Fungal Pathogens Associated with Strawberry Crown Rot Disease in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Field Surveys, Disease Symptoms, and Sampling
2.2. Fungal Isolation
2.3. Morphological Characterization
2.3.1. Colletotrichum spp.
2.3.2. Fusarium spp.
2.3.3. Other Fungi
2.4. DNA Extraction, PCR Amplification, and Sequencing
2.5. Phylogenetic Analysis
2.6. Pathogenicity Tests
2.7. Statistics and Analysis
3. Results
3.1. Field Surveys and Sample Collection
3.2. Fungi Collected
3.2.1. Colletotrichum spp.
3.2.2. Fusarium spp.
3.2.3. Other Fungal Species
3.3. Pathogenicity
3.4. Epidemic Distribution of Pathogenic Fungi
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mertely, J.C.; Legard, D.E. Detection, isolation, and pathogenicity of Colletotrichum spp. from strawberry petioles. Plant Dis. 2004, 8, 407–412. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.F.; Chen, H.J.; Sui, Y.; Wang, Y. Key technologies of controlling strawberry green production in greenhouse. North. Hortic. 2019, 18, 164–168. [Google Scholar]
- Wu, J.Y.; Hu, X.R.; Zhang, C.Q. Molecular detection of QoI resistance in Colletotrichum gloeosporioides causing strawberry anthracnose based on loop-mediated isothermal amplification assay. Plant Dis. 2019, 103, 1319–1325. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.; Louws, F.J. Epidemiological significance of crown rot in the fruiting field in relation to Colletotrichum gloeosporioides infection of strawberry nursery plants. Plant Dis. 2017, 101, 907–915. [Google Scholar] [CrossRef][Green Version]
- Morocko, I.; Fatehi, J.; Gerhardson, B. Gnomonia fragariae, a cause of strawberry root rot and petiole blight. Eur. J. Plant Pathol. 2016, 114, 235–244. [Google Scholar] [CrossRef]
- Debode, J.; Van-Hemelrijck, W.; Baeyen, S.; Creemers, P.; Heungens, K.; Maes, M. Quantitative detection and monitoring of Colletotrichum acutatum in strawberry leaves using real-time PCR. Plant Pathol. 2010, 58, 504–514. [Google Scholar] [CrossRef]
- Curry, K.J.; Abril, M.; Avant, J.B.; Smith, B.J. Strawberry anthracnose: Histopathology of Colletotrichum acutatum and C. fragariae. Phytopathology 2002, 92, 1055–1063. [Google Scholar] [CrossRef]
- Mackenzie, S.J.; Mertely, J.C.; Seijo, T.E.; Pereset, N.A. Colletotrichum fragariae is a pathogen on hosts other than strawberry. Plant Dis. 2008, 92, 1432–1438. [Google Scholar] [CrossRef]
- Cano, J.; Guarro, J.; Gene, J. Molecular and morphological identification of Colletotrichum species of clinical interest. J. Clin. Microbiol. 2004, 42, 2450–2454. [Google Scholar] [CrossRef]
- Dai, F.M.; Ren, X.J.; Lu, J.P. First report of anthracnose fruit rot of strawberry caused by Colletotrichum acutatum in China. Plant Dis. 2006, 90, 1460. [Google Scholar] [CrossRef]
