Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. The Panel of Samples: Bacterial Isolates, Viruses, Hosts, and Clinical Samples
2.2. Design of Primers, Probes, and PCR Conditions
2.3. Nucleic Acids Extraction
2.4. Validation of PCR Assays
2.5. Analytical Specificity
2.6. Analytical Sensitivity (Limit of Detection), Efficiency, and Coefficient of Determination (R2)
(N × 660 g/mol × 1 × 109 ng/g),
2.7. Diagnostic Specificity and Diagnostic Sensitivity
3. Results
3.1. Design of Real-Time PCR Assays
3.2. Analytical Specificity
3.3. Analytical Sensitivity (Limit of Detection), Efficiency, and Coefficient of Determination (R2)
3.4. Repeatability
3.5. Reproducibility
3.6. Diagnostic Specificity and Sensitivity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blackall, P.J.; Eaves, L.E.; Rogers, D.G. Proposal of a new serovar and altered nomenclature for Haemophilus paragallinarum in the Kume hemagglutinin scheme. J. Clin. Microbiol. 1990, 28, 1185–1187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saif, Y.M. Diseases of Poultry, 12th ed.; Blackwell Publishing: Ames, IA, USA, 2008. [Google Scholar]
- Deshmukh, S.; Banga, H.S.; Sodhi, S.; Brar, R.S. An update on avian infectious coryza: It’s re-emerging trends on epidemiology, etiologic characterization, diagnostics, therapeutic and prophylactic advancements. J. Dairy Vet. Anim. Res. 2015, 2, 86–92. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.; Xie, S.; Li, X.; Xu, F.; Li, Y.; Boucher, C.E.; Chen, X. Selection of Avibacterium paragallinarum Page serovar B strains for an infectious coryza vaccine. Vet. Immunol. Immunopathol. 2018, 199, 77–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Conde, M.D.; Huberman, Y.D.; Espinoza, A.M.; Delgado, R.I.; Terzolo, H.R. Vaccination of one-day-old broiler chicks against infectious coryza. Avian Dis. 2011, 55, 119–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, A.; Rawat, M.; Verma, R. Studies on absolute requirement of NAD and reduced oxygen tension for growth of field isolates of Avibacterium paragallinarum of poultry origin. Indian J. Poult. Sci. 2012, 47, 90–92. [Google Scholar]
- Tu, T.Y.; Hsieh, M.K.; Tan, D.H.; Ou, S.C.; Shien, J.H.; Yen, T.Y.; Chang, P.C. Loss of the capsule increases the adherence activity but decreases the virulence of Avibacterium paragallinarum. Avian Dis. 2015, 59, 87–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Firsova, M.S.; Potekhin, A.V.; Evgrafova, V.; Pruntova, O.V.; Rusaleyev, V.S.; Yashin, R.V. Properties of experimental samples of vaccine against avian infectious coryza. Agric. Biol. 2021, 56, 315–325. [Google Scholar] [CrossRef] [Scilit]
- Numee, S.; Hauck, R.; Hafez, H.M. Detection and typing of Ornithobacterium rhinotracheale from German poultry flocks. Avian Dis. 2012, 56, 654–658. [Google Scholar] [CrossRef] [Scilit]
