Vitamin C Improves Oocyte In Vitro Maturation and Potentially Changes Embryo Quality in Cattle
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bovine Ovaries and Chemicals
2.2. IVM
2.3. Parthenogenetic Activation
2.4. IVF and Embryo Culture
2.5. Blastocyst Cell Count
2.6. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.7. Statistical Analysis
3. Results
3.1. Effects of VC on Oocyte IVM and Parthenogenetic Embryo Development
3.2. Effects of VC on IVF Embryo Development
3.3. Effects of VC Combination on IVF Embryo Development
3.4. Effect of VC Combination on mRNA Expressions of Apoptotic Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Luciano, A.M.; Franciosi, F.; Barros, R.G.; Dieci, C.; Lodde, V. The variable success of in vitro maturation: Can we do better? Anim. Reprod. 2018, 15, 727–736. [Google Scholar] [CrossRef] [PubMed]
 - Strączyńska, P.; Papis, K.; Morawiec, E.; Czerwiński, M.; Gajewski, Z.; Olejek, A.; Bednarska-Czerwińska, A. Signaling mechanisms and their regulation during in vivo or in vitro maturation of mammalian oocytes. Reprod. Biol. Endocrinol. 2022, 20, 37. [Google Scholar] [CrossRef] [PubMed]
 - Abdollahifar, M.A.; Azad, N.; Sajadi, E.; Mofarahe, Z.S.; Zare, F.; Moradi, A.; Rezaee, F.; Gholamin, M.; Abdi, S. Vitamin C restores ovarian follicular reservation in a mouse model of aging. Anat. Cell Biol. 2019, 52, 196–203. [Google Scholar] [CrossRef] [PubMed]
 - Lykkesfeldt, J.; Michels, A.J.; Frei, B. Vitamin C. Adv. Nutr. 2014, 5, 16–18. [Google Scholar] [CrossRef] [PubMed]
 - Travica, N.; Ried, K.; Sali, A.; Scholey, A.; Hudson, I.; Pipingas, A. Vitamin C status and cognitive function: A systematic review. Nutrients 2017, 9, 960. [Google Scholar] [CrossRef] [PubMed]
 - Navid, S.; Saadatian, Z.; Talebi, A. Assessment of developmental rate of mouse embryos yielded from in vitro fertilization of the oocyte with treatment of melatonin and vitamin C simultaneously. BMC Womens Health 2023, 23, 525. [Google Scholar] [CrossRef] [PubMed]
 - Sovernigo, T.C.; Adona, P.R.; Monzani, P.S.; Guemra, S.; Barros, F.; Lopes, F.G.; Leal, C. Effects of supplementation of medium with different antioxidants during in vitro maturation of bovine oocytes on subsequent embryo production. Reprod. Domest. Anim. 2017, 52, 561–569. [Google Scholar] [CrossRef]
 - Zhang, L.; Zhang, Y.; Han, Z.; Fang, J.; Chen, H.; Guo, Z. Transcriptome analyses reveal effects of Vitamin C-treated donor cells on cloned bovine embryo development. Int. J. Mol. Sci. 2019, 20, 2628. [Google Scholar] [CrossRef] [PubMed]
 - Kere, M.; Siriboon, C.; Lo, N.W.; Nguyen, N.T.; Ju, J.C. Ascorbic acid improves the developmental competence of porcine oocytes after parthenogenetic activation and somatic cell nuclear transplantation. J. Reprod. Dev. 2013, 59, 78–84. [Google Scholar] [CrossRef]
