Evaluation of the Immunogenicity of a Pool of Recombinant Lactococcus lactis Expressing Eight Antigens of African Swine Fever Virus in a Mouse Model
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, and Target DNAs
2.2. Construction of the Recombinant Plasmids
2.3. Construction of the Recombinant L. lactis
2.4. Western Blotting
2.5. Growth Curve of rL. lactis Strains
2.6. Immunization of Mice
2.7. Enzyme-Linked Immunosorbent Assay (ELISA)
2.8. Spleen Lymphocytes Proliferation Test
2.9. Statistical Analysis
3. Results
3.1. Eight rL. lactis Strains Enabled Soluble Expression of Corresponding ASFV Antigens
3.2. Stable Inheritance of Recombinant Plasmids Without Affecting Bacterial Strain Growth
3.3. Intramuscular Injection of rL. lactis-Mix Induced High-Level Serum IgG Antibodies in Immunized Mice
3.4. Oral Gavage of rL. lactis-Mix Induced High-Level sIgA Antibodies in Immunized Mice at the Early Stage of Immunization
3.5. Intramuscular Injection of rL. lactis-Mix Elevated Sera IFN-γ and IL-10 in Immunized Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhao, D.; Sun, E.; Huang, L.; Ding, L.; Zhu, Y.; Zhang, J.; Shen, D.; Zhang, X.; Zhang, Z.; Ren, T.; et al. Highly lethal genotype I and II recombinant African swine fever viruses detected in pigs. Nat. Commun. 2023, 14, 3096. [Google Scholar] [CrossRef] [PubMed]
- Penrith, M.L.; Kivaria, F.M. One hundred years of African swine fever in Africa: Where have we been, where are we now, where are we going? Transbound. Emerg. Dis. 2022, 69, e1179–e1200. [Google Scholar] [CrossRef] [PubMed]
- Blome, S.; Gabriel, C.; Beer, M. Modern adjuvants do not enhance the efficacy of an inactivated African swine fever virus vaccine preparation. Vaccine 2014, 32, 3879–3882. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Zhao, D.; He, X.; Liu, R.; Wang, Z.; Zhang, X.; Li, F.; Shan, D.; Chen, H.; Zhang, J.; et al. A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs. Sci. China Life Sci. 2020, 63, 623–634. [Google Scholar] [CrossRef] [PubMed]
- Borca, M.V.; Ramirez-Medina, E.; Silva, E.; Vuono, E.; Rai, A.; Pruitt, S.; Holinka, L.G.; Velazquez-Salinas, L.; Zhu, J.; Gladue, D.P. Development of a highly effective African swine fever virus vaccine by deletion of the I177l gene results in sterile immunity against the current epidemic Eurasia strain. J. Virol. 2020, 94, e02017-19. [Google Scholar] [CrossRef] [PubMed]
- Lopera-Madrid, J.; Medina-Magues, L.G.; Gladue, D.P.; Borca, M.V.; Osorio, J.E. Optimization in the expression of ASFV proteins for the development of subunit vaccines using poxviruses as delivery vectors. Sci. Rep. 2021, 11, 23476. [Google Scholar] [CrossRef]
- Lokhandwala, S.; Waghela, S.D.; Bray, J.; Martin, C.L.; Sangewar, N.; Charendoff, C.; Shetti, R.; Ashley, C.; Chen, C.H.; Berghman, L.R.; et al. Induction of robust immune responses in swine by using a cocktail of adenovirus-vectored African swine fever virus antigens. Clin. Vaccine Immunol. 2016, 23, 888–900. [Google Scholar] [CrossRef] [PubMed]
- Chathuranga, K.; Lee, J.S. African swine fever virus (ASFV): Immunity and vaccine development. Vaccines 2023, 11, 199. [Google Scholar] [CrossRef] [PubMed]
- Kosowska, A.; Cadenas-Fernandez, E.; Barroso, S.; Sanchez-Vizcaino, J.M.; Barasona, J.A. Distinct African swine fever virus shedding in wild boar infected with virulent and attenuated isolates. Vaccines 2020, 8, 767. [Google Scholar] [CrossRef] [PubMed]