- De la Rosa-Ramos, M.A.; Muñoz-Solís, K.; Palma-Zepeda, M.; Gutierrez-Castillo, A.C.; López Villegas, E.O.; Guerra-Infante, F.M.; Castro-Escarpulli, G. Adherence of Ornithobacterium rhinotracheale to chicken embryo lung cells as a pathogenic mechanism. Avian Pathol. 2018, 47, 172–178. [Google Scholar] [CrossRef] [Scilit]
- Banani, M.; Pourbakhsh, S.A.; Khaki, P. Characterization of Ornithobacterium rhinotracheale isolates from commercial chickens. Arch. Razi Inst. 2001, 52, 27–36. [Google Scholar]
- Shurahova, Y.N.; Kononenko, A.B.; Vitkova, O.N. Ornithobacterium rhinotracheale: Distribution and diagnosis. In Proceedings of the International Veterinary Poultry Congress, Moscow, Russia, 10–13 April 2007; pp. 181–183. [Google Scholar]
- Chin, R.P.; van Empel, P.C.M.; Hafez, H.M. Ornithobacterium rhinotracheale infection. In Diseases of Poultry, 13th ed.; Swayne, D.E., Ed.; Wiley-Blackwell: Hoboken, NJ, USA, 2013; pp. 807–858. [Google Scholar]
- Barbosa, E.V.; Cardoso, C.V.; Silva, R.d.C.F.; Cerqueira, A.d.M.F.; Liberal, M.H.T.; Castro, H.C. Ornithobacterium rhinotracheale: An update review about an emerging poultry pathogen. Vet. Sci. 2019, 7, 3. [Google Scholar] [CrossRef] [Scilit]
- Sarika, N.; Devigasri, C.; Sankar, S.; Mini, M. A report of natural concurrent infection with Avibacterium paragallinarum and Mycoplasma gallisepticum in chicken. Pharma Innov. J. 2019, 8, 16–18. [Google Scholar]
- Silva, R.L.; Figueira, A.A.; Silva, M.M.; Dias, T.S.; Machado, L.S.; Soares, N.M.; Pereira, V.L.A. Detection of Mycoplasma Synoviae and other pathogens in laying hens with respiratory signs in the rearing and production phases. Braz. J. Poult. Sci. 2021, 23, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Eurofinsgenomics PCR Primer Design. Available online: https://eurofinsgenomics.eu/en/ecom/tools/qpcr-assay-design (accessed on 15 February 2023).
- IDT OligoAnalyzer. Available online: https://eu.idtdna.com/PrimerQuest/Home/Index (accessed on 15 February 2023).
- PCR Primer Stats. Available online: http://bioinformatics.org/sms2/pcr_primer_stats.html (accessed on 15 February 2023).
- Eurofinsgenomics Oligo Analysis Tool. Available online: https://eurofinsgenomics.eu/en/ecom/tools/oligo-analysis (accessed on 15 February 2023).
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Wittwer, C.T. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit]
- OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 1.1.6 Principles and Methods of Validation of Diagnostic Assays for Infectious Disease, 12th ed.; The World Organisation for Animal Health: Paris, France, 2023; Available online: https://www.woah.org/fileadmin/Home/eng/Health_standards/tahm/1.01.06_VALIDATION.pdf (accessed on 9 October 2023).
- OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.2.3 Development and Optimisation of Nucleic Acid Detection Assays, 12th ed.; The World Organisation for Animal Health: Paris, France, 2023; Available online: https://www.woah.org/fileadmin/Home/eng/Health_standards/aahm/current/GUIDELINE_3.6.3_NAD_ASSAYS.pdf (accessed on 9 October 2023).
- Mushegian, A.R.; Koonin, E.V. A minimal gene set for cellular life derived by comparison of complete bacterial genomes. Proc. Natl. Acad. Sci. USA 1996, 93, 10268–10273. [Google Scholar] [CrossRef] [Scilit]
- Pace, N.R.; Brown, J.W. Evolutionary perspective on the structure and function of ribonuclease P, a ribozyme. J. Bacteriol. 1995, 177, 1919–1928. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Miflin, J.K.; Zhang, P.; Blackall, P.J. Development and application of DNA probes and PCR tests for Haemophilus paragallinarum. Avian Dis. 1996, 40, 398–407. [Google Scholar] [CrossRef] [Scilit]
- Corney, B.G.; Diallo, I.S.; Wright, L.; Hewitson, G.; De Jong, A.; Tolosa, X.; Blackall, P.J. Rapid and sensitive detection of Avibacterium paragallinarum in the presence of other bacteria using a 5′ Taq nuclease assay: A new tool for diagnosing infectious coryza. Avian Pathol. 2008, 37, 599–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clothier, K.A.; Stoute, S.; Torain, A.; Crossley, B. Validation of a real-time PCR assay for high-throughput detection of Avibacterium paragallinarum in chicken respiratory sites. J. Vet. Diagn. Investig. 2019, 31, 714–718. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuchipudi, S.V.; Yon, M.; Surendran Nair, M.; Byukusenge, M.; Barry, R.M.; Nissly, R.H.; Jayarao, B.M. A highly sensitive and specific probe-based real-time PCR for the detection of Avibacterium paragallinarum in clinical samples from poultry. Front. Vet. Sci. 2021, 8, 609126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bogomazova, A.; Krylova, E.; Soltynskaya, I.; Prasolova, O.; Ivanova, O. In silico analysis to develop PCR assays for identification of bacterial pathogens in animals: What can we improve? Front. Vet. Sci. 2023, 10, 1235837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdelwhab, E.M.; Lüschow, D.; Hafez, H.M. Development of real-time polymerase chain reaction assay for detection of Ornithobacterium rhinotracheale in poultry. Avian Dis. 2013, 57, 663–666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hashish, A.; Sinha, A.; Sato, Y.; Macedo, N.R.; El-Gazzar, M. Development and validation of a new TaqMan real-time PCR for the detection of Ornithobacterium rhinotracheale. Microorganisms 2022, 10, 341. [Google Scholar] [CrossRef] [Scilit]
- Janda, J.M.; Abbott, S.L. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: Pluses, perils, and pitfalls. J. Clin. Microbiol. 2007, 45, 2761–2764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aguilar-Bultet, L.; Calderon-Copete, S.P.; Frey, J.; Falquet, L. Draft genome sequence of the virulent Avibacterium paragallinarum Serotype A strain JF4211 and identification of two toxins. Genome Announc. 2013, 1, 10–1128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- NCTC_3000. BioProject PRJEB6403. Available online: http://www.sanger.ac.uk/resources/downloads/bacteria/nctc/ (accessed on 9 October 2023).
- Xu, F.; Miao, D.; Du, Y.; Chen, X.; Zhang, P.; Sun, H. Draft genome sequence of Avibacterium paragallinarum strain 221. Genome Announc. 2013, 1, 10–1128. [Google Scholar] [CrossRef] [Scilit]