 - Tagler, D.; Makanji, Y.; Tu, T.; Bernabé, B.P.; Lee, R.; Zhu, J.; Kniazeva, E.; Hornick, J.E.; Woodruff, T.K.; Shea, L.D. Promoting extracellular matrix remodeling via ascorbic acid enhances the survival of primary ovarian follicles encapsulated in alginate hydrogels. Biotechnol. Bioeng. 2014, 111, 1417–1429. [Google Scholar] [CrossRef]
 - Wang, X.; Wu, Q. The divergent pluripotent states in mouse and human cells. Genes 2022, 13, 1459. [Google Scholar] [CrossRef] [PubMed]
 - Endoh, M.; Niwa, H. Stepwise pluripotency transitions in mouse stem cells. EMBO Rep. 2022, 23. [Google Scholar] [CrossRef] [PubMed]
 - Ramos-Ibeas, P.; Gimeno, I.; Cañón-Beltrán, K.; Gutiérrez-Adán, A.; Rizos, D.; Gómez, E. Senescence and apoptosis during in vitro embryo development in a bovine model. Front. Cell Dev. Biol. 2020, 8, 619902. [Google Scholar] [CrossRef] [PubMed]
 - Antunes, G.; Chaveiro, A.; Santos, P.; Marques, A.; Jin, H.S.; Moreira da Silva, F. Influence of apoptosis in bovine embryo’s development. Reprod. Domest. Anim. 2010, 45, 26–32. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, J.; Hao, L.; Wei, Q.; Zhang, S.; Cheng, H.; Zhai, Y.; Jiang, Y.; An, X.; Li, Z.; Zhang, X.; et al. TET3 overexpression facilitates DNA reprogramming and early development of bovine SCNT embryos. Reproduction 2020, 160, 379–391. [Google Scholar] [CrossRef] [PubMed]
 - Tatemoto, H.; Ootaki, K.; Shigeta, K.; Muto, N. Enhancement of developmental competence after in vitro fertilization of porcine oocytes by treatment with ascorbic acid 2-O-alpha-glucoside during in vitro maturation. Biol. Reprod. 2001, 65, 1800–1806. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Karimian, M.; Zandi, M.; Sanjabi, M.R.; Masoumian, M.; Ofoghi, H. Effects of grape seed extract, quercetin and vitamin C on ovine oocyte maturation and subsequent embryonic development. Cell Mol. Biol. 2018, 64, 98–102. [Google Scholar] [CrossRef] [PubMed]
 - Dalvit, G.; Llanes, S.P.; Descalzo, A.; Insani, M.; Beconi, M.; Cetica, P. Effect of alpha-tocopherol and ascorbic acid on bovine oocyte in vitro maturation. Reprod. Domest. Anim. 2005, 40, 93–97. [Google Scholar] [CrossRef]
 - Córdova, B.; Morató, R.; Izquierdo, D.; Paramio, T.; Mogas, T. Effect of the addition of insulin-transferrin-selenium and/or L-ascorbic acid to the in vitro maturation of prepubertal bovine oocytes on cytoplasmic maturation and embryo development. Theriogenology 2010, 74, 1341–1348. [Google Scholar] [CrossRef]
 - Li, Q.; Wang, Y.S.; Wang, L.J.; Zhang, H.; Li, R.Z.; Cui, C.C.; Li, W.Z.; Zhang, Y.; Jin, Y.P. Vitamin C supplementation enhances compact morulae formation but reduces the hatching blastocyst rate of bovine somatic cell nuclear transfer embryos. Cell Reprogram 2014, 16, 290–297. [Google Scholar] [CrossRef]
 - Li, Q.; Zhao, T.; He, H.; Robert, N.; Ding, T.; Hu, X.; Zhang, T.; Pan, Y.; Cui, Y.; Yu, S. Ascorbic acid protects the toxic effects of aflatoxin B1 on yak oocyte maturation. Anim. Sci. J. 2022, 93, e13702. [Google Scholar] [CrossRef] [PubMed]
