hair growth in C57BL/6 mice by enhancing the expression of Wnt pathway-related factors, including an increase in β-catenin and Lef-1, while decreasing DKK-1 during the transition to catagen [22]. However, the effects of these low-molecular ginsenosides on hair growth are quite limited, and there have been no studies on the hair growth effects of ginsenoside fermentation products derived from lactic acid bacteria.
In this study, we isolated and identified Levilactobacillus brevis THK-D437, which exhibits β-glucosidase activity, from kimchi. By fermenting this strain, we converted major ginsenosides into their compound-K-contained fermented ginsenosides. We then assessed the effects of these fermented ginsenosides on hair growth using a C57BL/6 mouse model and investigated their influence on the proliferation of human hair dermal papilla cells (HHDPCs). This research not only fills a gap in the current literature but also highlights the potential application of fermented ginsenosides in promoting hair growth, thereby contributing to both scientific knowledge and practical solutions in the field of hair care.

2. Materials and Methods

2.1. Isolation of β-Glucosidase Producing Bacterial Strain

Strain THK-D437 was isolated from traditional fermented food, kimchi, in South Korea. The kimchi sample was suspended in a 0.85% NaCl solution and subjected to a 10-fold serial dilution from 10−5 to 10−9, followed by spreading on BCP plate count agar (Eiken chemical Co., Tokyo, Japan). The inoculated BCP plates were incubated at 30 °C for 48 h, after which colonies that produced a yellow halo were selected and transferred onto bile esculin agar plates (Difco Laboratories Inc., Detroit, MI, USA). The strains exhibiting a black halo around their colonies on the bile esculin agar plates were identified as possessing β-glucosidase activity and were subsequently transferred to MRS agar plates for propagation. Following this, the strains were routinely cultured in MRS broth (Difco Laboratories Inc., Detroit, MI, USA) and on MRS agar plates (Difco Laboratories Inc., Detroit, MI, USA).

2.2. Identification of Levilactobacillus brevis THK-D437

The Gram reaction test was performed using the non-staining method, as described by Buck [23]. Briefly, colonies of the cultured strain from MRS agar plates incubated for 48 h were transferred onto a glass slide, followed by the addition of a 3% KOH solution (w/v) to initiate the reaction. If there was no change in the characteristics of the colony, it was determined to be Gram-positive. Conversely, if the mixture of the colony and KOH solution became viscous due to cytoplasmic leakage, it was classified as Gram-negative.
Cell morphology was observed using a light microscope (BX50, Olympus, Tokyo, Japan) at ×1000 magnification, utilizing cells grown for 48 h at 30 °C on MRS agar. Catalase activity was assessed using 3% hydrogen peroxide (v/v); a reaction that produced bubbles indicated a positive result, while a lack of reaction indicated a negative result.
Carbon source utilization was tested using API 50CH following the manufacturer’s instructions (bioMérieux, Craponne, France). The 16S rRNA gene sequence for strain THK-D437 was determined as described below. Genomic DNA extraction was performed using a commercial genomic DNA extraction kit (Solgent Co. Ltd., Daejeon, Korea). The 16S rRNA gene of strain THK-D437 was amplified from chromosomal DNA using a universal bacterial primer set consisting of 27F (5′ AGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′ GGTTACCTTGTTACGACTT 3′). The 16S rRNA gene sequences of related taxa were obtained from the EzBioCloud database (https://www.ezbiocloud.net/identify, accessed on 6 December 2023), and a phylogenetic tree was reconstructed using the neighbor-joining method in the MEGA X program [24,25].

2.3. Fermentation of Ginsenosides

The ginsenosides Rb1, Rb2, Rc, Rd, F2, and compound K used in the fermentation experiments were purchased from Dalian Green Bio Ltd. (Dalian, China). To achieve the fermentation of high-molecular-weight ginsenosides, a mixture of ginsenosides Rb1, Rb2, Rc, and Rd was prepared in MRS broth to a final concentration of 200 ppm. Subsequently, strain THK-D437, which had been cultured in an MRS liquid medium for 24 h, was inoculated at a concentration of 1% (v/v) and incubated at 30 °C without stirring. The degree of fermentation of the ginsenosides was assessed by sampling at 5, 10, 15, and 20 days of incubation. After fermentation, the culture medium was centrifuged at 12,000 rpm for 10 min at 4 °C, and the supernatant was mixed with an equal volume of water-saturated n-butanol for extraction. The mixture was then centrifuged at 3000 rpm for 5 min, and the n-butanol layer was collected for further analysis by thin-layer chromatography (TLC) and LC/MS.

2.4. Analysis of Ginsenosides by Chromatography

2.4.1. TLC Analysis

The n-butanol extracts were spotted at 50 μL on TLC plates. TLC was performed using a 60F264 silica gel plate (Merck, Darmstadt, Germany) with CHCl3-CH3OH-H2O (65:35:10, v/v, lower phase) as the developing solvent. The spots were visualized by spraying with 10% (v/v) H2SO4 and heating at 110 °C for 10 min.

2.4.2. LC/MS Analysis

Sample extraction was performed as described above, and the extracts were completely dried using a vacuum rotary evaporator. The dried samples were re-dissolved in 50% ethanol and then cleaned up using an SPE C18 cartridge (Waters, Milford, CT, USA). Separation was achieved using a C18 column (YMC, Kyoto, Japan) with a mobile phase consisting of acetonitrile (solvent A) and distilled water (solvent B) in a concentration gradient. Detection was performed using a PDA detector (Waters, Milford, CT, USA) and an SQ mass detector (Waters, Milford, CT, USA).

2.5. Cell Culture

HHDPCs were purchased from Sciencell (Carlsbad, CA, USA). The HHDPCs were cultured in a Mesenchymal Stem Cell (MSC) medium (Science Cell, Carlsbad, CA, USA) which contained 5% fetal bovine serum (FBS) (Gibco-BRL, Grand Island, NE, USA) and 1% penicillin/streptomycin (Cambrex, Walkersville, MD, USA). The cells were incubated at 37 °C in an atmosphere containing 5% CO2.

2.6. MTT Assay

Cell proliferation and/or cell viability were evaluated using a cell-based MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide) assay. MTT was purchased from Sigma–Aldrich (St. Louis, MI, USA). Cells were seeded at 1 × 104 cells per well in 96-well plates using a hemocytometer. After 24 h of incubation, the cells were washed with PBS and cultured in an MSC medium containing the indicated concentrations of fermented ginsenosides (0.01, 0.1, 1, and 10 μg/mL as the final concentrations in the culture medium). Absorbance was measured at 570 nm using a microplate reader (Molecular Devices, San Jose, CA, USA). The cell proliferation rates were calculated from the optical density (OD) readings and were represented as percentages of the vehicle control value (untreated cells).

2.7. Analysis of Hair Growth Morphological and Histological Changes in Hair Follicles in C57BL/6 Mice

Six-week-old C57BL/6 male mice (Dae-Han Biolink, Seoul, Korea) were allowed to adapt to their new environment for 1 week, with food and water being provided ad libitum. C57BL/6 shaved the hair of 7-week-old mice in telogen, who were divided into groups, including 10 mice who had their hair cut short using animal clippers, and the hair cycle of the mice was then synchronized by chemical depilation via hair removal cream (Veet, Massy, France). Starting the following day, 100 μL of fermented ginsenosides (1 mg/mL in 70% ethanol) were applied topically every day for 18 days. Hair growth rates were evaluated by observation; the darkening pigmentation of the back skin color indicated a telogen to anagen conversion.
For analysis of histological changes, the back skin was obtained from the mice at 18 days after depilation. Dorsal skin samples were fixed with 4% paraformaldehyde (PFA) and then processed by paraffin wax embedding. Sections were cut at 5 μm and mounted on glass slides. All specimens were stained with hematoxylin and eosin, and the specimen samples were examined under fluorescent microscopy (A Carl Zeiss SMT AG, Oberkochen, Germany).

2.8. Statistical Analysis

Data are expressed as mean values ± standard deviations. The statistical significance of differences between mean values was tested using an independent two-tailed Student’s t-test. Statistical significance was set at * p < 0.05, ** p < 0.01, and *** p < 0.001.

