Next Article in Journal
The Properties of Pectin Extracted from the Residues of Vinegar-Fermented Apple and Apple Pomace
Next Article in Special Issue
Anti-Inflammatory and Osteogenic Effects of Vitamin K from Sargassum fulvellum Fermented by Lactococcus lactis KCCM12759P and Leuconostoc mesenteroides KCCM12756P
Previous Article in Journal
Biomethane Production and Methanogenic Microbiota Restoration After a pH Failure in an Anaerobic Sequencing Batch Reactor (A-SBR) Treating Tequila Vinasse
Previous Article in Special Issue
(S)-2-Hydroxyisovalerate Production from d-Xylose with CO-Converting Clostridium ragsdalei
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism

Department of Chemical Engineering, School of Chemistry and Chemical Engineering, Chongqing University, Chongqing 401331, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Fermentation 2024, 10(11), 558; https://doi.org/10.3390/fermentation10110558
Submission received: 29 September 2024 / Revised: 26 October 2024 / Accepted: 30 October 2024 / Published: 31 October 2024
(This article belongs to the Special Issue Fermentation: 10th Anniversary)

Abstract

As a high-value bulk chemical, ethylene glycol plays an important role in many fields such as energy, the chemical industry, and automobile manufacturing. At the same time, methanol, as an economical and efficient raw material, has shown great potential in promoting the innovation of bio-based chemicals and fuels. In view of this, this study focused on the excavation and innovative application of enzymes, and successfully designed an efficient artificial cascade catalytic system. The system cleverly converts methanol into ethylene glycol, and the core is composed of methanol dehydrogenase, glycolaldehyde synthase, and lactoaldehyde–pyruvate oxidoreductase. The three enzyme systems work together, which not only simplifies the metabolic pathway, but also realizes the efficient reuse of coenzymes. Subsequently, after ribosome-binding site (RBS) optimization, isopropyl β-D-Thiogalactoside (IPTG) induction regulation, and methanol concentration adjustment, the concentration of ethylene glycol reached 14.73 mM after 48 h of reaction, and the conversion rate was 58.92%. Furthermore, a new breakthrough in ethylene glycol production was achieved within 48 h by using a two-stage biotransformation strategy and fed-batch feeding in a 5 L fermentor, reaching 49.29 mM, which is the highest yield of ethylene glycol reported so far. This achievement not only opens up a new way for the biotransformation of ethylene glycol, but also lays a foundation for the industrial application in this field in the future.

1. Introduction

With the continuous development of synthetic biology, the use of C1 compounds (such as CO2 [1], methane [2], methanol [3], etc.) to synthesize multi-carbon chemicals has attracted much attention due to its low cost, easy access, sustainability, and environmental friendliness [4]. Using synthetic biology technology to convert C1 raw materials into fuels or high-value chemicals can reduce carbon emissions and alleviate the greenhouse effect. It is a promising energy-saving and carbon-reduction strategy [5,6,7,8,9]. Ethylene glycol (EG) is a widely used bulk chemical, especially related to energy, chemical, automotive, transportation, and manufacturing technologies [10]. Therefore, the development and utilization of renewable raw materials such as biomass and carbon dioxide for the green direct synthesis of EG has important practical significance, because they have considerable industrial value.
The traditional methods for producing ethylene glycol mainly include the chloroethanol method, ethylene oxide hydration method, and ethylene direct hydration method [10], which mostly rely on petrochemical raw materials and have unstable production costs. Some methods and processes may generate a significant amount of by-products and harmful substances during the production process, causing certain environmental pressure. Therefore, with the development of technology and the diversified utilization of resources, people have begun to explore more efficient and environmentally friendly methods for preparing ethylene glycol, such as microbial fermentation to produce ethylene glycol. The method of producing ethylene glycol from biomass has been widely studied [11]. At present, there are three main pathways for microbial cells to produce ethylene glycol from sugar, namely the Dahms pathway [12,13,14,15,16], the xylulose-1-phosphate (X1P) pathway [17,18,19], and the ribulose-1-phosphate (R1P) pathway [20]. These pathways use glycolaldehyde as a key intermediate for ethylene glycol production, and EG is usually produced from glycolaldehyde by glycolaldehyde reductase (YqhD) [21,22] or lactaldehyde reductase (FucO) [17,23,24]. Among these pathways (Table 1), the EG production of the Dahms metabolic pathway that decomposes xylose reached the highest level of 108.2 g/L. However, the disadvantage is that it is difficult to separate the by-products produced by sugar metabolism during the fermentation process, and the low conversion rate of raw materials is caused by many pathway steps. At the same time, the use of sugar and food as raw materials for the biosynthesis of chemicals also has social contradictions with the people competing for food and competing with food for land. In contrast, the synthesis of high-value chemicals from a carbon compound (C1) can avoid the above problems. EG can be synthesized from C1 raw materials by multienzyme cascade catalysis or fermentation, and the greenhouse effect can be alleviated.
Methanol is an emerging C1 source, which can be prepared from CO2 by electrocatalytic or photocatalytic methods [25,26]. Methanol is expected to be a key raw material for the next generation of bio-manufacturing because methanol is a non-food raw material with abundant sources and low price. The use of low-cost carbon-based materials is conducive to the commercialization of industrial biotechnology. One of the typical representatives is Cai et al. [6], who constructed an artificial starch assimilation pathway (ASAP) that converts carbon dioxide into starch, including the electrocatalysis of carbon dioxide to methanol. Zhou et al. [5] proposed an in vitro multienzyme cascade pathway for the preparation of EG from methanol. This pathway also uses glycolaldehyde as a key intermediate. Glycolaldehyde can be obtained from methanol through the cascade reaction of glycolaldehyde synthase GALS [27] and alcohol oxidase. Glycolaldehyde generates EG under the action of reductase, but the NADH regeneration system developed by it needs to be further optimized. Finally, 0.90 g/L EG was generated from methanol. Jo et al. [24] used formaldehyde as the substrate, and the glycolaldehyde synthase EcGCL and aldehyde reductase obtained by overexpression mutation catalyzed formaldehyde to produce 6.6 mM ethylene glycol. However, due to the fact that formaldehyde is not easy to recycle at room temperature and its chemical properties are very active, it is very challenging to convert formaldehyde into value-added products. Therefore, the use of methanol as a substrate to produce ethylene glycol is a better choice for the production of high-value chemicals using C1 compounds.
In view of this, this study focuses on the development of an innovative multienzyme cascade catalytic system, aiming to efficiently and economically synthesize ethylene glycol with methanol as a single substrate. The system not only simplifies the catalytic pathway, but also realizes the immediate recovery and recycling of coenzyme NAD+ through the well-designed three core enzymes. This technological innovation has significantly improved the efficiency and sustainability of the production process and opened up a more economical and environmentally friendly new way for the field of methanol-based ethylene glycol synthesis.
Table 1. Metabolic engineering bacteria or enzymes producing EG.
Table 1. Metabolic engineering bacteria or enzymes producing EG.
Strain or EnzymesProduction ProcessSubstrateEthylene Glycol Yield (g/g)Reference
E. coli WL3110 (pTacxylBC-P1-anti-xylB)Microbial
fermentation
D-Xylose108.2[12]
E. coli BL21(DE3) ΔarcAΔaldA/pETDuet1-yjhH-xdh-xylC/pACYCDuet1-fucO-yjhGMicrobial
fermentation
D-Xylose72[13]
E. coli MG1655 ΔxylB ΔaldA dte fucA fucK fucOMicrobial
fermentation
D-Xylose40[20]
E. coli MG1655 ΔxylB ΔaldA khk-C aldoB fucOMicrobial
fermentation
D-Xylose20[17]
E. coli W3110(DE3) ΔxylA xdh yqhDMicrobial
fermentation
D-Xylose11.7[14]
E. coli MG1655 ΔaraB ΔaldA ΔxylB dte rhaB rhaD fucA fucK fucOMicrobial
fermentation
L-Arabinose + D-Xylose10.5[20]
E. coli W3110 ΔxylABΔaldAΔyjgBpKMX and pTrcHis2A_yjgBMicrobial
fermentation
D-Xylose7.72[15]
E. coli MG1655(DE3) ΔaldA serA:317 serB serC fucO sdcV.carteri aaoMicrobial
fermentation
D-Glucose4.1[28]
C. glutamicum Mdlc yqhD Sdc ASAO yqhD yqhDMicrobial
fermentation
D-Glucose3.5[29]
S. cerevisiae xks1Δ BsXI RnKHK FBA1 CDMicrobial
fermentation
D-Xylose0.5[18]
S. cerevisiae H4099 (MATα, ura3–52 HIS3, leu2–3/112, TRP1, MAL2–8 c, SUC2, gre3::xylB, fra2::HygR, xylD)Microbial
fermentation
D-Xylose +
D-Glucose
0.014[16]
S. cerevisiae (PeXYLA)47 RPE1 RKI1 TKL1 PsTAL1 PFK1 PFK2Microbial
fermentation
D-Xylose +
D-Glucose
4.05[19]
D-Xylose dehydrogenase, xylonolactonase, xylonate dehydratase, 2-keto-3-deoxy-D-xylonate aldolase, lactaldehyde reductase, a-acetolactate synthase, and α-acetolactate decarboxylaseCell-free
biosynthesis
D-Xylose0.341[30]
AldOmt, catalase, GRHPR, PDC, and FucOCell-free
biosynthesis
Glycerol0.47[23]

2. Materials and Methods

2.1. Strains and Plasmids

The strains and plasmids involved in this study are shown in Table 2 and the primers are shown in Table 3. The plasmid was constructed using E. coli DH5α, and the overexpression of the recombinant protein was performed using E. coli BL21 (DE3). The coding genes MDHcn (sequence id: cp002878.1) and GALS (mmdb_id: 172342) involved in ethylene glycol biosynthesis were synthesized in Escherichia coli after codon optimization. These genes were codon-optimized and synthesized by Kingsley Biotechnology Co., Ltd. (Nanjing, China). The construction of all the plasmids was completed by a seamless cloning kit, and the DNA fragments were amplified by PCR using Primestar Max DNA polymerase (Takara, Dalian, China) according to the manufacturer’s instructions. All the plasmids were constructed using a clonexpress ultra one step cloning Kit (wozyme Biotechnology Co., Ltd., Beijiing, China). In order to establish a protein expression vector, the FucO gene (CP026085.1) was cloned as an example. The FucO coding gene was amplified from the genomic DNA of E. coli MG1655 using the primers FucO-F/FucO-R, and then cloned into the vector pET28a using a seamless cloning kit, and named pET28a-FucO. Subsequently, the plasmid pET28a-FucO was transferred into E. coli BL21 (DE3) to obtain E. coli BL21 (DE3)/pET28a-FucO. All the E. coli strains were cultured in the Luria–Bertani (LB) medium at 37 °C, 200 rpm or 25 °C, 200 rpm. When necessary, kanamycin (final concentration of 50 μg/mL) was added to the medium. The remaining GALS and MDH genes were constructed in the same position of pET-28a using the same method. In order to establish a co-expression strain, the MDH, GALS, and FucO genes were inserted into pET-28a, and then the plasmid pET28a-MDH-GALS-FucO was generated, also named pET28a-MGF. In the same way, different intensities of RBS were constructed before the MDH gene to guide the expression of the MDH enzyme (Table S1). We named these vectors as MGF-R01~MGF-R05.

2.2. Expression and Purification of the Enzymes

Each recombinant plasmid was first transformed into E. coli BL21 (DE3) competent cells, and then a colony was picked and cultured in a liquid LB medium containing 50 μg/mL kanamycin at 37 °C for 12 h as a seed solution. The production of recombinant protein was carried out in 400 mL liquid LB medium containing 50 μg/mL kanamycin at 37 °C. When OD600 reached about 0.6, 0.5 mM IPTG was added to induce the expression of the target protein. The culture was then incubated at 16 °C for 16 h, followed by centrifugation at 4 °C and 4000 rpm for 20 min to harvest cells. The cells were resuspended in 30 mL 50 mM Tris-HCl buffer (pH 8.0) containing 300 mM NaCl.
To purify the recombinant protein, the cell particles were first lysed by ultrasound in an ice water bath. The cells were then centrifuged at 4 °C and 10,000 rpm for 60 min to remove cell debris. The target His-labeled protein in the supernatant was purified by Ni-NTE resin [31]. The extract was ultrafiltrated at 4 °C and 4000 rpm for 40 min, and then the purity of the purified enzyme was detected by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). Using bovine serum albumin (BSA) as a reference protein, the concentration of each purified protein was determined by the Bradford method [32].

2.3. Construction of In Vitro Cascade Reaction System

The purified recombinant protein was used to catalyze the cascade reaction of the enzyme at 37 °C and 200 rpm. The methanol synthesis of the formaldehyde pathway: the reaction was carried out at 37 °C, the final volume of 250 μL, and containing 50 mM potassium dihydrogen phosphate buffer (pH 8.0), 5 mM MgSO4, 10 mM NADH, and 2 mg·mL−1 MDH. The synthesis of glycolaldehyde and ethylene glycol from formaldehyde: the reaction was carried out at 37 °C, the final volume was 250 μL, and contained 50 mM potassium dihydrogen phosphate buffer (pH 8.0), 5 mM MgSO4, 10 mM NADH, 2 mg·mL−1 GALS, and 2 mg·mL−1 FucO. Methanol to ethylene glycol pathway: the reaction was carried out at 37 °C, and the final volume was 250 μL, containing 50 mM PBS buffer (pH 8.0), 5 mM MgSO4, 20 mM NAD+, 2 mg·mL−1 MDH, 2 mg·mL−1 GALS, and 2 mg·mL−1 FucO.

2.4. Medium and Culture

LB medium (containing 10 g tryptone, 5 g yeast extract, and 10 g sodium chloride per liter) was used in the construction of strains and plasmid amplification. In this process, the culture was cultured at a temperature of 37 °C and a rotation speed of 220 revolutions per minute. For the whole-cell catalytic reaction, SOB medium (containing 20 g tryptone, 5 g yeast extract, 10 mM NaCl, 25 mM KCl, and 10 mM MgSO4 per liter) was used. In the shake flask fermentation experiment of ethylene glycol, SMAC medium (containing 30 g glucose, 12 g Na2HPO4·12H2O, 3 g KH2PO4, 0.5 g NaCl, 1 g NH4Cl, 0.5 g MgSO4·7H2O, 0.011 g CaCl2, 1 g Vitamin B1, and 1 mL 1‰ metal ion solution per liter) was used. M9 medium (containing 6.78 g Na2HPO4, 3 g KH2PO4, 0.5 g NaCl, 1 g NH4Cl, 0.241 g MgSO4, and 0.011 g CaCl2 per liter) was used in a 5 L fermentation tank. Firstly, a single colony was selected from the plate and inoculated into 3 mL of LB medium. When its optical density (OD600) reached 0.6, it was regarded as the preparation of seed liquid. Subsequently, 1 mL of this seed solution was transferred to a 250 mL culture flask containing 50 mL of SMAC medium and continued to be cultured at 37 °C and 220 rpm. When the optical density (OD600) of the culture reached 0.6, IPTG was added to the culture flask to a final concentration of 0.6 mM and induced at a low temperature of 16 °C for 16 h. After induction, 50 mM methanol was added for fermentation.

2.5. Synthesis of Ethylene Glycol by Two-Stage Bioconversion Strategy

The process of EG synthesis by a two-stage biotransformation strategy is divided into two steps: In the initial stage, the cells were cultured in a 5 L fermentor containing 3 L SOB medium and 160 mM glucose. The bioreactor was maintained at a temperature of 37 °C and a stirring speed of 300 rpm, while the air flow rate was set to 2 L/min. Under the real-time pH monitoring and feedback control system of the fermentation tank, the speed of the peristaltic pump is automatically controlled through the real-time monitoring data of the pH electrode so as to adjust the flow acceleration of ammonium hydroxide, and then stabilize the pH value in fermentation tank at 7.0. When the cell density reached 30 (OD600), 1 mM IPTG was added and the expression of the pathway enzyme was induced at 16 °C for 16 h. At a subsequent stage, the cells were collected by centrifugation at 5000 revolutions per minute and washed with PBS. The cell precipitate was resuspended in M9 medium. The cell density was maintained at OD600 of 30. Subsequently, methanol was added in batches and the bioreactor was maintained at 37 °C and 300 rpm for fermentation.

2.6. Analytical Methods

The contents of methanol and ethylene glycol in the fermentation process were determined by Shimadzu SIL-20AXR high-performance liquid chromatograph (Kyoto, Japan) equipped with a refractive index detector and Bio-Rad Aminex HPX-87 H ion exchange column (7.8 × 300 mm, Hercules, CA, USA). The column temperature was 35 °C, the mobile phase was 5 mM H2SO4 solution, the flow rate was 0.6 mL/min, and the injection volume was 10 μL.
Color reaction was used to determine the amount of formaldehyde in the reaction process. Different concentrations of formaldehyde standard solution were prepared with water solvent. The 0.7 mL formaldehyde standard solution of each concentration was mixed with 0.7 mL Nessler’s solution [33], and the mixture was placed in a water bath at 65 °C for 30 min to determine OD405. The relationship curve between the formaldehyde concentration and absorption value was obtained by using formaldehyde concentration as the abscissa and the absorption value at 405 nm as the ordinate.
Gas chromatography/mass spectrometry was used to determine the amount of glycolaldehyde during the reaction [24]. The sample was mixed with 10% (v/v) H2SO4 and centrifuged at 12,000 rpm. After adding the internal standard (cyclohexanone) and (PFBHA) solution, the mixture was derivatized at room temperature. Then, the sample was mixed with ethyl acetate as the extraction solvent and vortexed for 3 min. Then, 80 μL of supernatant was evaporated, 25 μL of BSTFA was added, and the derivatization was performed at 65 °C for 30 min. After derivatization, the samples were analyzed by GC/MS.

3. Results and Discussion

3.1. Designing a New Multienzyme Cascade Pathway for Methanol to Ethylene Glycol

Here, a multienzyme cascade system was designed to convert methanol into ethylene glycol (Figure 1). Firstly, methanol is oxidized to formaldehyde by methanol dehydrogenase from Cupriavidus necator N-1 (Equation (1)). Then, formaldehyde was converted to glycolaldehyde (GALD) under the action of glycolaldehyde synthase (GALS) (Equation (2)). Finally, glycolaldehyde was reduced to ethylene glycol by lactaldehyde–propylene glycol oxidoreductase (FucO) (Equation (3)). The NADH produced in the synthesis of MDH can also act as a cofactor to catalyze the reduction of glycolaldehyde with FucO, and realize the reuse of NAD+ [34]. FucO can also be used as the ‘NADH Sink’ of NADH scavenger [35] to inhibit the reverse reaction of methanol dehydrogenation and ensure the normal operation of the synthesis pathway. Finally, we have successfully constructed an innovative cofactor regeneration catalytic system that can convert methanol to ethylene glycol by relying on only three enzymes, which shortens the synthesis pathway compared to previous reports [5].
2CH3OH + 2NAD+ → 2HCHO + 2NADH + 2H+
2HCHO → CH2OHCHO
CH2OHCHO + NADH + H+ → HOCH2CH2OH + NAD+

3.2. Verification of Enzyme Cascade Reaction Pathway

NAD+-dependent methanol oxidation is the main step in the use of methanol as a substrate for the microbial production of chemicals. The MDHs of Bacillus methanolicus and other homologous microorganisms reported so far require ACT activator proteins and 50 °C thermophilic conditions to activate methanol oxidation activity. [36] MDHCn from Cupriavidus necator N-1 does not require ACT activator proteins and has catalytic activity at room temperature and 37 °C. It is an excellent choice for methanol conversion in vitro and in vivo [33]. In order to construct the pathway of methanol to ethylene glycol in vitro, the catalytic ability of methanol dehydrogenase MDHCn was first tested and evaluated. Figure 2a shows that 17.46 mM formaldehyde was detected after methanol was added to potassium dihydrogen phosphate buffer containing methanol dehydrogenase MDH for 12 h, and the conversion rate was 58.19%. It is speculated that the low conversion rate may be due to the low concentration of NAD+ added in the system, which cannot better promote the catalytic reaction of MDH [33]. However, this result indicates that methanol can be successfully converted into formaldehyde under the action of methanol dehydrogenase. Moreover, the reaction can be carried out in vitro without ACT activator protein. Subsequently, the glycolaldehyde synthesis of GALS at lower formaldehyde concentrations was determined. Figure 2a shows that 30 mM formaldehyde was added to the buffer solution containing GALS, and 12.42 mM glycolaldehyde was produced after 12 h incubation at 37 °C, and the conversion rate was as high as 82.84%, indicating that GALS enzyme has good catalytic activity in the catalytic reaction.
Then, FucO and NADH were added to the previous GALS reaction solution to continue the reaction, and the content of glycolaldehyde decreased with the production of ethylene glycol. Finally, after 12 h of catalysis, the concentration of ethylene glycol reached 11.31 mM, more than half of the theoretical yield of ethylene glycol from formaldehyde. This result is consistent with the study of Jo et al. [24], confirming that GALS can effectively catalyze the dimerization of formaldehyde to produce glycolaldehyde GALD, and can be reduced to ethylene glycol by the introduced FucO (Figure 2b). Finally, the methanol dehydrogenase MDH was introduced to construct a one-carbon assimilation pathway from methanol to ethylene glycol. In this pathway, we added methanol with the same molar concentration as formaldehyde and increased the concentration of cofactor NAD+. Through the combined action of three pathway enzymes and cofactor NAD+, the yield of ethylene glycol reached only 6.96 mM within 12 h, and the conversion rate reached 46.37%. This conversion rate is lower than the conversion rate of 75.4% when formaldehyde is used as a substrate alone, which may be due to the addition of more NAD+ in the system and the lack of NADH produced by MDH as a rate-limiting step, which inhibits FucO’s rapid reduction of glycolaldehyde to ethylene glycol. [37] Therefore, improving the activity of MDH and optimizing the regeneration strategy of NADH are crucial for improving the efficiency of ethylene glycol production from methanol [38,39].

3.3. Enhancing the Expression and Activity of the Enzyme In Vivo

In living organisms, methanol can be converted into formaldehyde through the action of methanol dehydrogenase (MDH). However, NAD+-dependent methanol dehydrogenase exhibits a low affinity for its substrate, with a Km value of merely 21.6 ± 1.5 mM (Table 4). Additionally, this enzyme is constrained by the thermodynamics of methanol dehydrogenase (ΔG = −0.4 kJ/mol), making it the rate-limiting step in this biotransformation pathway [40]. Therefore, it is crucial to enhance the efficient expression of MDH to ensure an adequate supply of intermediate products and more reducing cofactor NADH for the subsequent reaction steps.
Figure 3a demonstrates that the control strain (YS) produced only 4.87 mM of ethylene glycol in 50 mM methanol by utilizing the RBS inherent to pET-28a. The expression of MDH was optimized by employing five RBS sequences of varying strengths selected from the Anderson and Community RBS libraries (refer to Table S1) [41]. The findings revealed that the MGF-R04 strain, optimized with the RBS-04 sequence, excelled in ethylene glycol production, achieving a yield of 9.16 mM, almost doubling that of the YS strain. It is hypothesized that the boost in ethylene glycol production is attributed to the intensified expression of MDH, which elevates the conversion rate of methanol, thereby augmenting the output of ethylene glycol.
IPTG-induced protein expression also directly impacts enzyme activity and stability [42], thereby influencing the efficiency of catalytic reactions. For the MGF-R04 strain, the concentration and induction duration of the inducer IPTG were thoroughly optimized. The experimental results (Figure 3b,c) revealed that under the conditions of an IPTG concentration of 1 mM and an induction time of 16 h, the cells exhibited optimal methanol conversion efficiency, with the EG concentration climbing to 11.85 mM. However, when the IPTG concentration was increased to 1.2 mM, the production of EG exhibited a decreasing trend. This could be attributed to excessive IPTG, which prompted a surge in enzyme expression and folding rates [43], potentially disrupting the correct folding of enzymes, thereby diminishing enzyme activity and leading to a decline in EG production.
In addition, the concentration of the substrate methanol was finely regulated. By comparing the final yield of EG (Figure 3d), the highest yield was achieved at 14.73 mM when the amount of methanol added was 100 mM. It was observed that when the methanol concentration was below 100 mM, there was a positive correlation between the EG production and methanol concentration, which may be due to the increase in the methanol concentration providing more substrate molecules, thereby increasing the synthesis potential of ethylene glycol. When the methanol concentration jumped to 150 mM or above, the EG production showed a decreasing trend, which may be attributed to the higher toxicity of methanol and its oxidation product formaldehyde [36], which had adverse effects on cells.

3.4. Increasing the Production of Ethylene Glycol Through a Two-Stage Biotransformation Strategy

To enhance ethylene glycol production and tackle the challenge of low biomass in shake flasks, this study innovatively established a two-stage biotransformation system. Firstly, we cultivated the strain in a 3 L SOB medium containing 160 mM glucose, and added IPTG inducer when OD600 reached 30. After 16 h of low-temperature induction at 16 °C, the strain was centrifuged and resuspended in M9 medium for methanol biotransformation. The two-stage biotransformation strategy can efficiently convert methanol into the target product ethylene glycol through clear bacterial growth and substrate conversion processes. In large-scale production, this strategy can ensure that every step is optimized, thereby achieving higher production efficiency. As shown in Figure 4a, the cell culture was carried out in a 5 L fermentor in the early stage. When the OD600 reached 30, low-temperature induction was started. In the later stage, the production of ethylene glycol was carried out by harvesting the induced cells. As shown in Figure 4b, 24 h before fermentation, with the continuous consumption of methanol, the production of EG was also increasing and the production intensity was high, reaching 30.56 mM. However, when the methanol content was less than 40 mM, it was found that the yield of ethylene glycol began to increase slowly. It is speculated that this may be because the lower concentration of methanol affects the reaction rate of the enzyme. Therefore, according to the optimal methanol concentration selected in the shake flask, which was 100 mM, methanol was fed to 100 mM after 24 h of fermentation. As shown in Figure 4b, after feeding, the production rate of ethylene glycol was observed to be significantly improved, reaching a maximum yield of 49.29 mM at 48 h, and the conversion rate reached 59.11%. Compared with the highest yield (0.9 g/L) previously reported, it was increased by about 2.4 times [5]. In addition, screening high-yield strains and optimizing enzyme fermentation processes through mutagenesis breeding techniques in enzyme engineering will further improve substrate utilization and target product conversion rates.

4. Conclusions

In this study, we constructed an artificial cascade catalytic system that integrates three types of enzymes through enzyme mining. This system not only ingeniously simplifies the originally complex metabolic process and shortens the biotransformation pathway, but also achieves the efficient reuse of coenzyme molecules, significantly improving the overall efficiency and sustainability of the system. To further explore the potential of the system, we optimized the expression strategy and catalytic activity of the enzymes in depth. Through a series of precise regulatory measures, the yield of ethylene glycol was significantly increased, reaching 14.73 mM. It is worth noting that in order to maximize production and optimize production efficiency, we innovatively introduced a two-stage biotransformation strategy and combined it with batch-feeding technology, ultimately achieving a yield of 49.29 mM of ethylene glycol. This achievement not only demonstrates the powerful ability of synthetic biology in the precise design and optimization of biotransformation pathways, but also opens up new avenues for the direct conversion of renewable resource methanol into high-value chemical ethylene glycol. At the same time, it also lays a foundation for the industrial production of methanol biotransformation glycol in the future.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/fermentation10110558/s1, Table S1: The ribosome-binding site sequence.

Author Contributions

Writing—original draft preparation, Z.Z.; conceptualization and methodology, W.L.; resources, X.F., J.L. and X.L.; Writing—review and editing, project administration, and funding acquisition, D.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China (2022YFC2105700, 2021YFC2103300); the National Natural Science Foundation of China (22378032); and the Fundamental Research Funds for the Central Universities (2023CDJXY-047).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Whipple, D.T.; Kenis, P.J. Prospects of CO2 utilization via direct heterogeneous electrochemical reduction. J. Phys. Chem. Lett. 2010, 1, 3451–3458. [Google Scholar] [CrossRef]
  2. Weng, C.; Peng, X.; Han, Y. From methane to value-added bioproducts: Microbial metabolism, enzymes, and metabolic engineering. In Advances in Applied Microbiology; Elsevier: Amsterdam, The Netherlands, 2023; Volume 124, pp. 119–146. [Google Scholar]
  3. Liu, K.; Qiao, Y.; Zhang, S.; Guo, F.; Ma, J.; Xin, F.; Zhang, W.; Jiang, M. Advances in biotransformation of methanol into chemicals. Sheng Wu Gong Cheng Xue Bao Chin. J. Biotechnol. 2023, 39, 2430–2448. [Google Scholar]
  4. Guo, M.; Song, W.; Buhain, J. Bioenergy and biofuels: History, status, and perspective. Renew. Sustain. Energy Rev. 2015, 42, 712–725. [Google Scholar] [CrossRef]
  5. Zhou, J.; Tian, X.; Yang, Q.; Zhang, Z.; Chen, C.; Cui, Z.; Ji, Y.; Schwaneberg, U.; Chen, B.; Tan, T. Three multi-enzyme cascade pathways for conversion of C1 to C2/C4 compounds. Chem. Catal. 2022, 2, 2675–2690. [Google Scholar] [CrossRef]
  6. Cai, T.; Sun, H.; Qiao, J.; Zhu, L.; Zhang, F.; Zhang, J.; Tang, Z.; Wei, X.; Yang, J.; Yuan, Q. Cell-free chemoenzymatic starch synthesis from carbon dioxide. Science 2021, 373, 1523–1527. [Google Scholar] [CrossRef]
  7. Navarro-Jaén, S.; Virginie, M.; Bonin, J.; Robert, M.; Wojcieszak, R.; Khodakov, A.Y. Highlights and challenges in the selective reduction of carbon dioxide to methanol. Nat. Rev. Chem. 2021, 5, 564–579. [Google Scholar] [CrossRef] [PubMed]
  8. Tan, T.; Chen, B.; Zhang, H.; Cui, Z. Accelerate promotion of green bio-manufacturing to help achieve “carbon neutrality”. Chem. Ind. Eng. Prog. 2021, 40, 1137–1141. [Google Scholar]
  9. Wagner, N.; Wen, L.; Frazão, C.J.; Walther, T. Next-generation feedstocks methanol and ethylene glycol and their potential in industrial biotechnology. Biotechnol. Adv. 2023, 69, 108276. [Google Scholar] [CrossRef]
  10. Yue, H.; Zhao, Y.; Ma, X.; Gong, J. Ethylene glycol: Properties, synthesis, and applications. Chem. Soc. Rev. 2012, 41, 4218–4244. [Google Scholar] [CrossRef]
  11. Salusjärvi, L.; Havukainen, S.; Koivistoinen, O.; Toivari, M. Biotechnological production of glycolic acid and ethylene glycol: Current state and perspectives. Appl. Microbiol. Biotechnol. 2019, 103, 2525–2535. [Google Scholar] [CrossRef]
  12. Chae, T.U.; Choi, S.Y.; Ryu, J.Y.; Lee, S.Y. Production of ethylene glycol from xylose by metabolically engineered Escherichia coli. AIChE J. 2018, 64, 4193–4200. [Google Scholar] [CrossRef]
  13. Wang, Y.; Xian, M.; Feng, X.; Liu, M.; Zhao, G. Biosynthesis of ethylene glycol from d-xylose in recombinant Escherichia coli. Bioengineered 2018, 9, 233–241. [Google Scholar] [CrossRef]
  14. Liu, H.; Ramos, K.R.M.; Valdehuesa, K.N.G.; Nisola, G.M.; Lee, W.-K.; Chung, W.-J. Biosynthesis of ethylene glycol in Escherichia coli. Appl. Microbiol. Biotechnol. 2013, 97, 3409–3417. [Google Scholar] [CrossRef] [PubMed]
  15. Cabulong, R.B.; Valdehuesa, K.N.G.; Ramos, K.R.M.; Nisola, G.M.; Lee, W.-K.; Lee, C.R.; Chung, W.-J. Enhanced yield of ethylene glycol production from d-xylose by pathway optimization in Escherichia coli. Enzym. Microb. Technol. 2017, 97, 11–20. [Google Scholar] [CrossRef] [PubMed]
  16. Salusjärvi, L.; Toivari, M.; Vehkomäki, M.-L.; Koivistoinen, O.; Mojzita, D.; Niemelä, K.; Penttilä, M.; Ruohonen, L. Production of ethylene glycol or glycolic acid from D-xylose in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 2017, 101, 8151–8163. [Google Scholar] [CrossRef]
  17. Alkim, C.; Cam, Y.; Trichez, D.; Auriol, C.; Spina, L.; Vax, A.; Bartolo, F.; Besse, P.; François, J.M.; Walther, T. Optimization of ethylene glycol production from (D)-xylose via a synthetic pathway implemented in Escherichia coli. Microb. Cell Factories 2015, 14, 127. [Google Scholar] [CrossRef]
  18. Chomvong, K.; Bauer, S.; Benjamin, D.I.; Li, X.; Nomura, D.K.; Cate, J.H. Bypassing the pentose phosphate pathway: Towards modular utilization of xylose. PLoS ONE 2016, 11, e0158111. [Google Scholar] [CrossRef]
  19. Uranukul, B.; Woolston, B.M.; Fink, G.R.; Stephanopoulos, G. Biosynthesis of monoethylene glycol in Saccharomyces cerevisiae utilizing native glycolytic enzymes. Metab. Eng. 2019, 51, 20–31. [Google Scholar] [CrossRef]
  20. Pereira, B.; Li, Z.-J.; De Mey, M.; Lim, C.G.; Zhang, H.; Hoeltgen, C.; Stephanopoulos, G. Efficient utilization of pentoses for bioproduction of the renewable two-carbon compounds ethylene glycol and glycolate. Metab. Eng. 2016, 34, 80–87. [Google Scholar] [CrossRef] [PubMed]
  21. Jarboe, L.R. YqhD: A broad-substrate range aldehyde reductase with various applications in production of biorenewable fuels and chemicals. Appl. Microbiol. Biotechnol. 2011, 89, 249–257. [Google Scholar] [CrossRef]
  22. Zhang, Z.; Yang, Y.; Wang, Y.; Gu, J.; Lu, X.; Liao, X.; Shi, J.; Kim, C.H.; Lye, G.; Baganz, F. Ethylene glycol and glycolic acid production from xylonic acid by Enterobacter cloacae. Microb. Cell Factories 2020, 19, 89. [Google Scholar] [CrossRef]
  23. Li, K.; Sun, W.; Meng, W.; Yan, J.; Zhang, Y.; Guo, S.; Lü, C.; Ma, C.; Gao, C. Production of ethylene glycol from glycerol using an in vitro enzymatic cascade. Catalysts 2021, 11, 214. [Google Scholar] [CrossRef]
  24. Jo, H.-J.; Kim, J.-H.; Kim, Y.-N.; Seo, P.-W.; Kim, C.-Y.; Kim, J.-W.; Yu, H.-n.; Cheon, H.; Lee, E.Y.; Kim, J.-S. Glyoxylate carboligase-based whole-cell biotransformation of formaldehyde into ethylene glycol via glycolaldehyde. Green Chem. 2022, 24, 218–226. [Google Scholar] [CrossRef]
  25. Kong, S.; Lv, X.; Wang, X.; Liu, Z.; Li, Z.; Jia, B.; Sun, D.; Yang, C.; Liu, L.; Guan, A. Delocalization state-induced selective bond breaking for efficient methanol electrosynthesis from CO2. Nat. Catal. 2023, 6, 6–15. [Google Scholar] [CrossRef]
  26. Qu, T.; Wei, S.; Xiong, Z.; Zhang, J.; Zhao, Y. Progress and prospect of CO2 photocatalytic reduction to methanol. Fuel Process. Technol. 2023, 251, 107933. [Google Scholar] [CrossRef]
  27. Lu, X.; Liu, Y.; Yang, Y.; Wang, S.; Wang, Q.; Wang, X.; Yan, Z.; Cheng, J.; Liu, C.; Yang, X. Constructing a synthetic pathway for acetyl-coenzyme A from one-carbon through enzyme design. Nat. Commun. 2019, 10, 1378. [Google Scholar] [CrossRef]
  28. Pereira, B.; Zhang, H.; De Mey, M.; Lim, C.G.; Li, Z.J.; Stephanopoulos, G. Engineering a novel biosynthetic pathway in Escherichia coli for production of renewable ethylene glycol. Biotechnol. Bioeng. 2016, 113, 376–383. [Google Scholar] [CrossRef]
  29. Chen, Z.; Huang, J.; Wu, Y.; Liu, D. Metabolic engineering of Corynebacterium glutamicum for the de novo production of ethylene glycol from glucose. Metab. Eng. 2016, 33, 12–18. [Google Scholar] [CrossRef]
  30. Jia, X.; Kelly, R.M.; Han, Y. Simultaneous biosynthesis of (R)-acetoin and ethylene glycol from D-xylose through in vitro metabolic engineering. Metab. Eng. Commun. 2018, 7, e00074. [Google Scholar] [CrossRef]
  31. Cheng, J.; Hu, G.; Xu, Y.; Torrens-Spence, M.P.; Zhou, X.; Wang, D.; Weng, J.-K.; Wang, Q. Production of nonnatural straight-chain amino acid 6-aminocaproate via an artificial iterative carbon-chain-extension cycle. Metab. Eng. 2019, 55, 23–32. [Google Scholar] [CrossRef]
  32. Kruger, N.J. The Bradford method for protein quantitation. In The Protein Protocols Handbook; Humana Press: Totowa, NJ, USA, 2009; pp. 17–24. [Google Scholar]
  33. Wu, T.-Y.; Chen, C.-T.; Liu, J.T.-J.; Bogorad, I.W.; Damoiseaux, R.; Liao, J.C. Characterization and evolution of an activator-independent methanol dehydrogenase from Cupriavidus necator N-1. Appl. Microbiol. Biotechnol. 2016, 100, 4969–4983. [Google Scholar] [CrossRef]
  34. Wang, X.; Saba, T.; Yiu, H.H.; Howe, R.F.; Anderson, J.A.; Shi, J. Cofactor NAD (P) H regeneration inspired by heterogeneous pathways. Chem 2017, 2, 621–654. [Google Scholar] [CrossRef]
  35. Price, J.V.; Chen, L.; Whitaker, W.B.; Papoutsakis, E.; Chen, W. Scaffoldless engineered enzyme assembly for enhanced methanol utilization. Proc. Natl. Acad. Sci. USA 2016, 113, 12691–12696. [Google Scholar] [CrossRef] [PubMed]
  36. Whitaker, W.B.; Jones, J.A.; Bennett, R.K.; Gonzalez, J.E.; Vernacchio, V.R.; Collins, S.M.; Palmer, M.A.; Schmidt, S.; Antoniewicz, M.R.; Koffas, M.A. Engineering the biological conversion of methanol to specialty chemicals in Escherichia coli. Metab. Eng. 2017, 39, 49–59. [Google Scholar] [CrossRef]
  37. Zavarise, A.; Sridhar, S.; Kiema, T.R.; Wierenga, R.K.; Widersten, M. Structures of lactaldehyde reductase, FucO, link enzyme activity to hydrogen bond networks and conformational dynamics. FEBS J. 2023, 290, 465–481. [Google Scholar] [CrossRef]
  38. Wu, H.; Tian, C.; Song, X.; Liu, C.; Yang, D.; Jiang, Z. Methods for the regeneration of nicotinamide coenzymes. Green Chem. 2013, 15, 1773–1789. [Google Scholar] [CrossRef]
  39. Wang, X.; Yiu, H.H. Heterogeneous catalysis mediated cofactor NADH regeneration for enzymatic reduction. ACS Catal. 2016, 6, 1880–1886. [Google Scholar] [CrossRef]
  40. Whitaker, W.B.; Sandoval, N.R.; Bennett, R.K.; Fast, A.G.; Papoutsakis, E.T. Synthetic methylotrophy: Engineering the production of biofuels and chemicals based on the biology of aerobic methanol utilization. Curr. Opin. Biotechnol. 2015, 33, 165–175. [Google Scholar] [CrossRef]
  41. Li, M.; Chen, H.; Liu, C.; Guo, J.; Xu, X.; Zhang, H.; Nian, R.; Xian, M. Improvement of isoprene production in Escherichia coli by rational optimization of RBSs and key enzymes screening. Microb. Cell Factories 2019, 18, 4. [Google Scholar] [CrossRef]
  42. Dvorak, P.; Chrast, L.; Nikel, P.I.; Fedr, R.; Soucek, K.; Sedlackova, M.; Chaloupkova, R.; de Lorenzo, V.; Prokop, Z.; Damborsky, J. Exacerbation of substrate toxicity by IPTG in Escherichia coli BL21 (DE3) carrying a synthetic metabolic pathway. Microb. Cell Factories 2015, 14, 201. [Google Scholar] [CrossRef]
  43. Simas, R.G.; Pessoa Junior, A.; Long, P.F. Mechanistic aspects of IPTG (isopropylthio-β-galactoside) transport across the cytoplasmic membrane of Escherichia coli—A rate limiting step in the induction of recombinant protein expression. J. Ind. Microbiol. Biotechnol. 2023, 50, kuad034. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Pathway for ethylene glycol production from methanol based on an artificial in vitro enzyme cascade. These enzymes are methanol oxidase (MDH) from Cupriavidus necator N-1, glycolaldehyde synthase (GALS) from Pseudomonas putida, and lactaldehyde–propanediol oxidoreductase (FucO) from Escherichia coli MG1655. The background shows the protein structure of the GALS enzyme.
Figure 1. Pathway for ethylene glycol production from methanol based on an artificial in vitro enzyme cascade. These enzymes are methanol oxidase (MDH) from Cupriavidus necator N-1, glycolaldehyde synthase (GALS) from Pseudomonas putida, and lactaldehyde–propanediol oxidoreductase (FucO) from Escherichia coli MG1655. The background shows the protein structure of the GALS enzyme.
Fermentation 10 00558 g001
Figure 2. EG production of different catalytic systems. (a) Validation of different substrate pathways; (b) Synthesis of ethylene glycol using two substrates, methanol and formaldehyde, respectively.
Figure 2. EG production of different catalytic systems. (a) Validation of different substrate pathways; (b) Synthesis of ethylene glycol using two substrates, methanol and formaldehyde, respectively.
Fermentation 10 00558 g002
Figure 3. Conversion of methanol into ethylene glycol using RBS series strains through whole-cell catalysis in shake flasks. (a) Five strains with strong EG-producing ability and unmodified strains (YS). (b) Effect of different IPTG additions on EG production. (c) EG production capacity under different IPTG induction times. (d) Regulation of different substrate concentrations on whole-cell catalytic production of EG.
Figure 3. Conversion of methanol into ethylene glycol using RBS series strains through whole-cell catalysis in shake flasks. (a) Five strains with strong EG-producing ability and unmodified strains (YS). (b) Effect of different IPTG additions on EG production. (c) EG production capacity under different IPTG induction times. (d) Regulation of different substrate concentrations on whole-cell catalytic production of EG.
Fermentation 10 00558 g003
Figure 4. Methanol is converted to ethylene glycol in a 5 L fermenter. (a) When the cell density reached 30 (OD600), 1 mM IPTG was added and the expression of the pathway enzyme was induced at 16 °C for 16 h. (b) The catalytic reaction was carried out at 37 °C and 300 rpm. The error bar represents the standard deviation of three parallel repetitions. Due to the small data error in the process of some data detection, some error bars in the figure are not obvious.
Figure 4. Methanol is converted to ethylene glycol in a 5 L fermenter. (a) When the cell density reached 30 (OD600), 1 mM IPTG was added and the expression of the pathway enzyme was induced at 16 °C for 16 h. (b) The catalytic reaction was carried out at 37 °C and 300 rpm. The error bar represents the standard deviation of three parallel repetitions. Due to the small data error in the process of some data detection, some error bars in the figure are not obvious.
Fermentation 10 00558 g004
Table 2. Strains and plasmids used in this study.
Table 2. Strains and plasmids used in this study.
Strain or PlasmidDescriptionSource
Strains
E. coli DH5αPlasmid extractionOur laboratory
E. coli BL21(DE3)F-ompT hsdSB (rB-mB-) gal (λ c I 857 ind1 Sam7 nin5 lacUV5 T7gene1) dcm (DE3)Our laboratory
E.coli BL21(DE3)/MDHE. coli BL21(DE3) expressing MDH from Cupriavidus necator N-1This study
E. coli BL21(DE3)/GALSE. coli BL21(DE3) expressing GALS from Pseudomonas putidaThis study
E. coli BL21(DE3)/FucOE. coli BL21(DE3) expressing FucO from Escherichia coli MG1655This study
E. coli BL21(DE3)/MGFCo-expressing strains of MDH, GALS, and FucOThis study
Plasmids
pET28aVector carries N-terminal His Tag, Kanr, 5369 bpOur laboratory
pET28a-MDHpET28a harboring the MDH geneThis study
pET28a-GALSpET28a harboring the GALS geneThis study
pET28a-FucOpET28a harboring the FucO geneThis study
pET28a-MGFpET28a harboring the MDH, GALS, and FucO geneThis study
Table 3. Primers used in this study.
Table 3. Primers used in this study.
PrimersSequences (5′-3′)
F1-ZTGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAG
R1-ZTCACCACCACCACCACCAC
F1-MDHCTTTAAGAAGGAGATATACCatgacccacctgaac
R1-MDHGTGGTGGTGGTGGTGGTGcatcgccgcagcgaagattg
F1-GALSCTTTAAGAAGGAGATATACCatggcttctgttcacggtac
R1-GALSGTGGTGGTGGTGGTGGTGtttaaccggagaaac
F1-FucOGTTTAACTTTAAGAAGGAGATATACCatggctaacagaatgattct
R1-FucOGTGGTGGTGGTGGTGGTGccaggcggtatg
F1-M/GCTGAAAGAAGATTAAatggcttctgttcacg
R1-M/GGTGAACAGAAGCCATttaatcttctttcagtttc
F2-G/FCGTTTCTCCGGTTAAATAAatggctaacagaatg
R2-G/FCATTCTGTTAGCCATttatttaaccggag
Table 4. Kinetic constants of pathway enzymes.
Table 4. Kinetic constants of pathway enzymes.
EnzymeKm (mM)kcat (s−1)kcat/Km (M−1 s−1)Reference
MDH21.6 ± 1.50.2 ± 0.019.30[33]
GALS1701.69.60[27]
EcGCL180.15.20[24]
FucO2.42410[24]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhu, Z.; Li, W.; Wang, D.; Fang, X.; Li, J.; Li, X. Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism. Fermentation 2024, 10, 558. https://doi.org/10.3390/fermentation10110558

AMA Style

Zhu Z, Li W, Wang D, Fang X, Li J, Li X. Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism. Fermentation. 2024; 10(11):558. https://doi.org/10.3390/fermentation10110558

Chicago/Turabian Style

Zhu, Zeyang, Wenwei Li, Dan Wang, Xia Fang, Jianing Li, and Xuyang Li. 2024. "Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism" Fermentation 10, no. 11: 558. https://doi.org/10.3390/fermentation10110558

APA Style

Zhu, Z., Li, W., Wang, D., Fang, X., Li, J., & Li, X. (2024). Constructing a New Pathway for Ethylene Glycol Biosynthesis and Its Coenzyme Reuse Mechanism. Fermentation, 10(11), 558. https://doi.org/10.3390/fermentation10110558

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop