Differential Expression of Cell Wall Remodeling Genes Is Part of the Dynamic Phase-Specific Transcriptional Program of Conidial Germination of Trichoderma asperelloides
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Culturing Conditions
2.2. Isolation of Nucleic Acids, RT-PCR, and RNASeq
2.3. Bayesian Network Prediction for Functional Genes Groups during Conidial Germination
3. Results
3.1. Phenotypic Characteristics of Germinating T. asperelloides Strain T203
3.2. Changes in Gene Expression during Germination of T. asperelloides Strain T203
3.2.1. Changes in Cellular Component Gene Expression Pattern during Conidial Germination
3.2.2. Expression of Genes Associated with Cell Wall Remodeling during Germination
3.3. Congo Red Affects Germination and Alters Expression of gel3
3.4. Changes in Expression of Chitin-Synthase- and Glucan-Elongase-Encoding Genes in the Presence of Rhizoctonia solani
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Osherov, N.; May, G.S. The Molecular Mechanisms of Conidial Germination. FEMS Microbiol. Lett. 2001, 199, 153–160. [Google Scholar] [CrossRef] [PubMed]
- Deacon, J. Fungal Biology, 4th ed.; John Wiley & Sons: Hoboken, NJ, USA, 2013; ISBN 9781405169530. [Google Scholar]
- Watkinson, S.C.; Boddy, L.; Money, N.P. The Fungi, 3rd ed.; Academic Press: Cambridge, MA, USA, 2015; ISBN 9780123820341. [Google Scholar]
- D’Enfert, C. Fungal Spore Germination: Insights from the Molecular Genetics of Aspergillus nidulans and Neurospora crassa. Fungal Genet. Biol. 1997, 21, 163–172. [Google Scholar] [CrossRef]
- Gottlieb, D. The Physiology of Spore Germination in Fungi. Bot. Rev. 1950, 16, 229–257. [Google Scholar] [CrossRef]
- Wang, F.; Sethiya, P.; Hu, X.; Guo, S.; Chen, Y.; Li, A.; Tan, K.; Wong, K.H. Transcription in Fungal Conidia before Dormancy Produces Phenotypically Variable Conidia That Maximize Survival in Different Environments. Nat. Microbiol. 2021, 6, 1066–1081. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Miguel-Rojas, C.; Lopez-Giraldez, F.; Yarden, O.; Trail, F.; Townsend, J.P. Metabolism and Development during Conidial Germination in Response to a Carbon-Nitrogen-Rich Synthetic or a Natural Source of Nutrition in Neurospora crassa. mBio 2019, 10, e00192-19. [Google Scholar] [CrossRef] [PubMed]
- Osherov, N.; May, G. Conidial Germination in Aspergillus nidulans Requires RAS Signaling and Protein Synthesis. Genetics 2000, 155, 647–656. [Google Scholar] [CrossRef] [PubMed]
- Baltussen, T.J.H.; Zoll, J.; Verweij, P.E.; Melchers, W.J.G. Molecular Mechanisms of Conidial Germination in Aspergillus. Microbiol. Mol. Biol. Rev. 2019, 84, e00049-19. [Google Scholar] [CrossRef] [PubMed]
- van Leeuwen, M.R.; Krijgsheld, P.; Bleichrodt, R.; Menke, H.; Stam, H.; Stark, J.; Wösten, H.A.B.; Dijksterhuis, J. Germination of Conidia of Aspergillus niger Is Accompanied by Major Changes in RNA Profiles. Stud. Mycol. 2013, 74, 59–70. [Google Scholar] [CrossRef]