3. Results and Discussion

3.1. Isolation and Identification of Levilactobacillus brevis THK-D437

Strain THK-D437 was isolated from kimchi, which was bought at the traditional market in Yongin, Korea. After spreading the kimchi sample on a BCP agar, we identified 437 strains that formed yellow halos, indicating potential classification as lactic acid bacteria. From these, we selected three strains that produced black halos on an esculin agar, ultimately choosing strain THK-D437 for its ability to biotransform ginsenosides. The physiological characteristics of strain THK-D437 are summarized in Table 1. Strain THK-D437 was Gram-positive, non-spore-forming, catalase-negative, facultatively anaerobic, and rod-shaped. In API 50CH tests, THK-D437 was positive for acid production of L-arabinose, D-ribose, D-xylose, D-galactose, D-glucose, D-fructose, methyl-α-D-glucopyranoside, esculin ferric citrate, D-maltose, and D-melobiose. The API 50CH test of the strain THK-D437indicated that its closest relative was Lactobacillus brevis 3 (96.7% similarity). In terms of the 16S rRNA gene sequence of the strain THK-D437, the closest relative was Levilactobacillus brevis ATCC 14869T (99.93% sequence similarity). This relationship between strain THK-D437 and other strains of the genus Levilactobacillus was shown in the phylogenetic tree (Figure 1). The NCBI GenBank accession number for the 16s rRNA gene sequence of strain THK-D437 is JX843770.

3.2. Biotransformation of Ginsenoside by Levilactobacillus brevis THK-D437

The time profile of the biotransformation of the ginsenoside mixture (Rb1, Rb2, Rc, and Rd) was detected by TLC analysis. As shown in Figure 2, compound K was slightly converted after 5 days and ginsenoside Rb1 was almost completely hydrolyzed after 20 days. Additionally, a generation of the substances was observed at a slightly lower Rf than compound K. These spots appear to be different compounds to the five ginsenosides used as standards. LC/MS analysis was performed at 0 day and 20 days of fermentation. Compared to ginsenosides contents before and after fermentation, ginsenoside Rb1, Rd, compound K, and Rh2 were −78.2%, +295.8%, +1102.1%, and +268%, respectively (Table 2). The ginsenosides Rb1, Rb2, Rc, and Rd were converted to minor ginsenosides by the fermentation of Levilactobacillus brevis THK-D437, as shown in Figure 3. According to Figure 3, the pathway showed that compound K and Rh2 are produced with the by-product ginsenosides F2 and Rg3. Therefore, in this study, L. brevis THK-D437 was confirmed to produce β-glucosidase, enabling the fermentation of major ginsenosides Rb1, Rb2, Rc, and Rd into the minor ginsenosides compound K and Rh2. Although Rg3 and F2 were not analyzed in the final fermentation products, it is presumed that they were produced as intermediate products based on the observed biotransformation pathway of ginsenosides. Previous studies have shown that compound K stimulates the expression of the HAS2 gene, thereby promoting hyaluronic acid synthesis [26]. Furthermore, ginsenoside Rh2 has demonstrated anti-inflammatory effects by inhibiting neovascularization, indicating potential therapeutic benefits in psoriasis treatment [27]. Consequently, the increases in compound K and ginsenoside Rh2 suggest their possible interaction with pathways related to hair follicle growth.

3.3. Effects of Fermented Ginsenosides on the Cell Viability and Proliferation of HHDPCs

An MTT assay was conducted to measure the effect of fermented ginsenosides on the proliferation of HHDPCs, with an untreated control group serving as the negative control and the commercial hair growth agent finasteride 0.2 μM serving as the positive control. The proliferation rates increased by 25% in the group treated with 0.1 μg/mL of fermented ginsenosides and by 10% in the finasteride-treated group after 24 h (Figure 4). These results suggest that the fermented ginsenosides did not exhibit cytotoxicity HHDPC proliferation and indicate their potential for promoting hair growth.
In this study, the results suggest that fermented ginsenosides exhibit no cytotoxicity in regard to HHDPCs. Furthermore, at certain concentrations, they promote cell proliferation beyond that of the positive control. These findings indicate that fermented ginsenosides do not exhibit cytotoxic effects in regard to HHDPC proliferation and suggest their potential for promoting hair growth [28,29]. Moreover, the results emphasize the role of dermal papilla cells, which are known for their importance in skin regeneration, highlighting the promise of fermented ginsenosides as a functional material that positively influences HHDPCs. Previous studies have indicated that these cells play a crucial role in wound healing, raising the possibility that fermented ginsenosides may also enhance the hair follicle regenerative processes [30]. This suggests that they could be valuable candidates for formulations aimed at wound healing, including the inhibition of scar formation.

3.4. Hair Growth Stimulation Effect of Fermented Ginsenosides in the C57BL/6 Mouse Model

After treatment of fermented ginsenosides into the back skin of the C57BL/6 mice for 18 days, characteristic changes in the hair cycle were easily observed depending on the back skin color. At one week after treatment, short hair was visible on the back skin of the mice treated with fermented ginsenosides, while hair growth was rarely observed on the back skin of the mice treated with vehicle only, as well as in the control group (Figure 5A). Therefore, fermented ginsenosides produced by L. brevis THK-D437 induce hair growth by delaying the hair cycle during the induction of the catagen phase. These findings are consistent with previous research by Song et al. [31], which emphasized the role of fermented red ginseng in promoting hair growth and extending the anagen phase of the hair cycle. Fermented red ginseng contains low-molecular-weight ginsenosides. However, low-molecular-weight ginsenosides primarily produced through heat treatment during the manufacturing process do not follow the biotransformation pathway leading to ginsenoside F2 and compound K, suggesting the possibility that the composition of the fermented ginsenosides produced by L. brevis THK-D437 differs from those in other studies. Furthermore, the observed increase in hair length in the treatment group as early as one week post-treatment indicates a rapid response, underscoring the efficacy of these bioactive compounds in promoting hair growth.

3.5. Analysis of Histological Changes in the Skin Tissue of Mice Treated with Fermented Ginsenosides

An analysis of the histological changes in the skin tissue of mice treated with fermented ginsenosides produced by L. brevis THK-D437 is presented in Figure 5B. The results showed an increase in the number, size, depth, and length of hair follicles in the group treated with fermented ginsenosides. These findings suggest that fermented ginsenosides produced by L. brevis THK-D437 regulate the hair growth cycle, leading to an increase in hair follicle count and thickness, thereby effectively preventing hair loss.
Shin et al. conducted a study using C57BL/6 mice to investigate the hair growth effects of low-molecular-weight ginsenosides, finding that the group treated with F2 exhibited delayed hair cycles and had longer, larger hair follicles compared to the finasteride-treated group, thereby reducing hair loss [32]. This aligns with our findings that low-molecular-weight ginsenosides produced through biotransformation also delay the hair cycle and help prevent hair loss. However, our study does not clarify how the various ginsenoside components in the mixed fermented product interact to produce these effects. Future research on low-molecular-weight ginsenosides related to hair growth is expected to clarify these interactions.

4. Conclusions

In this study, we isolated a lactic acid bacterium capable of converting major ginsenosides Rb1, Rb2, Rc, and Rd into the minor ginsenosides Rh2 and compound K, identifying the isolate as L. brevis THK-D437 through 16S rRNA sequencing. We suggest that the fermented ginsenosides produced by L. brevis THK-D437 play a significant role in stimulating hair growth, highlighting the potential for these compounds to serve as natural alternatives in hair loss prevention and treatment.
The findings of this research contribute to the understanding of how low-molecular-weight ginsenosides can be utilized in commercial applications, such as in hair and skin care products. Future studies should explore the efficacy of these compounds at various concentrations, investigate their synergistic effects with other ginsenosides, and further elucidate the underlying mechanisms by which they promote hair growth. Overall, this research lays the groundwork for the development of natural hair-growth-promoting agents.

Author Contributions

Conceptualization, E.-J.Y. and T.-H.Y.; methodology, T.-H.Y.; software, E.-J.Y.; validation, T.T.M.N. and J.J.; formal analysis, E.-J.Y.; investigation, X.J., S.-J.P. and G.-S.Y.; resources, E.-J.Y.; data curation, Q.Z.; writing—original draft preparation, E.-J.Y.; writing—review and editing, E.-J.Y. and T.T.M.N.; visualization, E.-J.Y.; supervision, T.-H.Y.; project administration, S.-J.Y. and T.-H.Y.; funding acquisition, J.J. and T.-H.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of Kyung Hee University (approval number: KHGASP-23-015).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Conflicts of Interest