 - Bogliotti, Y.S.; Wu, J.; Vilarino, M.; Okamura, D.; Soto, D.A.; Zhong, C.; Sakurai, M.; Sampaio, R.V.; Suzuki, K.; Izpisua Belmonte, J.C.; et al. Efficient derivation of stable primed pluripotent embryonic stem cells from bovine blastocysts. Proc. Natl. Acad. Sci. USA 2018, 115, 2090–2095. [Google Scholar] [CrossRef] [PubMed]
 - Jiang, Y.; An, X.L.; Yu, H.; Cai, N.N.; Zhai, Y.H.; Li, Q.; Cheng, H.; Zhang, S.; Tang, B.; Li, Z.Y.; et al. Transcriptome profile of bovine iPSCs derived from Sertoli cells. Theriogenology 2020, 146, 120–132. [Google Scholar] [CrossRef] [PubMed]
 - Jiang, Y.; Cai, N.N.; An, X.L.; Zhu, W.Q.; Yang, R.; Tang, B.; Li, Z.Y.; Zhang, X.M. Naïve-like conversion of bovine induced pluripotent stem cells from Sertoli cells. Theriogenology 2023, 196, 68–78. [Google Scholar] [CrossRef] [PubMed]
 - Zhao, L.; Gao, X.; Zheng, Y.; Wang, Z.; Zhao, G.; Ren, J.; Zhang, J.; Wu, J.; Wu, B.; Chen, Y.; et al. Establishment of bovine expanded potential stem cells. Proc. Natl. Acad. Sci. USA 2021, 118, e2018505118. [Google Scholar] [CrossRef]
 - Yenilmez, F. Effect of in ovo vitamin C injection against mobile phone radiation on post-hatch performance of broiler chicks. Vet. Sci. 2022, 9, 613. [Google Scholar] [CrossRef]
 




| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | 
|---|---|---|
| 18S rRNA | GACTCATTGGCCCTGTAATTGGAATGAGTC | GCTGCTGGCACCAGACTTG | 
| Oct4 | GATTTGGATGAGTTTTTAAGGGTT | ACTCCAACTTCTCCTTATCCAACTT | 
| Sox2 | CTATGACCAGCTCGCAGA | GGAAGAAGAGGTAACCACG | 
| Cdx2 | CTTTCCTCCGGATGGTGATA | AGCCAAGTGAAAACCAGGAC | 
| Nanog | AAACAACTGGCCGAAGGAATA | AGGAGTGGTTGVTCCAAGAC | 
| Bcl-2 | GAGTCGGATCGCAACTTGGA | CTCTCGGCTGCTGCATTGT | 
| Bax | GCGCATCGGAGATGAATTG | CCACAGCTGCGATCATCCT | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Wang, A.; Liu, H.; Yang, R.; Zhang, B.; Tang, B.; Li, Z.; Zhang, X. Vitamin C Improves Oocyte In Vitro Maturation and Potentially Changes Embryo Quality in Cattle. Vet. Sci. 2024, 11, 372. https://doi.org/10.3390/vetsci11080372
Wang Y, Wang A, Liu H, Yang R, Zhang B, Tang B, Li Z, Zhang X. Vitamin C Improves Oocyte In Vitro Maturation and Potentially Changes Embryo Quality in Cattle. Veterinary Sciences. 2024; 11(8):372. https://doi.org/10.3390/vetsci11080372
Chicago/Turabian StyleWang, Yueqi, Aibing Wang, Hongmei Liu, Rui Yang, Boyang Zhang, Bo Tang, Ziyi Li, and Xueming Zhang. 2024. "Vitamin C Improves Oocyte In Vitro Maturation and Potentially Changes Embryo Quality in Cattle" Veterinary Sciences 11, no. 8: 372. https://doi.org/10.3390/vetsci11080372
APA StyleWang, Y., Wang, A., Liu, H., Yang, R., Zhang, B., Tang, B., Li, Z., & Zhang, X. (2024). Vitamin C Improves Oocyte In Vitro Maturation and Potentially Changes Embryo Quality in Cattle. Veterinary Sciences, 11(8), 372. https://doi.org/10.3390/vetsci11080372
        