- Zajac, M.D.; Trujillo, J.D.; Yao, J.; Kumar, R.; Sangewar, N.; Lokhandwala, S.; Sang, H.; Mallen, K.; McCall, J.; Burton, L.; et al. Immunization of pigs with replication-incompetent adenovirus-vectored African swine fever virus multi-antigens induced humoral immune responses but no protection following contact challenge. Front. Vet. Sci. 2023, 10, 1208275. [Google Scholar] [CrossRef]
- Wang, Z.; Ai, Q.; Huang, S.; Ou, Y.; Gao, Y.; Tong, T.; Fan, H. Immune escape mechanism and vaccine research progress of African swine fever virus. Vaccines 2022, 10, 344. [Google Scholar] [CrossRef]
- Bosch-Camos, L.; Lopez, E.; Rodriguez, F. African swine fever vaccines: A promising work still in progress. Porcine Health Manag. 2020, 6, 17. [Google Scholar] [CrossRef]
- Iyer, L.M.; Balaji, S.; Koonin, E.V.; Aravind, L. Evolutionary genomics of nucleo-cytoplasmic large DNA viruses. Virus Res. 2006, 117, 156–184. [Google Scholar] [CrossRef]
- Yang, S.; Miao, C.; Liu, W.; Zhang, G.; Shao, J.; Chang, H. Structure and function of African swine fever virus proteins: Current understanding. Front. Microbiol. 2023, 14, 1043129. [Google Scholar] [CrossRef] [PubMed]
- Lu, W.; Bai, Y.; Zhang, S.; Zhao, X.; Jin, J.; Zhu, X.; Wang, R.; Wu, Y.; Zhang, A.; Zhang, G.; et al. An intracellular epitope of ASFV CD2v protein elicits humoral and cellular immune responses. Animals 2023, 13, 1967. [Google Scholar] [CrossRef]
- Liu, W.; Li, H.; Liu, B.; Lv, T.; Yang, C.; Chen, S.; Feng, L.; Lai, L.; Duan, Z.; Chen, X.; et al. A new vaccination regimen using adenovirus-vectored vaccine confers effective protection against African swine fever virus in swine. Emerg. Microbes Infect. 2023, 12, 2233643. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Wang, M.; Zhou, L.; Tian, P.; Sun, Z.; Sun, J.; Wang, X.; Zhuang, G.; Jiang, D.; Wu, Y.; et al. A candidate nanoparticle vaccine comprised of multiple epitopes of the African swine fever virus elicits a robust immune response. J. Nanobiotechnol. 2023, 21, 424. [Google Scholar] [CrossRef]
- Jancovich, J.K.; Chapman, D.; Hansen, D.T.; Robida, M.D.; Loskutov, A.; Craciunescu, F.; Borovkov, A.; Kibler, K.; Goatley, L.; King, K.; et al. Immunization of pigs by DNA prime and recombinant vaccinia virus boost to identify and rank African swine fever virus immunogenic and protective proteins. J. Virol. 2018, 92, e02219-17. [Google Scholar] [CrossRef]
- Dieye, Y.; Usai, S.; Clier, F.; Gruss, A.; Piard, J.C. Design of a protein-targeting system for lactic acid bacteria. J. Bacteriol. 2001, 183, 4157–4166. [Google Scholar] [CrossRef] [PubMed]
- Cano-Garrido, O.; Rueda, F.L.; Sanchez-Garcia, L.; Ruiz-Avila, L.; Bosser, R.; Villaverde, A.; Garcia-Fruitos, E. Expanding the recombinant protein quality in Lactococcus lactis. Microb. Cell Fact. 2014, 13, 167. [Google Scholar] [CrossRef]
- Zhou, X.X.; Li, W.F.; Ma, G.X.; Pan, Y.J. The nisin-controlled gene expression system: Construction, application and improvements. Biotechnol. Adv. 2006, 24, 285–295. [Google Scholar] [CrossRef]
- Zhang, F.; Zhang, Z.; Li, X.; Li, J.; Lv, J.; Ma, Z.; Pan, L. Immune responses to orally administered recombinant Lactococcus lactis expressing multi-epitope proteins targeting M cells of foot-and-mouth disease virus. Viruses 2021, 13, 2036. [Google Scholar] [CrossRef] [PubMed]