Authors Eun-Ji Yi and Jeehaeng Jeong are employed by the Snowwhitefactory Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Maloh, J.; Engel, T.; Natarelli, N.; Nong, Y.; Zufall, A.; Sivamani, R.K. Systematic Review of Psychological Interventions for Quality of Life, Mental Health, and Hair Growth in Alopecia Areata and Scarring Alopecia. J. Clin. Med. 2023, 12, 964. [Google Scholar] [CrossRef] [PubMed]
  2. Roh, S.-S.; Kim, C.D.; Lee, M.-H.; Hwang, S.-L.; Rang, M.-J.; Yoon, Y.-K. The Hair Growth Promoting Effect of Sophora flavescens Extract and Its Molecular Regulation. J. Dermatol. Sci. 2002, 30, 43–49. [Google Scholar] [CrossRef] [PubMed]
  3. Stenn, K.S.; Paus, R. Controls of Hair Follicle Cycling. Physiol. Rev. 2001, 81, 449–494. [Google Scholar] [CrossRef] [PubMed]
  4. Hardy, M.H. The Secret Life of the Hair Follicle. Trends Genet. 1992, 8, 55–61. [Google Scholar] [CrossRef] [PubMed]
  5. Oliver, R.F. The Induction of Hair Follicle Formation in the Adult Hooded Rat by Vibrissa Dermal Papillae. Development 1970, 23, 219–236. [Google Scholar] [CrossRef]
  6. Jahoda, C.A. Induction of Follicle Formation and Hair Growth by Vibrissa Dermal Papillae Implanted into Rat Ear Wounds: Vibrissa-Type Fibres Are Specified. Development 1992, 115, 1103–1109. [Google Scholar] [CrossRef]
  7. Kim, J.; Han, B.J.; Kim, H.; Lee, J.; Joo, I.; Omer, S.; Kim, Y.; Han, Y. Th1 Immunity Induction by Ginsenoside Re Involves in Protection of Mice against Disseminated Candidiasis Due to Candida albicans. Int. Immunopharmacol. 2012, 14, 481–486. [Google Scholar] [CrossRef]
  8. Shin, J.Y.; Lee, J.M.; Shin, H.S.; Park, S.Y.; Yang, J.E.; Cho, S.K.; Yi, T.-H. Anti-Cancer Effect of Ginsenoside F2 against Glioblastoma Multiforme in Xenograft Model in SD Rats. J. Ginseng Res. 2012, 36, 86. [Google Scholar] [CrossRef]
  9. Attele, A.S.; Wu, J.A.; Yuan, C.-S. Ginseng Pharmacology: Multiple Constituents and Multiple Actions. Biochem. Pharmacol. 1999, 58, 1685–1693. [Google Scholar] [CrossRef]
  10. Song, S.B.; Tung, N.H.; Quang, T.H.; Ngan, N.T.T.; Kim, K.E.; Kim, Y.H. Inhibition of TNF-α-Mediated NF-κB Transcriptional Activity in HepG2 Cells by Dammarane-Type Saponins from Panax ginseng Leaves. J. Ginseng Res. 2012, 36, 146. [Google Scholar] [CrossRef]
  11. Tawab, M.A.; Bahr, U.; Karas, M.; Wurglics, M.; Schubert-Zsilavecz, M. Degradation of Ginsenosides in Humans after Oral Administration. Drug Metab. Dispos. 2003, 31, 1065–1071. [Google Scholar] [CrossRef] [PubMed]
  12. Lee, S.M.; Shon, H.J.; Choi, C.-S.; Hung, T.M.; Min, B.S.; Bae, K. Ginsenosides from Heat Processed Ginseng. Chem. Pharm. Bull. 2009, 57, 92–94. [Google Scholar] [CrossRef] [PubMed]
  13. Han, B.; Park, M.; Han, Y.; Woo, L.; Sankawa, U.; Yahara, S.; Tanaka, O. Degradation of Ginseng Saponins under Mild Acidic Conditions. Planta Med. 1982, 44, 146–149. [Google Scholar] [CrossRef] [PubMed]
  14. Ding, L.; Gao, Z.; Wu, S.; Chen, C.; Liu, Y.; Wang, M.; Zhang, Y.; Li, L.; Zou, H.; Zhao, G.; et al. Ginsenoside Compound-K Attenuates OVX-Induced Osteoporosis via the Suppression of RANKL-Induced Osteoclastogenesis and Oxidative Stress. Nat. Prod. Bioprospect. 2023, 13, 49. [Google Scholar] [CrossRef]
  15. Wang, R.; Zhang, M.; Hu, S.; Liu, K.; Tai, Y.; Tao, J.; Zhou, W.; Zhao, Z.; Wang, Q.; Wei, W. Ginsenoside Metabolite Compound-K Regulates Macrophage Function through Inhibition of β-Arrestin2. Biomed. Pharmacother. 2019, 115, 108909. [Google Scholar] [CrossRef]
  16. Tang, M.; Xie, X.; Yang, Y.; Li, F. Ginsenoside Compound K-a Potential Drug for Rheumatoid Arthritis. Pharmacol. Res. 2021, 166, 105498. [Google Scholar] [CrossRef]
  17. Cheng, L.-Q.; Na, J.R.; Bang, M.H.; Kim, M.K.; Yang, D.-C. Conversion of Major Ginsenoside Rb1 to 20 (S)-Ginsenoside Rg3 by Microbacterium sp. GS514. Phytochemistry 2008, 69, 218–224. [Google Scholar] [CrossRef]
  18. Jiang, Y.; Li, W.; Fan, D. Biotransformation of Ginsenoside Rb1 to Ginsenoside CK by Strain XD101: A Safe Bioconversion Strategy. Appl. Biochem. Biotechnol. 2021, 193, 2110–2127. [Google Scholar] [CrossRef]
  19. Kim, B.-G.; Choi, S.-Y.; Kim, M.-R.; Suh, H.J.; Park, H.J. Changes of Ginsenosides in Korean Red Ginseng (Panax ginseng) Fermented by Lactobacillus plantarum M1. Process Biochem. 2010, 45, 1319–1324. [Google Scholar] [CrossRef]
  20. Quan, L.-H.; Cheng, L.-Q.; Kim, H.-B.; Kim, J.-H.; Son, N.-R.; Kim, S.-Y.; Jin, H.-O.; Yang, D.-C. Bioconversion of Ginsenoside Rd into Compound K by Lactobacillus pentosus DC101 Isolated from Kimchi. J. Ginseng Res. 2010, 34, 288–295. [Google Scholar] [CrossRef]
  21. Quan, L.-H.; Piao, J.-Y.; Min, J.-W.; Yang, D.-U.; Lee, H.N.; Yang, D.C. Bioconversion of Ginsenoside Rb1 into Compound K by Leuconostoc citreum LH1 Isolated from Kimchi. Braz. J. Microbiol. 2011, 42, 1227–1237. [Google Scholar] [CrossRef] [PubMed]
  22. Shin, H.-S.; Park, S.-Y.; Hwang, E.-S.; Lee, D.-G.; Song, H.-G.; Mavlonov, G.T.; Yi, T.-H. The Inductive Effect of Ginsenoside F2 on Hair Growth by Altering the WNT Signal Pathway in Telogen Mouse Skin. Eur. J. Pharmacol. 2014, 730, 82–89. [Google Scholar] [CrossRef] [PubMed]
  23. Buck, J.D. Nonstaining (KOH) Method for Determination of Gram Reactions of Marine Bacteria. Appl. Environ. Microbiol. 1982, 44, 992–993. [Google Scholar] [CrossRef] [PubMed]
  24. Fitch, W.M. Toward Defining the Course of Evolution: Minimum Change for a Specific Tree Topology. Syst. Biol. 1971, 20, 406–416. [Google Scholar] [CrossRef]
  25. Saitou, N.; Nei, M. The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
  26. Kim, S.; Kang, B.Y.; Cho, S.Y.; Sung, D.S.; Chang, H.K.; Yeom, M.H.; Kim, D.H.; Sim, Y.C.; Lee, Y.S. Compound K Induces Expression of Hyaluronan Synthase 2 Gene in Transformed Human Keratinocytes and Increases Hyaluronan in Hairless Mouse Skin. Biochem. Biophys. Res. Commun. 2004, 316, 348–355. [Google Scholar] [CrossRef]
  27. Zhou, J.; Gao, Y.; Yi, X.; Ding, Y. Ginsenoside Rh2 Suppresses Neovascularization in Xenograft Psoriasis Model. Cell. Physiol. Biochem. 2015, 36, 980–987. [Google Scholar] [CrossRef]
  28. Qi, S.-H.; Liu, P.; Xie, J.-L.; Shu, B.; Xu, Y.-B.; Ke, C.-N.; Liu, X.-S.; Li, T.-Z. Experimental Study on Repairing of Nude Mice Skin Defects with Composite Skin Consisting of Xenogeneic Dermis and Epidermal Stem Cells and Hair Follicle Dermal Papilla Cells. Burns 2008, 34, 385–392. [Google Scholar] [CrossRef]
  29. Gharzi, A.; Reynolds, A.J.; Jahoda, C.A.B. Plasticity of Hair Follicle Dermal Cells in Wound Healing and Induction. Exp. Dermatol. 2003, 12, 126–136. [Google Scholar] [CrossRef]
  30. Zhang, Z.; Zhang, Y.; Li, W.; Ma, L.; Wang, E.; Xing, M.; Zhou, Y.; Huan, Z.; Guo, F.; Chang, J. Curcumin/Fe-SiO2 Nano Composites with Multi-Synergistic Effects for Scar Inhibition and Hair Follicle Regeneration during Burn Wound Healing. Appl. Mater. Today 2021, 23, 101065. [Google Scholar] [CrossRef]
  31. Song, P.H.; Park, G.-R.; Kim, Y.-H.; Jung, D.H.; Ku, S.-K.; Song, C.-H. Hair-Growth-Promoting Effects of Fermented Red Ginseng Marc and Traditional Polyherb Formula in C57BL/6 Mice. Appl. Sci. 2021, 11, 1195. [Google Scholar] [CrossRef]
  32. Shin, H.-S.; Park, S.-Y.; Hwang, E.-S.; Lee, D.-G.; Mavlonov, G.T.; Yi, T.-H. Ginsenoside F2 Reduces Hair Loss by Controlling Apoptosis through the Sterol Regulatory Element-Binding Protein Cleavage Activating Protein and Transforming Growth Factor-β Pathways in a Dihydrotestosterone-Induced Mouse Model. Biol. Pharm. Bull. 2014, 37, 755–763. [Google Scholar] [CrossRef] [PubMed]
Figure 1. A neighbor-joining phylogenetic tree was constructed based on a comparative analysis of the 16S rRNA gene sequences of strain THK-D437 and closely related reference strains. Bootstrap values (expressed as percentage of 1000 replications) >65% are shown at the branch points. Bar, 0.005 substitutions per nucleotide position.
Figure 1. A neighbor-joining phylogenetic tree was constructed based on a comparative analysis of the 16S rRNA gene sequences of strain THK-D437 and closely related reference strains. Bootstrap values (expressed as percentage of 1000 replications) >65% are shown at the branch points. Bar, 0.005 substitutions per nucleotide position.