- Suh, M.J.; Fedorova, N.D.; Cagas, S.E.; Hastings, S.; Fleischmann, R.D.; Peterson, S.N.; Perlin, D.S.; Nierman, W.C.; Pieper, R.; Momany, M. Development Stage-Specific Proteomic Profiling Uncovers Small, Lineage Specific Proteins Most Abundant in the Aspergillus fumigatus Conidial Proteome. Proteome Sci. 2012, 10, 30. [Google Scholar] [CrossRef]
- Seong, K.Y.; Zhao, X.; Xu, J.R.; Güldener, U.; Kistler, H.C. Conidial Germination in the Filamentous Fungus Fusarium graminearum. Fungal Genet. Biol. 2008, 45, 389–399. [Google Scholar] [CrossRef] [PubMed]
- Kasuga, T.; Townsend, J.P.; Tian, C.; Gilbert, L.B.; Mannhaupt, G.; Taylor, J.W.; Glass, N.L. Long-Oligomer Microarray Profiling in Neurospora crassa Reveals the Transcriptional Program Underlying Biochemical and Physiological Events of Conidial Germination. Nucleic Acids Res. 2005, 33, 6469–6485. [Google Scholar] [CrossRef] [PubMed]
- Druzhinina, I.S.; Seidl-Seiboth, V.; Herrera-Estrella, A.; Horwitz, B.A.; Kenerley, C.M.; Monte, E.; Mukherjee, P.K.; Zeilinger, S.; Grigoriev, I.V.; Kubicek, C.P. Trichoderma: The Genomics of Opportunistic Success. Nat. Rev. Microbiol. 2011, 9, 749–759. [Google Scholar] [CrossRef] [PubMed]
- Rossman, A.Y.; Seifert, K.A.; Samuels, G.J.; Minnis, A.M.; Schroers, H.-J.; Lombard, L.; Crous, P.W.; Põldmaa, K.; Cannon, P.F.; Summerbell, R.C.; et al. Genera in Bionectriaceae, Hypocreaceae, and Nectriaceae (Hypocreales) Proposed for Acceptance or Rejection. IMA Fungus 2013, 4, 41–51. [Google Scholar] [CrossRef] [PubMed]
- Samuels, G.J. Trichoderma: Systematics, the Sexual State, and Ecology. Phytopathology 2006, 96, 195–206. [Google Scholar] [CrossRef] [PubMed]
- Atanasova, L. Ecophysiology of Trichoderma in Genomic Perspective. In Biotechnology and Biology of Trichoderma; Elsevier: Amsterdam, The Netherlands, 2014; pp. 25–40. [Google Scholar] [CrossRef]
- Ben-Dor Cohen, E.; Ilan, M.; Yarden, O. The Culturable Mycobiome of Mesophotic Agelas oroides: Constituents and Changes Following Sponge Transplantation to Shallow Water. J. Fungi 2021, 7, 567. [Google Scholar] [CrossRef] [PubMed]
- Gal-Hemed, I.; Atanasova, L.; Komon-Zelazowska, M.; Druzhinina, I.S.; Viterbo, A.; Yarden, O. Marine Isolates of Trichoderma spp. As Potential Halotolerant Agents of Biological Control for Arid-Zone Agriculture. Appl. Environ. Microbiol. 2011, 77, 5100–5109. [Google Scholar] [CrossRef]
- Groll, A.H.; Walsh, T.J. Uncommon Opportunistic Fungi: New Nosocomial Threats. Clin. Microbiol. Infect. 2001, 7, 8–24. [Google Scholar] [CrossRef]
- du Plessis, I.L.; Druzhinina, I.S.; Atanasova, L.; Yarden, O.; Jacobs, K. The Diversity of Trichoderma Species from Soil in South Africa, with Five New Additions. Mycologia 2018, 110, 559–583. [Google Scholar] [CrossRef]