- Fatehi, Z.; Doosti, A.; Jami, M.S. Oral vaccination with novel Lactococcus lactis mucosal live vector-secreting Brucella lumazine synthase (BLS) protein induces humoral and cellular immune protection against Brucella abortus. Arch. Microbiol. 2023, 205, 122. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Li, J.; Wang, Y.; Zhang, D.; Shi, C.; Li, Y.; Bergmann, S.M.; Mo, X.; Yin, J.; Wang, Q. Recombinant Lactococcus lactis expressing grass carp reovirus VP6 induces mucosal immunity against grass carp reovirus infection. Front. Immunol. 2022, 13, 914010. [Google Scholar] [CrossRef] [PubMed]
- Ma, C.; Li, G.; Chen, W.; Jia, Z.; Yang, X.; Pan, X.; Ma, D. Eimeria tenella: IMP1 protein delivered by Lactococcus lactis induces immune responses against homologous challenge in chickens. Vet. Parasitol. 2021, 289, 109320. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Feng, T.; Hou, T.; Zhu, W.G. Protocol to purify the histone deacetylase sirt6 and assess its activity in vitro. Star. Protoc. 2023, 4, 102206. [Google Scholar] [CrossRef]
- Liu, X.; Qi, L.; Lv, J.; Zhang, Z.; Zhou, P.; Ma, Z.; Wang, Y.; Zhang, Y.; Pan, L. The immune response to a recombinant Lactococcus lactis oral vaccine against foot-and-mouth disease virus in mice. Biotechnol. Lett. 2020, 42, 1907–1917. [Google Scholar] [CrossRef]
- Huang, J.; Wu, H.; Gao, T.; Zhai, H.; Moon, A.; Song, X.; Li, S.; Lu, Z.; Lan, J.; Zhong, D.; et al. A pool of bacterium-like particles displaying African swine fever virus antigens induces both humoral and cellular immune responses in pigs. Vaccines 2025, 13, 5. [Google Scholar] [CrossRef] [PubMed]
- Munoz-Perez, C.; Jurado, C.; Sanchez-Vizcaino, J.M. African swine fever vaccine: Turning a dream into reality. Transbound. Emerg. Dis. 2021, 68, 2657–2668. [Google Scholar] [CrossRef]
- Podgorski, T.; Pepin, K.M.; Radko, A.; Podbielska, A.; Lyjak, M.; Wozniakowski, G.; Borowik, T. How do genetic relatedness and spatial proximity shape African swine fever infections in wild boar? Transbound. Emerg. Dis. 2022, 69, 2656–2666. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Song, Y.; Liu, L.; Zhang, Y.; Wang, T.; Zhang, W.; Li, K.; Qi, X.; Gao, Y.; Gao, L.; et al. Neutralizing-antibody-mediated protection of chickens against infectious bursal disease via one-time vaccination with inactivated recombinant Lactococcus lactis expressing a fusion protein constructed from the RCK protein of Salmonella enterica and VP2 of infectious bursal disease virus. Microb. Cell Fact. 2019, 18, 21. [Google Scholar] [PubMed]
- Jiang, H.Q.; Bos, N.A.; Cebra, J.J. Timing, localization, and persistence of colonization by segmented filamentous bacteria in the neonatal mouse gut depend on immune status of mothers and pups. Infect. Immun. 2001, 69, 3611–3617. [Google Scholar] [CrossRef] [PubMed]
- Pietrzak, B.; Tomela, K.; Olejnik-Schmidt, A.; Mackiewicz, A.; Schmidt, M. Secretory IgA in intestinal mucosal secretions as an adaptive barrier against microbial cells. Int. J. Mol. Sci. 2020, 21, 9254. [Google Scholar] [CrossRef] [PubMed]
- Friedman, A.; Weiner, H.L. Induction of anergy or active suppression following oral tolerance is determined by antigen dosage. Proc. Natl. Acad. Sci. USA 1994, 91, 6688–6692. [Google Scholar] [CrossRef]
- Chen, Y.; Kuchroo, V.K.; Inobe, J.; Hafler, D.A.; Weiner, H.L. Regulatory T cell clones induced by oral tolerance: Suppression of autoimmune encephalomyelitis. Science 1994, 265, 1237–1240. [Google Scholar] [CrossRef]
- Nagler-Anderson, C.; Bhan, A.K.; Podolsky, D.K.; Terhorst, C. Control freaks: Immune regulatory cells. Nat. Immunol. 2004, 5, 119–122. [Google Scholar] [CrossRef] [PubMed]
- Churiso, G.; Husen, G.; Bulbula, D.; Abebe, L. Immunity cell responses to RSV and the role of antiviral inhibitors: A systematic review. Infect. Drug Resist. 2022, 15, 7413–7430. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.; Yi, S.; Guo, Y.; Zhang, S.; Niu, J.; Wang, K.; Hu, G. Construction of a recombinant Lactococcus lactis strain expressing a variant porcine epidemic diarrhea virus S1 gene and its immunogenicity analysis in mice. Viral. Immunol. 2019, 32, 144–150. [Google Scholar] [CrossRef] [PubMed]
- Qian, S.; Li, R.; He, Y.; Wang, H.; Zhang, D.; Sun, A.; Yu, L.; Song, X.; Zhao, T.; Chen, Z.; et al. Immunogenicity and protective efficacy of a recombinant Lactococcus lactis vaccine against HSV-1 infection. Microb. Cell Fact. 2024, 23, 244. [Google Scholar] [CrossRef]
Name | Sequences (5′-3′) |
---|---|
F317L-F | GCACTCACCATGGTTGAAACACAAATGGAT |
H171R-F | GCACTCACCATGGTTGTTTATGATCTTCTT |
D117L-F | GCACTCACCATGGATACAGAAACTTCACCT |
E120R-F | GCACTCACCATGGCTGATTTTAATTCACCA |
B602L-F | GCACTCACCATGGCTGAATTTAATATT |
CD2v-F | GCACTCACCATGATTATTCTTATTTTTCTT |
p54-F | GCACTCACCATGGATTCAGAATTT |
p72-F | GCACTCACCATGGCTTCAGGTGGA |
Common-R | AAGCTTGAGCTCTCACTTCTCGAACTGGGG |
pNZ8149-F | GGTACCACTAGTTCTAGAGAGCTC |
pNZ8149-R | GCATGCCTGCAGTACCCATGGTGA |
Group | Amount | Immunogens | Immunizing dose | Immunization route |
---|---|---|---|---|
A | 5 | rL. lactis-mix | 8 × 109 CFU | oral gavage |
B | 5 | L. lactis-pNZ8149 | 8 × 109 CFU | oral gavage |
C | 5 | PBS | 200 μL | oral gavage |
D | 5 | rL. lactis-mix | 8 × 109 CFU | intramuscular injection |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, J.; Gao, T.; Lu, Z.; Zhong, D.; Li, M.; Qiu, H.-J.; Li, Y.; Wu, H.; Sun, Y. Evaluation of the Immunogenicity of a Pool of Recombinant Lactococcus lactis Expressing Eight Antigens of African Swine Fever Virus in a Mouse Model. Vet. Sci. 2025, 12, 140. https://doi.org/10.3390/vetsci12020140
Huang J, Gao T, Lu Z, Zhong D, Li M, Qiu H-J, Li Y, Wu H, Sun Y. Evaluation of the Immunogenicity of a Pool of Recombinant Lactococcus lactis Expressing Eight Antigens of African Swine Fever Virus in a Mouse Model. Veterinary Sciences. 2025; 12(2):140. https://doi.org/10.3390/vetsci12020140
Chicago/Turabian StyleHuang, Jingshan, Tianqi Gao, Zhanhao Lu, Dailang Zhong, Mingzhi Li, Hua-Ji Qiu, Yongfeng Li, Hongxia Wu, and Yuan Sun. 2025. "Evaluation of the Immunogenicity of a Pool of Recombinant Lactococcus lactis Expressing Eight Antigens of African Swine Fever Virus in a Mouse Model" Veterinary Sciences 12, no. 2: 140. https://doi.org/10.3390/vetsci12020140
APA StyleHuang, J., Gao, T., Lu, Z., Zhong, D., Li, M., Qiu, H.-J., Li, Y., Wu, H., & Sun, Y. (2025). Evaluation of the Immunogenicity of a Pool of Recombinant Lactococcus lactis Expressing Eight Antigens of African Swine Fever Virus in a Mouse Model. Veterinary Sciences, 12(2), 140. https://doi.org/10.3390/vetsci12020140