- Urea-Padilla, A.R.; Mackenzie, S.J.; Bowen, B.W.; Legard, D.E. Etiology and population genetics of Colletotrichum spp. causing crown and fruit rot of strawberry. Phytopathology 2002, 92, 1245–1252. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Debode, J.; Van-Hemelrijck, W.; Xu, X.M.; Maes, M.; Creemers, P.; Heungens, K. Latent entry and spread of Colletotrichum acutatum (species complex) in strawberry fields. Plant Pathol. 2015, 64, 385–395. [Google Scholar] [CrossRef]
- Chen, X.Y.; Dai, D.J.; Zhao, S.F.; Shen, Y.; Wang, H.D.; Zhang, C.-Q. Genetic diversity of Colletotrichum spp. causing strawberry anthracnose in Zhejiang, China. Plant Dis. 2020, 104, 1951–1957. [Google Scholar] [CrossRef] [PubMed]
- Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef]
- Yang, Y.L.; Liu, Z.Y.; Cai, L.; Hyde, K.D.; Yu, Z.N.; McKenzie, E.H.C. Colletotrichum anthracnose of Amaryllidaceae. Fungal Divers. 2009, 39, 123–146. [Google Scholar]
- Cai, L.; Hyde, K.D.; Taylor, P.; Weir, B.S.; Waller, J.M.; Abang, M.M. A polyphasic approach for studying Colletotrichum. Fungal Divers. 2009, 39, 183–204. [Google Scholar]
- Haegi, A.; Catalano, V.; Luongo, L.; Vitale, S.; Scotton, M.; Ficcadenti, N.; Belisario, A. A newly developed real-time PCR assay for detection and quantification of Fusarium oxysporum and its use in compatible and incompatible interactions with grafted melon genotypes. Phytopathology 2013, 103, 802–810. [Google Scholar] [CrossRef]
- Choi, Y.; Hyde, K.; Ho, W. Single spore isolation of fungi. Fungal Divers. 1999, 3, 29–38. [Google Scholar]
- Yan, J.Y.; Jayawardena, M.M.R.S.; Goonasekara, I.D.; Wang, Y.; Zhang, W.; Liu, M.; Huang, J.B.; Wang, Z.Y.; Shang, J.J.; Peng, Y.L.; et al. Diverse species of Colletotrichum associated with grapevine anthracnose in China. Fungal Divers. 2015, 71, 233–246. [Google Scholar] [CrossRef]
- Ajay Kumar, G. Colletotrichum gloeosporioides: Biology, pathogenicity and management in India. J. Plant Physiol. Pathol. 2014, 2, 2–11. [Google Scholar]
- Zeng, H.L.; Lu, Q.N.; Zeng, P.Y.; Li, R.G. Identification, biological characteristics, and sensitivity of the causal pathogen inducing leaf dieback on lily. Acta Hortic. Sin. 2018, 45, 2407–2416. [Google Scholar]
- Pardo-De, C.J.; Calderon, C.; Rincon, A.M.; Cardenas, M.; Danies, G.; Lopez-Kleine, L.; Restrepoa, S.; Jimenez, P. Species from the Colletotrichum acutatum, Colletotrichum boninense and Colletotrichum gloeosporioides species complexes associated with tree tomato and mango crops in Colombia. Plant Pathol. 2016, 65, 227–237. [Google Scholar] [CrossRef]
- Manamgoda, D.S.; Dhanushka, U.; Lei, C.; Ekachai, C.; Kevin, D. Endophytic Colletotrichum from tropical grasses with a new species C. endophytica. Fungal Divers. 2013, 61, 107–115. [Google Scholar] [CrossRef]
- Tamura1, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA 5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