- Kubicek, C.P.; Herrera-Estrella, A.; Seidl-Seiboth, V.; Martinez, D.A.; Druzhinina, I.S.; Thon, M.; Zeilinger, S.; Casas-Flores, S.; Horwitz, B.A.; Mukherjee, P.K.; et al. Comparative Genome Sequence Analysis Underscores Mycoparasitism as the Ancestral Life Style of Trichoderma. Genome Biol. 2011, 12, R40. [Google Scholar] [CrossRef]
- Mukherjee, P.K.; Mendoza-Mendoza, A.; Zeilinger, S.; Horwitz, B.A. Mycoparasitism as a Mechanism of Trichoderma-Mediated Suppression of Plant Diseases. Fungal Biol. Rev. 2022, 39, 15–33. [Google Scholar] [CrossRef]
- Kubicek, C.P. Fungi and Lignocellulosic Biomass; John Wiley & Sons: Hoboken, NJ, USA, 2012; ISBN 9780470960097. [Google Scholar]
- Sood, M.; Kapoor, D.; Kumar, V.; Sheteiwy, M.S.; Ramakrishnan, M.; Landi, M.; Araniti, F.; Sharma, A. Trichoderma: The “Secrets” of a Multitalented Biocontrol Agent. Plants 2020, 9, 762. [Google Scholar] [CrossRef] [PubMed]
- Benítez, T.; Rincón, A.M.; Limón, M.C.; Codón, A.C. Biocontrol Mechanisms of Trichoderma Strains. Int. Microbiol. 2004, 7, 249–260. [Google Scholar] [PubMed]
- Fraceto, L.F.; Maruyama, C.R.; Guilger, M.; Mishra, S.; Keswani, C.; Singh, H.B.; de Lima, R. Trichoderma Harzianum-Based Novel Formulations: Potential Applications for Management of Next-Gen Agricultural Challenges. J. Chem. Technol. Biotechnol. 2018, 93, 2056–2063. [Google Scholar] [CrossRef]
- Rajesh, R.W.; Rahul, M.S.; Ambalal, N.S. Trichoderma: A Significant Fungus for Agriculture and Environment. Afr. J. Agric. Res. 2016, 11, 1952–1965. [Google Scholar] [CrossRef]
- Osherov, N.; Yarden, O. The Fungal Cell Wall. In Cellular and Molecular Biology of Filamentous Fungi; Borkovich, K.A., Ebbole, D.J., Eds.; American Society of Microbiology Press: New York, NY, USA, 2010; pp. 224–237. [Google Scholar]
- Garcia-Rubio, R.; de Oliveira, H.C.; Rivera, J.; Trevijano-Contador, N. The Fungal Cell Wall: Candida, Cryptococcus, and Aspergillus Species. Front. Microbiol. 2020, 10, 2993. [Google Scholar] [CrossRef]
- Free, S.J. Fungal Cell Wall Organization and Biosynthesis. Adv. Genet. 2013, 81, 33–82. [Google Scholar]
- Beauvais, A.; Latgé, J.P. Special Issue: Fungal Cell Wall. J. Fungi 2018, 4, 91. [Google Scholar] [CrossRef]
- Kappel, L.; Gruber, S. Chitin and Chitosan—Important Structural Components in Trichoderma Cell Wall Remodeling. In New and Future Developments in Microbial Biotechnology and Bioengineering; Elsevier: Amsterdam, The Netherlands, 2020. [Google Scholar]
- Mouyna, I.; Fontaine, T.; Vai, M.; Monod, M.; Fonzi, W.A.; Diaquin, M.; Popolo, L.; Hartlandt, R.P.; Latgé, J.P. Glycosylphosphatidylinositol-Anchored Glucanosyltransferases Play an Active Role in the Biosynthesis of the Fungal Cell Wall. J. Biol. Chem. 2000, 275, 14882–14889. [Google Scholar] [CrossRef]
- Patel, P.; Free, S.J. Characterization of Neurospora Crassa GH16, GH17, and GH72 Gene Families of Cell Wall Crosslinking Enzymes. Cell Surf. 2022, 8, 100073. [Google Scholar] [CrossRef]
- Ao, J.; Free, S.J. Genetic and Biochemical Characterization of the GH72 Family of Cell Wall Transglycosylases in Neurospora crassa. Fungal Genet. Biol. 2017, 101, 46–54. [Google Scholar] [CrossRef]
- Patel, P.K.; Free, S.J. The Genetics and Biochemistry of Cell Wall Structure and Synthesis in Neurospora crassa, a Model Filamentous Fungus. Front. Microbiol. 2019, 10, 2294. [Google Scholar] [CrossRef] [PubMed]
- Verburg, K.; van Neer, J.; Duca, M.; de Cock, H. Novel Treatment Approach for Aspergilloses by Targeting Germination. J. Fungi 2022, 8, 758. [Google Scholar] [CrossRef] [PubMed]
- Samuels, G.J.; Ismaiel, A.; Bon, M.C.; de Respinis, S.; Petrini, O. Trichoderma asperellum sensu lato Consists of Two Cryptic Species. Mycologia 2010, 102, 944–966. [Google Scholar] [CrossRef] [PubMed]
- Elad, Y. Parasitism of Trichoderma Spp. on Rhizoctonia solani and Sclerotium rolfsii—Scanning Electron Microscopy and Fluorescence Microscopy. Phytopathology 1983, 73, 85. [Google Scholar] [CrossRef]
- Viterbo, A.; Montero, M.; Ramot, O.; Friesem, D.; Monte, E.; Llobell, A.; Chet, I. Expression Regulation of the Endochitinase Chit36 from Trichoderma asperellum (T. harzianum T-203). Curr. Genet. 2002, 42, 114–122. [Google Scholar] [CrossRef] [PubMed]
- Chet, I. (Ed.) Trichoderma—Application, Mode of Action, and Potential as Biocontrol Agent of Soilborne Plant Pathogenic. In Innovative Approaches to Plant Disease Control; John Wiley: New York, NY, USA, 1987; pp. 137–160. [Google Scholar]
- Gortikov, M.; Wang, Z.; Steindorff, A.S.; Grigoriev, I.V.; Druzhinina, I.S.; Townsend, J.P.; Yarden, O. Sequencing and Analysis of the Entire Genome of the Mycoparasitic Bioeffector Fungus Trichoderma asperelloides Strain T 203 (Hypocreales). Microbiol. Resour. Announc. 2022, 11, e0099521. [Google Scholar] [CrossRef]
- Paz, Z.; Komon-Zelazowska, M.; Druzhinina, I.S.; Aveskamp, M.M.; Shnaiderman, A.; Aluma, Y.; Carmeli, S.; Ilan, M.; Yarden, O. Diversity and Potential Antifungal Properties of Fungi Associated with a Mediterranean Sponge. Fungal Divers. 2010, 42, 17–26. [Google Scholar] [CrossRef]
- Herold, I.; Zolti, A.; Garduño-Rosales, M.; Wang, Z.; López-Giráldez, F.; Mouriño-Pérez, R.R.; Townsend, J.P.; Ulitsky, I.; Yarden, O. The GUL-1 Protein Binds Multiple RNAs Involved in Cell Wall Remodeling and Affects the MAK-1 Pathway in Neurospora crassa. Front. Fungal Biol. 2021, 2, 672696. [Google Scholar] [CrossRef]