- Horta-Valerdi, G.; Sanchez-Alonso, M.P.; Perez-Marquez, V.M.; Negrete-Abascal, E.; Vaca-Pacheco, S.; Hernandez-Gonzalez, I.; Vázquez-Cruz, C. The genome sequence of Avibacterium paragallinarum strain CL has a large repertoire of insertion sequence elements. Genome Announc. 2017, 5, 10–1128. [Google Scholar] [CrossRef] [Scilit]
- Roodt, Y.; Bragg, R.R.; Albertyn, J. Identification of prophages and prophage remnants within the genome of Avibacterium paragallinarum bacterium. Sequencing 2012, 2012, 953609. [Google Scholar] [CrossRef] [Scilit]
- Christensen, H.; Bisgaard, M. Classification of genera of Pasteurellaceae using conserved predicted protein sequences. Int. J. Syst. Evol. Microbiol. 2018, 68, 2692–2696. [Google Scholar] [CrossRef] [Scilit]
- Tataje-Lavanda, L.; Montalván, Á.; Montesinos, R.; Morales-Erasto, V.; Zimic-Peralta, M.; Fernández-Sánchez, M.; Fernández-Díaz, M. Genomic islands in the full-genome sequence of an NAD-hemin-independent Avibacterium paragallinarum strain isolated from Peru. Microbiol. Resour. Announc. 2019, 8, 10–1128. [Google Scholar] [CrossRef] [Scilit]
- Mei, C.; Sun, A.H.; Blackall, P.J.; Xian, H.; Li, S.F.; Gong, Y.M.; Wang, H.J. Component identification and functional analysis of outer membrane vesicles released by Avibacterium paragallinarum. Front. Microbiol. 2020, 11, 518060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Byukusenge, M.; Nissly, R.H.; Li, L.; Pierre, T.; Mathews, T.; Wallner-Pendleton, E.; Kuchipudi, S.V. Complete genome sequences of seven Avibacterium paragallinarum isolates from poultry farms in Pennsylvania, USA. Microbiol. Resour. Announc. 2020, 9, 10–1128. [Google Scholar] [CrossRef] [Scilit]
- Requena, D.; Chumbe, A.; Torres, M.; Alzamora, O.; Ramirez, M.; Valdivia-Olarte, H.; Fernández-Díaz, M. Genome sequence and comparative analysis of Avibacterium paragallinarum. Bioinformation 2013, 9, 528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Wang, Y.; Yang, H.; Li, Q.; Gong, X.; Zhang, G.; Zhu, K. Resident bacteria contribute to opportunistic infections of the respiratory tract. PLoS Pathog. 2021, 17, e1009436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J.; Mei, C.; Zhi, Y.; Liang, Z.X.; Zhang, X.; Wang, H.J. Outer membrane vesicle mediated multidrug resistance gene transfer in Avibacterium paragallinarum. bioRxiv 2022. [Google Scholar] [CrossRef] [Scilit]
- Zehr, E.S.; Bayles, D.O.; Boatwright, W.D.; Tabatabai, L.B.; Register, K.B. Complete genome sequence of Ornithobacterium rhinotracheale strain ORT-UMN 88. Stand. Genom. Sci. 2014, 9, 16. [Google Scholar] [CrossRef] [Scilit]
- Alispahic, M.; Endler, L.; Hess, M.; Hess, C. Ornithobacterium rhinotracheale: MALDI-TOF MS and whole genome sequencing confirm that serotypes K, L and M deviate from well-known reference strains and numerous field isolates. Microorganisms 2021, 9, 1006. [Google Scholar] [CrossRef] [Scilit]
- Salter, S.J.; Scott, P.; Page, A.J.; Tracey, A.; de Goffau, M.C.; Cormie, C.; Parkhill, J. Candidatus Ornithobacterium hominis: Insights gained from draft genomes obtained from nasopharyngeal swabs. Microb. Genom. 2019, 5, e000247. [Google Scholar] [CrossRef] [Scilit]
| Pathogen | Clinical Sample Type | Number | |
|---|---|---|---|
| Known Positives | Known Negatives | ||
| A. paragallinarum | fragments of chicken beaks and sinuses | 30 | 30 |
| O. rhinotracheale | fragments of chicken trachea | 30 | 30 |
| Pathogen | Target Gene | Gene Description | Oligo | Sequence (5′–3′) | Length, bp | Amplicon Size, bp |
|---|---|---|---|---|---|---|
| Avibacterium paragallinarum | lysS | Lysine-tRNA ligase | LysS-F 1 | GTGAAAGAGGATCTGTACGAC | 21 | 139 |
| LysS-P 2 | ROX– TCGATCGTGCCAAAGCCTTGG–BHQ2 | 21 | ||||
| LysS-R 3 | GCTGAATTAAGTGATGTTCTGC | 22 | ||||
| Internal control | synthetic construct | IC-F | GTGCGATGGTCCGACTTAT | 19 | 90 | |
| IC-P | R6G–CTAGCTGGGCGTCAGGAATCC–BHQ1 | 21 | ||||
| IC-R | GGTCAGTTATTTACCTACGACAG | 23 | ||||
| Pathogen | Target Gene | Gene Description | Oligo | Sequence (5′–3′) | Length, bp | Amplicon Size, bp |
|---|---|---|---|---|---|---|
| Ornithobacterium rhinotracheale | rnaP | DNA- directed RNA polymerase | RnaP-F 1 | TAACACCCGCCACTTGTTT | 19 | 101 |
| RnaP-P 2 | ROX– TTCTGCTGCACTAGTCCTCCTT GC–BHQ2 | 24 | ||||
| RnaP-R 3 | CCACGCAGAGTTTACCTGATT | 21 | ||||
| Internal control | synthetic construct | IC-F | GTGCGATGGTCCGACTTAT | 19 | 90 | |
| IC-P | R6G–CTAGCTGGGCGTCAGGAATCC–BHQ1 | 21 | ||||
| IC-R | GGTCAGTTATTTACCTACGACAG | 23 | ||||
| Pathogen | Target Gene | F/R/P, nM | MgCl2, mM | PCR Program |
|---|---|---|---|---|
| Ornithobacterium rhinotracheale | rnaP | 240/240/120 | 2.5 | 95 °C for 15 min, 40 cycles of 95 °C for 15 s, and 62 °C for 45 s |
| Internal control | synthetic construct | 120/120/60 | ||
| Avibacterium paragallinarum | lysS | 240/240/120 | 2.5 | 95 °C for 15 min, 40 cycles of 95 °C for 15 s, and 62 °C for 45 s |
| Internal control | synthetic construct | 120/120/60 |
| No. | Organism | Sample Type | Description | Mean Ct | |
|---|---|---|---|---|---|
| rnaP | lysS | ||||
| 1 | A.paragallinarum ser. B | bacterial suspension | collection strain 1116 | - | 14.23 |
| 2 | A.paragallinarum ser. B | bacterial suspension | collection strain 1818 | - | 17.93 |
| 3 | A.paragallinarum ser. B | bacterial suspension | collection strain 5111 | - | 18.54 |
| 4 | A.paragallinarum ser. A | bacterial suspension | collection strain 6261 | - | 14.77 |
| 5 | A.paragallinarum ser. A | bacterial suspension | ATCC 29545 | - | 17.41 |
| 6 | A.paragallinarum ser. C | bacterial suspension | collection strain 1919 | - | 18.98 |
| 7 | A.paragallinarum | bacterial suspension | collection strain Kostroma | - | 30.12 |
| 8 | O.rhinotracheale | bacterial suspension | collection strain OR-21 | 22.36 | - |
| 9 | Avian encephalomyelitis | viral cDNA | vaccine strain Calnec 1143 M | - | - |
| 10 | Avian metapneumovirus | viral cDNA | vaccine strain TRT 11/94 ser. B; | - | - |
| 11 | Avian metapneumovirus | viral cDNA | vaccine strain Clone K ser. A | - | - |
| 12 | Avian metapneumovirus | viral cDNA | vaccine strain PV03-B | - | - |
| 13 | Infectious laryngotracheitis virus | viral gDNA | vaccine strain CHP 50 | - | - |
| 14 | Avian poxvirus | viral gDNA | vaccine strain KEM-7 | - | - |
| 15 | Chicken anemia virus | viral gDNA | vaccine strain Cux-1 | - | - |
| 16 | Infectious bronchitis virus | viral cDNA | vaccine strain H120 ser Massachusetts | - | - |
| 17 | Infectious bursal disease virus | viral cDNA | vaccine strain Winterfield 2512 | - | - |
| 18 | Newcastle virus | viral cDNA | vaccine strain La-Sota | - | - |
| 19 | Egg drop syndrome virus | viral gDNA | vaccine strain EDS-76 B-93 | - | - |
| 20 | Influenza virus type A | viral cDNA | vaccine strain Chicken/USSR/315/70 | - | - |
| 21 | Influenza virus type A H14N6 | viral cDNA | vaccine strain Mallard/Astrakhan 263/82 | - | - |
| 22 | Turkey herpes virus | viral gDNA | field isolate | - | - |
| 23 | Avian reovirus | viral cDNA | field isolate | - | - |
| 24 | Mycoplasma gallisepticum | bacterial gDNA | field isolate | - | - |
| 25 | Salmonella Typhimurium | bacterial gDNA | ATCC 14028 | - | - |
| 26 | Staphylococcus aureus | bacterial gDNA | ATCC 39591 | - | - |
| 27 | Streptococcus sp. | bacterial gDNA | field isolate | - | - |
| 28 | Mannhemia haemolytica | bacterial gDNA | field isolate | - | - |
| 29 | Arcanobacterium pyogenes | bacterial gDNA | ATCC 8164 | - | - |
| 30 | Pasterella multocida | bacterial gDNA | field isolate | - | - |
| 31 | Glaesserella parasuis | bacterial gDNA | ATCC 19417 | - | - |
| 32 | Mycobacterium avium | bacterial gDNA | field isolate | - | - |
| 33 | Enterococcus avium | bacterial gDNA | ATCC 14025 | - | - |
| 34 | Escherichia coli | bacterial gDNA | ATCC 25922 | - | - |
| 35 | Aspergillus brasiliensis | bacterial gDNA | ATCC 16404 | - | - |
| 36 | Bordetella bronchiseptica | bacterial gDNA | ATCC 10580 | - | - |
| 37 | Histophilus somni | bacterial gDNA | field isolate | - | - |
| 38 | Gallus gallus | gDNA | isolated from muscle tissue | - | - |
| 39 | Meleagris gallopavo | gDNA | isolated from muscle tissue | - | - |
| 40 | Anas platyrhynchos | gDNA | isolated from muscle tissue | - | - |
| 41 | Coturnix coturnix | gDNA | isolated from muscle tissue | - | - |
| 42 | Columba livia | gDNA | isolated from muscle tissue | - | - |
| 43 | Internal control | phage λ gDNA | recombinant phage λ | - | - |
| DNA Type | Target Gene | Serotype | LOD | Linear Equation | R2 | Efficiency |
|---|---|---|---|---|---|---|
| plasmid with A. paragallinarum lysS fragment | lysS | nd | 7000 copies/mL | y = −3.349x + 37.201 | 0.999 | 99% |
| A. paragallinarum genomic DNA | A | y = −3.336x + 38.510 | 0.996 | 99% | ||
| B | y = −3.464x + 38.615 | 0.999 | 94% | |||
| C | y = −3.413x + 37.668 | 0.999 | 96% |
| DNA Type | Target Gene | LOD | Linear Equation | R2 | Efficiency |
|---|---|---|---|---|---|
| plasmid with O. rhinotracheale rnaP fragment | rnaP | 4000 copies/mL | y = −3.362x + 38.448 | 0.999 | 98% |
| O. rhinotracheale OR21 genomic DNA | y = −3.308x + 37.729 | 0.999 | 101% |
| DNA Type | Copy Number/PCR | Replicates | Mean Ct | CV(Ct), % | Mean Copy Number/ PCR (N) | CV(N), % |
|---|---|---|---|---|---|---|
| plasmid with A. paragallinarum lysS fragment | 170 | 10 | 29.83 | 0.8 | 223.3 | 16.9 |
| 85 | 10 | 30.78 | 1.4 | 120.5 | 24.6 | |
| genomic DNA of A. paragallinarum, ser. B | 143 | 10 | 32.10 | 0.8 | 141.2 | 17.4 |
| 70 | 10 | 33.14 | 1.4 | 74.2 | 24.1 | |
| plasmid with O. rhinotracheale rnaP fragment | 105 | 10 | 31.52 | 0.7 | 93.2 | 14.6 |
| 42 | 10 | 32.16 | 0.5 | 60.3 | 11.1 | |
| genomic DNA of O. rhinotracheale OR21 | 92 | 10 | 31.79 | 0.5 | 107.9 | 10.0 |
| 46 | 10 | 32.78 | 1.0 | 58.1 | 20.7 |
| DNA Type | Copy Number /PCR | Mean Ct | CV(Ct), % | Mean Copy Number/PCR (N) | CV(N), % |
|---|---|---|---|---|---|
| plasmid with A. paragallinarum lysS fragment | 1.7 × 106 | 16.55 | 1.4 | 1,714,465 | 5.8 |
| 1.7 × 105 | 19.97 | 0.8 | 166,931 | 5.7 | |
| 1.7 × 104 | 23.30 | 0.9 | 17,067 | 1.9 | |
| 1.7 × 103 | 26.65 | 0.5 | 1731 | 7.6 | |
| 1.7 × 102 | 29.97 | 1.1 | 179 | 7.3 | |
| 85 | 31.02 | 1.2 | 102 | 20.7 | |
| genomic DNA of A. paragallinarum ser. B | 5.7 × 106 | 15.19 | 1.1 | 5,632,822 | 4.1 |
| 5.7 × 105 | 18.56 | 1.1 | 572,344 | 3.7 | |
| 5.7 × 104 | 21.96 | 0.7 | 56,599 | 3.6 | |
| 5.7 × 103 | 25.29 | 0.8 | 5915 | 5.0 | |
| 5.7 × 102 | 28.72 | 0.3 | 575 | 14.0 | |
| 70 | 32.97 | 0.7 | 72 | 15.3 |
| DNA Type | Copy Number/PCR | Mean Ct | CV(Ct), % | Mean Copy Number/PCR (N) | CV(N), % |
|---|---|---|---|---|---|
| plasmid with O. rhinotracheale rna P fragment | 4.2 × 106 | 15.97 | 1.1 | 4,839,048 | 10.6 |
| 4.2 × 105 | 19.41 | 0.8 | 431,128 | 6.9 | |
| 4.2 × 104 | 22.90 | 0.4 | 37,328 | 14.7 | |
| 4.2 × 103 | 26.10 | 0.4 | 3965 | 14.0 | |
| 4.2 × 102 | 29.48 | 1.0 | 369 | 9.0 | |
| 42 | 32.54 | 1.6 | 44 | 22.7 | |
| genomic DNA of O. rhinotracheale OR21 | 1.8 × 105 | 20.14 | 1.2 | 203,107 | 6.5 |
| 1.8 × 104 | 24.08 | 1.3 | 16,098 | 7.7 | |
| 1.8 × 103 | 27.51 | 1.5 | 1748 | 2.2 | |
| 1.8 × 102 | 30.89 | 1.9 | 199 | 13.2 | |
| 46 | 32.85 | 1.1 | 55 | 19.2 |
| Pathogen | Diagnostic Sensitivity (95% Confidence Level) | Diagnostic Specificity (95% Confidence Level) |
|---|---|---|
| O. rhinotracheale | 100% (88.4–100%) | 100% (88.4–100%) |
| A. paragallinarum | 100% (88.4–100%) | 100% (88.4–100%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Krylova, E.; Bogomazova, A.; Kirsanova, N.; Putintseva, A.; Gorbacheva, N.; Prasolova, O.; Soltynskaya, I.; Ivanova, O. Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale. Vet. Sci. 2024, 11, 7. https://doi.org/10.3390/vetsci11010007
Krylova E, Bogomazova A, Kirsanova N, Putintseva A, Gorbacheva N, Prasolova O, Soltynskaya I, Ivanova O. Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale. Veterinary Sciences. 2024; 11(1):7. https://doi.org/10.3390/vetsci11010007
Chicago/Turabian StyleKrylova, Ekaterina, Alexandra Bogomazova, Nataliya Kirsanova, Anastasiya Putintseva, Natalia Gorbacheva, Olga Prasolova, Irina Soltynskaya, and Olga Ivanova. 2024. "Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale" Veterinary Sciences 11, no. 1: 7. https://doi.org/10.3390/vetsci11010007
APA StyleKrylova, E., Bogomazova, A., Kirsanova, N., Putintseva, A., Gorbacheva, N., Prasolova, O., Soltynskaya, I., & Ivanova, O. (2024). Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale. Veterinary Sciences, 11(1), 7. https://doi.org/10.3390/vetsci11010007