- Denoyes-Rothan, B.; Guérin, G.; Délye, C.; Smith, B.; Minz, D.; Maymon, M.; Freeman, S. Genetic diversity and pathogenic variability among isolates of Colletotrichum species from strawberry. Phytopathology 2003, 93, 219–228. [Google Scholar] [CrossRef]
- Kruger, E.; Josuttis, M.; Nestby, R.; Andersen, T.B.; Carlen, C.; Mezzetti, B. Influence of growing conditions at different latitudes of Europe on strawberry growth performance, yield and quality. J. Berry Res. 2012, 2, 143–157. [Google Scholar] [CrossRef]
- Gomes, S.; Prieto, P.; Martins-Lopes, P.; Carvalho, T.; Martin, A.; Guedes-Pinto, H. Development of Colletotrichum acutatum on tolerant and susceptible Olea europaea L. cultivars: A microscopic analysis. Mycopathologia 2009, 168, 203–211. [Google Scholar] [CrossRef][Green Version]
- Sánchez, S.; Gambardella, M.; Henríquez, J.L.; Diaz, I. First report of crown rot of strawberry caused by Macrophomina phaseolina in Chile. Plant Dis. 2013, 97, 996. [Google Scholar] [CrossRef]
- Hassan, O.; Chang, T. Morphological and molecular characteristics of fungal species associated with crown rot of strawberry in South Korea. Mol. Biol. Rep. 2022, 49, 51–62. [Google Scholar] [CrossRef]
- Paynter, M.; Gomez, A.; Ko, L.; Herrington, M.E. Research into crown rot and wilt diseases of strawberries in Queensland. Acta Hortic. 2016, 1117, 163–170. [Google Scholar] [CrossRef]
- Paredes, B.D.L.S.G.; Muñoz, F.R. Effect of different fungicides in the control of Colletotrichum acutatum, causal agent of anthracnose crown rot in strawberry plants. Crop Prot. 2002, 21, 11–15. [Google Scholar] [CrossRef]
- Lin, X.F.; Lin, T.; Yuan, S.K.; Dai, D.J.; Shi, H.J.; Zhang, C.Q.; Wang, H.D. Characterization of baseline sensitivity and resistance risk of Colletotrichum gloeosporioides complex isolates from strawberry and grape to two demethylation-inhibitor fungicides, prochloraz and tebuconazole. Australas. Plant Pathol. 2014, 43, 605–613. [Google Scholar]
- Han, Y.C.; Zeng, X.G.; Xiang, F.Y.; Ren, L.; Chen, F.Y.; Gu, Y.C. Distribution and characteristics of Colletotrichum spp. associated with anthracnose of strawberry in Hubei, China. Plant Dis. 2016, 100, 996–1006. [Google Scholar] [CrossRef]
- Han, Y.C.; Xiang, F.Y.; Zeng, X.G.; Zhang, P.; Gu, Y.C. Identification of pathogen causing crown and root rot on strawberry. Sci. Agric. Sin. 2014, 47, 53–60. [Google Scholar]
- Hu, S.D.; Zhang, Y.T.; Yu, H.; Zhou, J.Y.; Hu, M.H.; Liu, A.C.; Wu, J.Y.; Wang, H.C.; Zhang, C.Q. Colletotrichum spp. diversity between leaf anthracnose and crown rot from the same strawberry plant. Front. Microbiol. 2022, 13, 860694. [Google Scholar] [CrossRef] [PubMed]
- Henry, P.M.; Kirkpatrick, S.C.; Islas, C.M.; Pastrana, A.M.; Yoshisato, J.A.; Koike, S.E.; Gordon, T.R. The population of Fusarium oxysporum f. sp. fragariae, cause of Fusarium wilt of strawberry, in California. Plant Dis. 2016, 101, 550–556. [Google Scholar] [CrossRef][Green Version]
- Ayoubi, N.; Soleimani, M.J. Morphological and molecular identification of pathogenic Fusarium spp. on strawberry in Iran. Sydowia 2016, 68, 163–171. [Google Scholar]
- Pastrana, A.M.; Annesi, T.; Motta, E.; Forti, E. First report of Fusarium solani causing crown and root rot on strawberry crops in southwestern Spain. Plant Dis. 2014, 98, 161. [Google Scholar] [CrossRef]
- Lei, Y.H.; Kuang, M.G.; Zheng, C.S.; Li, X.Z.; Gao, W.N.; Li, C.J. Detection and identification of the genus Fusarium by DNA barcoding. J. Plant Prot. Res. 2016, 43, 544–551. [Google Scholar]
- Marin, M.V.; Seijo, T.E.; Mertely, J.; Peres, N.A. First report of crown rot caused by Phytopythium helicoides on strawberry in the Americas. Plant Dis. 2019, 103, 11–14. [Google Scholar] [CrossRef]
- Ishiguro, Y.; Otsubo, K.; Watanabe, H.; Suzuki, M.; Nakayama, K.; Fukuda, T.; Fuginaga, M.; Suga, H.; Kageyama, K. Root and crown rot of strawberry caused by Pythium helicoides and its distribution in strawberry production areas of Japan. J. Gen. Plant Pathol. 2014, 80, 423–429. [Google Scholar] [CrossRef]
- Zhang, L.Q.; Duan, K.; Gao, Q.H.; Song, L.L. First report of Nectria pseudotrichia causing crown rot of strawberry in China. Plant Dis. 2018, 102, 1655. [Google Scholar] [CrossRef]
- Cota, L.V.; Maffia, L.A.; Mizubuti, E.S.G.; Macedo, P.E.F. Biological control by Clonostachys rosea as a key component in the integrated management of strawberry gray mold. Biol. Control. 2009, 50, 222–230. [Google Scholar] [CrossRef]
- Jin, B.C.; Zhang, L.; Xing, D.M.; Zhang, G.Z. Disease occurrence and resistance of 11 strawberry cultivars to anthracnose in the field. Plant Sci. 2014, 40, 123–126. [Google Scholar]
- Tulipani, S.; Marzban, G.; Herndl, A.; Laimer, M.; Battino, M. Influence of environmental and genetic factors on health-related compounds in strawberry. J. Agric. Food Chem. 2011, 124, 906–913. [Google Scholar] [CrossRef]
Species | Gene | Primers | Direction | Length (bp) | Sequence |
---|---|---|---|---|---|
Colletotrichum spp. | ACT | ACT-512F | Forward | 399 | ATGTGCAAGGCCGGTTTCGC |
ACT-783R | Reverse | TACGAGTCCTTCTGGCCCAT | |||
CAL | CL1C | Forward | 773 | GAATTCAAGGAGGCCTTCTC | |
CL2C | Reverse | CTTCTGCATCATGAGCTGGAC | |||
CHS-I | CHS-79F | Forward | 779 | TGGGGCAAGGATGCTTGGAAGAAG | |
CHS-354R | Reverse | TGGAAGAACCATCTGTGAGAGTTG | |||
GAPDH | GDF | Forward | 870 | GCCGTCAACGACCCCTTCATTGA | |
FDR | Reverse | GGGTGGAGTCGTACTTGAGCATGT | |||
Fusarium | EF1-α | EF1 | Forward | 680 | ATGGGTATAAGGAAGGACAAGAC |
EF2 | Reverse | GGAGAGTACCAGTGAATCATGTT | |||
other species | ITS | Its-1F | Forward | 593 | CTTGGTCATTTAGAGGAAGTAA |
Its-4R | Reverse | TCCTCCGCTTATTGATATGC |
Fungal Species | Strawberry Varieties | |||||
---|---|---|---|---|---|---|
Hongjia | Zhangji | Tianxianzui | Hongyu | Yuexin | Total | |
Colletotrichum spp. | 91 | 69 | 13 | 6 | 6 | 185 |
Fusarium spp. | 36 | 25 | 4 | 21 | 6 | 86 |
Other species | 10 | 5 | 0 | 0 | 0 | 15 |
Total | 137 | 99 | 17 | 27 | 6 | 287 |
Species v | Conidia | Appressoria | Growth Rate (mm/ day) x | ||
---|---|---|---|---|---|
Length (μm) | Width (μm) | Length (μm) | Width (μm) | ||
C. fructicola | 17.18 ± 0.23 | 6.21 ± 0.19 | 8.19 ± 0.10 | 6.50 ± 0.13 | 14.18 ± 0.02 |
C. siamense | 15.07 ± 0.49 | 6.26 ± 0.26 | 7.09 ± 0.11 | 6.46 ± 0.09 | 13.51 ± 0.17 |
F. oxysporum | 15.49 ± 0.71 | 5.96 ± 0.27 | 11.35 ± 0.20 | 5.73 ± 0.15 | 13.72 ± 0.31 |
F. commune | 13.71 ± 0.31 | 5.12 ± 0.09 | 8.75 ± 0.20 | 4.11 ± 0.08 | 13.91 ± 0.30 |
F. equiseti | 37.90 ± 3.04 | 7.30 ± 0.55 | 11.93 ± 0.32 | 7.26 ± 0.20 | 14.52 ± 0.27 |
F. solani | 13.53 ± 0.26 | 6.48 ± 0.16 | 7.99 ± 0.13 | 4.85 ± 0.08 | 14.48 ± 0.19 |
F. tricinctum | 15.92 ± 0.71 | 5.06 ± 0.13 | / | / | 9.43 ± 0.07 |
E. sorghinum | 16.39 ± 0.32 | 7.91 ± 0.18 | / | / | 13.85 ± 0.11 |
S. lycopersici | 6.43 ± 0.22 | 3.60 ± 0.09 | / | / | 12.83 ± 0.08 |
Cl. rosea | 22.74 ± 0.37 | 21.13 ± 0.28 | / | / | 13.77 ± 0.03 |
P. herbarum | 19.81 ± 0.95 | 7.74 ± 0.22 | / | / | 12.70 ± 0.20 |
Cu. trifolii | 25.05 ± 0.38 | 9.42 ± 0.17 | / | / | 12.36 ± 0.18 |
Species v | Pathogenicity | |
---|---|---|
Disease Incidence (%) | Lesion Length (mm) | |
C. fructicola | 39.34 ± 1.40 d | 92.13 ± 3.98 a z |
C. siamense | 63.49 ± 1.58 a | 64.00 ± 3.79 bc |
F. oxysporum | 63.17 ± 2.37 a | 75.83 ± 6.76 ab |
F. commune | 38.96 ± 3.16 d | 69.77 ± 8.51 b |
F. equiseti | 52.38 ± 2.75 bc | 40.40 ± 3.83 de |
F. solani | 39.54 ± 2.88 d | 40.00 ± 4.83 de |
F. tricinctum | 28.33 ± 2.44 e | 21.33 ± 3.84 ef |
E. sorghinum | 45.93 ± 6.18 cd | 42.22 ± 5.63 de |
S. lycopersici | 50.49 ± 3.75 bc | 59.00 ± 2.39 bc |
Cl. rosea | 52.91 ± 3.26 bc | 42.67 ± 3.93 de |
P. herbarum | 57.14 ± 2.13 ab | 66.09 ± 5.93 b |
Cu. trifolii | 16.09 ± 1.74 f | 13.40 ± 1.03 f |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Yu, H.; Hu, M.; Wu, J.; Zhang, C. Fungal Pathogens Associated with Strawberry Crown Rot Disease in China. J. Fungi 2022, 8, 1161. https://doi.org/10.3390/jof8111161
Zhang Y, Yu H, Hu M, Wu J, Zhang C. Fungal Pathogens Associated with Strawberry Crown Rot Disease in China. Journal of Fungi. 2022; 8(11):1161. https://doi.org/10.3390/jof8111161
Chicago/Turabian StyleZhang, Yanting, Hong Yu, Meihua Hu, Jianyan Wu, and Chuanqing Zhang. 2022. "Fungal Pathogens Associated with Strawberry Crown Rot Disease in China" Journal of Fungi 8, no. 11: 1161. https://doi.org/10.3390/jof8111161
APA StyleZhang, Y., Yu, H., Hu, M., Wu, J., & Zhang, C. (2022). Fungal Pathogens Associated with Strawberry Crown Rot Disease in China. Journal of Fungi, 8(11), 1161. https://doi.org/10.3390/jof8111161