- Herold, I.; Kowbel, D.; Delgado-Álvarez, D.L.; Garduño-Rosales, M.; Mouriño-Pérez, R.R.; Yarden, O. Transcriptional Profiling and Localization of GUL-1, a COT-1 Pathway Component, in Neurospora crassa. Fungal Genet. Biol. 2019, 126, 1–11. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Lopez-Giraldez, F.; Townsend, J.P. LOX: Inferring Level of EXpression from Diverse Methods of Census Sequencing. Bioinformatics 2010, 26, 1918–1919. [Google Scholar] [CrossRef] [PubMed]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Kriventseva, E.V.; Kuznetsov, D.; Tegenfeldt, F.; Manni, M.; Dias, R.; Simão, F.A.; Zdobnov, E.M. OrthoDB V10: Sampling the Diversity of Animal, Plant, Fungal, Protist, Bacterial and Viral Genomes for Evolutionary and Functional Annotations of Orthologs. Nucleic Acids Res. 2019, 47, D807–D811. [Google Scholar] [CrossRef] [PubMed]
- Ziebarth, J.D.; Bhattacharya, A.; Cui, Y. Bayesian Network Webserver: A Comprehensive Tool for Biological Network Modeling. Bioinformatics 2013, 29, 2801–2803. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Lopez-Giraldez, F.; Lehr, N.; Farré, M.; Common, R.; Trail, F.; Townsend, J.P. Global Gene Expression and Focused Knockout Analysis Reveals Genes Associated with Fungal Fruiting Body Development in Neurospora crassa. Eukaryot. Cell 2014, 13, 154–169. [Google Scholar] [CrossRef] [PubMed]
- Trail, F.; Wang, Z.; Stefanko, K.; Cubba, C.; Townsend, J.P. The Ancestral Levels of Transcription and the Evolution of Sexual Phenotypes in Filamentous Fungi. PLOS Genet. 2017, 13, e1006867. [Google Scholar] [CrossRef]
- Sephton-Clark, P.C.S.; Muñoz, J.F.; Ballou, E.R.; Cuomo, C.A.; Voelz, K. Pathways of Pathogenicity: Transcriptional Stages of Germination in the Fatal Fungal Pathogen Rhizopus delemar. mSphere 2018, 3, e00403-18. [Google Scholar] [CrossRef]
- Baltussen, T.J.H.; Coolen, J.P.M.; Zoll, J.; Verweij, P.E.; Melchers, W.J.G. Gene Co-Expression Analysis Identifies Gene Clusters Associated with Isotropic and Polarized Growth in Aspergillus fumigatus Conidia. Fungal Genet. Biol. 2018, 116, 62–72. [Google Scholar] [CrossRef]
- Millet, N.; Moya-Nilges, M.; Sachse, M.; Krijnse Locker, J.; Latgé, J.; Mouyna, I. Aspergillus fumigatus Exoβ(1-3)Glucanases Family GH55 Are Essential for Conidial Cell Wall Morphogenesis. Cell. Microbiol. 2019, 21, e13102. [Google Scholar] [CrossRef]
- Gow, N.A.R.; Latge, J.-P.; Munro, C.A. The Fungal Cell Wall: Structure, Biosynthesis, and Function. Microbiol. Spectr. 2017, 5. [Google Scholar] [CrossRef] [PubMed]
- Ene, I.V.; Walker, L.A.; Schiavone, M.; Lee, K.K.; Martin-Yken, H.; Dague, E.; Gow, N.A.R.; Munro, C.A.; Brown, A.J.P. Cell Wall Remodeling Enzymes Modulate Fungal Cell Wall Elasticity and Osmotic Stress Resistance. mBio 2015, 6, e00986. [Google Scholar] [CrossRef]
- Herold, I.; Yarden, O. Regulation of Neurospora crassa Cell Wall Remodeling via the cot-1 Pathway Is Mediated by gul-1. Curr. Genet. 2017, 63, 145–159. [Google Scholar] [CrossRef]
- Shaw, J.A.; Mol, P.C.; Bowers, B.; Silverman, S.J.; Valdivieso, M.H.; Duran, A.; Cabib, E. The Function of Chitin Synthases 2 and 3 in the Saccharomyces cerevisiae Cell Cycle. J. Cell Biol. 1991, 114, 111–123. [Google Scholar] [CrossRef] [PubMed]