Fermentation 10 00565 g001
Figure 2. The time profile biotransformation of ginsenoside by Levilactobacillus brevis THK-D437 using a TLC analysis. (S) standard ginsenoside; (1) saponin mixture control (Rb1, Rb2 and Rd); (2) 5 days culture; (3) 10 days culture; (4) 15 days culture; (5) 20 days culture. Abbreviations: (C-K) compound K.
Figure 2. The time profile biotransformation of ginsenoside by Levilactobacillus brevis THK-D437 using a TLC analysis. (S) standard ginsenoside; (1) saponin mixture control (Rb1, Rb2 and Rd); (2) 5 days culture; (3) 10 days culture; (4) 15 days culture; (5) 20 days culture. Abbreviations: (C-K) compound K.
Fermentation 10 00565 g002
Figure 3. The biotransformation pathway of ginsenoside Rb1, Rb2, and Rc to low-molecular ginsenosides.
Figure 3. The biotransformation pathway of ginsenoside Rb1, Rb2, and Rc to low-molecular ginsenosides.
Fermentation 10 00565 g003
Figure 4. Proliferation effects of fermented ginsenosides on human hair dermal papilla cells (HHDPCs). HHDPCs were seeded in 96-well plates and various concentrations of treated fermented ginsenosides. The results were expressed as a percentage of the control in three replicate cultures, and the values of cell proliferation were the mean ± SD. ** p < 0.01, *** p < 0.001.
Figure 4. Proliferation effects of fermented ginsenosides on human hair dermal papilla cells (HHDPCs). HHDPCs were seeded in 96-well plates and various concentrations of treated fermented ginsenosides. The results were expressed as a percentage of the control in three replicate cultures, and the values of cell proliferation were the mean ± SD. ** p < 0.01, *** p < 0.001.
Fermentation 10 00565 g004
Figure 5. Effect of fermented ginsenosides on the hair growth in C57BL/6 mice on the 18th day. (A) Comparison of back skin colors and hair growth in C57BL/6 mice. (B) Comparison of histological images of hair follicles.
Figure 5. Effect of fermented ginsenosides on the hair growth in C57BL/6 mice on the 18th day. (A) Comparison of back skin colors and hair growth in C57BL/6 mice. (B) Comparison of histological images of hair follicles.
Fermentation 10 00565 g005
Table 1. Phenotypic characteristics of Levilactobacillus brevis THK-D437 and Levilactobacillus brevis ATCC 14687T. In API 50CH tests, all of the strain are positive for acid production of L-arabinose, D-ribose, D-galactose, D-glucose, D-fructose, and D-melobiose. (+) positive; (−) negative.
Table 1. Phenotypic characteristics of Levilactobacillus brevis THK-D437 and Levilactobacillus brevis ATCC 14687T. In API 50CH tests, all of the strain are positive for acid production of L-arabinose, D-ribose, D-galactose, D-glucose, D-fructose, and D-melobiose. (+) positive; (−) negative.
CharacteristicsTHK-D437L. brevis ATCC 14687T
Isolation sourceKimchi
Gram++
Catalase
MorphologyLodLod
Acid production (API 50CH) of:
    D-Xylose+
    Methyl-α-D-glucopyranoside+
    N-Acetyl-Glucosamine+
    Esculin ferric citrate+
    D-Maltose+
    D-Turanose+
    D-gluconate (potassium)+
    2-Ketogluconate (potassium)+
Table 2. LC/MS analysis of ginsenosides contents in fermented ginsenosides by Levilactobacillus brevis THK-D437.
Table 2. LC/MS analysis of ginsenosides contents in fermented ginsenosides by Levilactobacillus brevis THK-D437.
Retention TimeIdentification12% of Change
39′Rb195942088−78.2
39.5′Rc34046085+78.7
39.85′Rb216751241−25.9
40.7′Rd580422,973+295.8
54.3′Compound K1902094+1102.1
55.6′Rh27301961+268
(1) Peak area before fermentation; (2) peak area after fermentation by Levilactobacillus brevis THK-D437.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yi, E.-J.; Nguyen, T.T.M.; Jeong, J.; Jin, X.; Zheng, Q.; Park, S.-J.; Yi, G.-S.; Yang, S.-J.; Yi, T.-H. Stimulation of Hair Growth Effect by Fermented Ginsenosides Using Levilactobacillus brevis THK-D437. Fermentation 2024, 10, 565. https://doi.org/10.3390/fermentation10110565