- Din, A.B.; Yarden, O. The Neurospora crassa chs-2 Gene Encodes a Non-Essential Chitin Synthase. Microbiology 1994, 140, 2189–2197. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Fajardo-Somera, R.A.; Jöhnk, B.; Bayram, Ö.; Valerius, O.; Braus, G.H.; Riquelme, M. Dissecting the Function of the Different Chitin Synthases in Vegetative Growth and Sexual Development in Neurospora crassa. Fungal Genet. Biol. 2015, 75, 30–45. [Google Scholar] [CrossRef] [PubMed]
- Münsterkötter, M.; Sipos, G.; Escobar Rodriguez, C.; Gruber, S. Chitin and Chitosan Remodeling Defines Vegetative Development and Trichoderma Biocontrol. PLoS Pathog. 2020, 16, e1008320. [Google Scholar] [CrossRef]
- Kamei, M.; Yamashita, K.; Takahashi, M.; Fukumori, F.; Ichiishi, A.; Fujimura, M. Deletion and Expression Analysis of Beta-(1,3)-Glucanosyltransferase Genes in Neurospora crassa. Fungal Genet. Biol. 2013, 52, 65–72. [Google Scholar] [CrossRef]
- Kopecká, M.; Gabriel, M. The Influence of Congo Red on the Cell Wall and (1 → 3)-β-d-Glucan Microfibril Biogenesis in Saccharomyces cerevisiae. Arch. Microbiol. 1992, 158, 115–126. [Google Scholar] [CrossRef]
- Liu, Z.; Raj, S.; van Rhijn, N.; Fraczek, M.; Michel, J.P.; Sismeiro, O.; Legendre, R.; Varet, H.; Fontaine, T.; Bromley, M.; et al. Functional Genomic and Biochemical Analysis Reveals Pleiotropic Effect of Congo Red on Aspergillus fumigatus. mBio 2021, 12, e00863-21. [Google Scholar] [CrossRef]
- Howell, C.R. Mechanisms Employed by Trichoderma Species in the Biological Control of Plant Diseases: The History and Evolution of Current Concepts. Plant Dis. 2003, 87, 4–10. [Google Scholar] [CrossRef]
- Shalini, S.; Kotasthane, A.S. Parasitism of Rhizoctonia Solani by Strains of Trichoderma spp. Electron. J. Environ. Agric. Food Chem. 2007, 6, 2272–2281. [Google Scholar] [CrossRef]
- Moreno-Ruiz, D.; Salzmann, L.; Fricker, M.; Zeilinger, S.; Lichius, A. Stress-Activated Protein Kinase Signalling Regulates Mycoparasitic Hyphal-Hyphal Interactions in Trichoderma atroviride. J. Fungi 2021, 7, 365. [Google Scholar] [CrossRef]
- Zapparata, A.; Baroncelli, R.; Brandström Durling, M.; Kubicek, C.P.; Karlsson, M.; Vannacci, G.; Sarrocco, S. Fungal Cross-Talk: An Integrated Approach to Study Distance Communication. Fungal Genet. Biol. 2021, 148, 103518. [Google Scholar] [CrossRef] [PubMed]
- Cooper, B.; Neelam, A.; Campbell, K.B.; Lee, J.; Liu, G.; Garrett, W.M.; Scheffler, B.; Tucker, M.L. Protein Accumulation in the Germinating Uromyces appendiculatus Uredospore. Mol. Plant-Microbe Interact. 2007, 20, 857–866. [Google Scholar] [CrossRef] [PubMed]
- Balotf, S.; Wilson, R.; Tegg, R.S.; Nichols, D.S.; Wilson, C.R. Quantitative Proteomics Provides an Insight into Germination-related Proteins in the Obligate Biotrophic Plant Pathogen Spongospora subterranea. Environ. Microbiol. Rep. 2021, 13, 521–532. [Google Scholar] [CrossRef]
- Brown, S.H.; Yarden, O.; Gollop, N.; Chen, S.; Zveibil, A.; Belausov, E.; Freeman, S. Differential Protein Expression in Colletotrichum acutatum: Changes Associated with Reactive Oxygen Species and Nitrogen Starvation Implicated in Pathogenicity on Strawberry. Mol. Plant Pathol. 2008, 9, 171–190. [Google Scholar] [CrossRef] [PubMed]











| Gene Name | Primer Designation | Sequence (5′ to 3′) |
|---|---|---|
| Translation elongation factor 1α | tef1α F tef1α R | TGACGGCAACCCCACTATCG CGAGTTCGGCGGCTTCCTAT |
| Chitin synthase 1 | CHS1F CHS1R | CATTACGGTGTTGCCCGGTG GCCCATGGCCAGTTTCATCG |
| Chitin synthase 2 | CHS2F CHS2R | CCGACGGGTGGCATCAAAAG GTTCGCCGTGAGGGTTTTCG |
| Chitin synthase 3 | CHS3F CHS3R | CGCCAAGCAGCAAGTGAACA GTGTTCGGCGATGAACCAGC |
| Chitin synthase 4 | CHS4F CHS4R | GGGTATTCCGTTGGAGGCGA GAGCCCTCAGCAAGGGTGAT |
| Chitin synthase 5 | CHS5F CHS5R | GATACCGTTGTCGCCCCAGA ATTAGTCAGGGCCGTCTCGC |
| Chitin synthase 6 | CHS6F CHS6R | ACCGCCATCGTTGGTGTAGT CACGCAGAGCACGTTGATGG |
| Chitin synthase 7 | CHS7F CHS7R | CACCGTACTCCGACTTCCCC ACCGAAGCCTGGGGATAAGC |
| Glycosyl-elongase 1 | GEL1F GEL1R | GTGAGATCCCCGTCGGCTAC GGGTCGCACCACGAATAGGA |
| Glycosyl-elongase 2 | GEL2F GEL2R | GAACCGACTTTGTCGACGCC CCCGACTTGGGGTCGTATCC |
| Glycosyl-elongase 3 | GEL3F GEL3R | ACGACGTCGATATCCGCTCC AGCGGTCTCGGTGTCATAGC |
| Glycosyl-elongase 4 | GEL4F GEL4R | ACTTTGCCGCGCTTCAGAAC ACTGCTGGGCAGTCTTCAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gortikov, M.; Yakubovich, E.; Wang, Z.; López-Giráldez, F.; Tu, Y.; Townsend, J.P.; Yarden, O. Differential Expression of Cell Wall Remodeling Genes Is Part of the Dynamic Phase-Specific Transcriptional Program of Conidial Germination of Trichoderma asperelloides. J. Fungi 2022, 8, 854. https://doi.org/10.3390/jof8080854
Gortikov M, Yakubovich E, Wang Z, López-Giráldez F, Tu Y, Townsend JP, Yarden O. Differential Expression of Cell Wall Remodeling Genes Is Part of the Dynamic Phase-Specific Transcriptional Program of Conidial Germination of Trichoderma asperelloides. Journal of Fungi. 2022; 8(8):854. https://doi.org/10.3390/jof8080854
Chicago/Turabian StyleGortikov, Maggie, Elizabeta Yakubovich, Zheng Wang, Francesc López-Giráldez, Yujia Tu, Jeffrey P. Townsend, and Oded Yarden. 2022. "Differential Expression of Cell Wall Remodeling Genes Is Part of the Dynamic Phase-Specific Transcriptional Program of Conidial Germination of Trichoderma asperelloides" Journal of Fungi 8, no. 8: 854. https://doi.org/10.3390/jof8080854
APA StyleGortikov, M., Yakubovich, E., Wang, Z., López-Giráldez, F., Tu, Y., Townsend, J. P., & Yarden, O. (2022). Differential Expression of Cell Wall Remodeling Genes Is Part of the Dynamic Phase-Specific Transcriptional Program of Conidial Germination of Trichoderma asperelloides. Journal of Fungi, 8(8), 854. https://doi.org/10.3390/jof8080854