AMA Style

Yi E-J, Nguyen TTM, Jeong J, Jin X, Zheng Q, Park S-J, Yi G-S, Yang S-J, Yi T-H. Stimulation of Hair Growth Effect by Fermented Ginsenosides Using Levilactobacillus brevis THK-D437. Fermentation. 2024; 10(11):565. https://doi.org/10.3390/fermentation10110565

Chicago/Turabian Style

Yi, Eun-Ji, Trang Thi Minh Nguyen, Jeehaeng Jeong, Xiangji Jin, Qiwen Zheng, Se-Jig Park, Gyeong-Seon Yi, Su-Jin Yang, and Tae-Hoo Yi. 2024. "Stimulation of Hair Growth Effect by Fermented Ginsenosides Using Levilactobacillus brevis THK-D437" Fermentation 10, no. 11: 565. https://doi.org/10.3390/fermentation10110565

APA Style

Yi, E.-J., Nguyen, T. T. M., Jeong, J., Jin, X., Zheng, Q., Park, S.-J., Yi, G.-S., Yang, S.-J., & Yi, T.-H. (2024). Stimulation of Hair Growth Effect by Fermented Ginsenosides Using Levilactobacillus brevis THK-D437. Fermentation, 10(11), 565. https://doi.org/10.3390/fermentation10110565

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop