Next Article in Journal
Characterizing and Eliminating the Inbreeding Load
Next Article in Special Issue
The Microbiota Architecture of the Chinchilla Gastrointestinal Tract
Previous Article in Journal
Comparison of Two Surgical Techniques Based on the Semitendinosus Myocutaneous Flap in Cats
Previous Article in Special Issue
Microbiota Characterization of the Cow Mammary Gland Microenvironment and Its Association with Somatic Cell Count
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale

by
Ekaterina Krylova
1,*,
Alexandra Bogomazova
1,2,
Nataliya Kirsanova
1,
Anastasiya Putintseva
1,
Natalia Gorbacheva
1,
Olga Prasolova
1,
Irina Soltynskaya
1 and
Olga Ivanova
1
1
Department of Molecular Biology, Russian State Center for Quality and Standardization of Veterinary Drugs and Feed (VGNKI), 123022 Moscow, Russia
2
Laboratory of Cell Biology, Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine of FMBA of Russia (Lopukhin FRCC PCM), 119435 Moscow, Russia
*
Author to whom correspondence should be addressed.
Vet. Sci. 2024, 11(1), 7; https://doi.org/10.3390/vetsci11010007
Submission received: 18 October 2023 / Revised: 7 December 2023 / Accepted: 18 December 2023 / Published: 22 December 2023
(This article belongs to the Special Issue Advances in Veterinary Clinical Microbiology)

Simple Summary

Respiratory diseases cause severe economic damage to poultry farming. Common respiratory diseases in poultry include ornithobacteriosis and infectious coryza. The causative agents of these diseases, Ornithobacterium rhinotracheale and Avibacterium paragallinarum, are difficult-to-cultivate bacteria and are often found in mixed infections, which complicates the diagnosis of these diseases. PCR is a rapid, sensitive, and specific method that does not require special sample preparation; therefore, it is often used to detect infectious agents of animal diseases. We developed and validated two efficient and sensitive diagnostic assays for the rapid and accurate detection of A. paragallinarum and O. rhinotracheale DNA in bacterial isolates and clinical samples using real-time PCR. These diagnostic assays are expected to improve the differential diagnosis of respiratory diseases in poultry. PCR-based diagnostic assays can provide an alternative to microbiological cultivation and significantly reduce the time required to obtain results.

Abstract

PCR is the most effective method for detecting difficult-to-cultivate pathogens and pathogens that are part of mixed infections in animals, such as Ornithobacterium rhinotracheale, which causes bird ornithobacteriosis, or Avibacterium paragallinarum, which causes infectious coryza. In this work, we developed and validated two efficient and sensitive diagnostic assays for the rapid and accurate detection of A. paragallinarum and O. rhinotracheale DNA in bacterial isolates and clinical samples using real-time PCR with TaqMan-like probes. When designing the PCR assays, we performed in silico analysis, optimized DNA isolation methods and PCR conditions, and assessed the analytical and diagnostic performance of PCR. We designed primers and probes that have no mismatches with published whole-genome sequences of bacteria. The optimization of conditions showed that the PCR assays are sufficiently robust to changes in temperature and oligonucleotide concentration. The validation showed that the developed assays have high analytical and diagnostic sensitivity and specificity. These assays are expected to improve the differential diagnosis of respiratory diseases in chickens and turkeys.

1. Introduction

Respiratory diseases are among poultry’s most frequent infectious pathologies and cause serious economic damage to aviculture. They can be caused by various bacterial and viral pathogens, either independently or in association. Among the bacterial infections of the respiratory tract in poultry, infectious coryza and ornithobacteriosis occupy the leading places. The causative agent of infectious coryza in chickens, Avibacterium paragallinarum (formerly Haemophilus paragallinarum), is a Gram-negative bacterium of the Pasteurellaceae family; it is divided into three serogroups (A, B, and C) that comprise nine serotypes. In different countries, different serogroups and serotypes of the pathogen are predominant [1,2,3,4]. Infectious coryza of chickens is common in countries with developed aviculture, including Russia [5,6,7]; it leads to a slowdown in the growth rate of broilers and a decrease in the egg production of chickens [8]. Chickens and turkeys of all ages are susceptible to infectious coryza, especially chickens older than 4 weeks.
The causative agent of ornithobacteriosis, Ornithobacterium rhinotracheale (ORT), is a Gram-negative, sedentary, non-spore-forming bacterium of the Flavobacteriaceae family with 18 known serotypes (A–L) that are not directly associated with virulence [9,10]. Meat poultry, such as turkeys and broiler chickens, are most often affected [11,12]. Since non-specific and variable clinical manifestations characterize the disease, it is essential to have a specific and sensitive diagnostic test [13]. Phenotypic and immunological methods for the diagnosis of ornithobacteriosis still need to be developed or improved [14].
A. paragallinarum and O. rhinotracheale are difficult to cultivate in vitro, and their identification by classical microbiological methods is arduous. Moreover, isolates can be obtained from clinical material only during the acute period of the disease. These microorganisms are often accompanied by a co-infection with other pathogens such as E. coli, P. multocida, Bordetella avium, Mycoplasma gallisepticum, etc., which also complicates the isolation of pure cultures and diagnosis of the diseases [15,16]. An alternative approach to rapid diagnostics of infectious coryza and ornithobacteriosis is the use of PCR techniques. This approach does not require a large amount of material and does not require the isolation of a pure bacterial culture.
Currently, there are no validated and approved diagnostic PCR assays in the Russian Federation for detecting the DNA of A. paragallinarum and O. rhinotracheale in clinical material. Moreover, no guidelines for the PCR diagnostics of infectious coryza and ornithobacteriosis have yet been developed by the World Organization for Animal Health (WOAH, founded as OIE). Considering the growing size of the poultry industry and the economic losses from these diseases, the importance of developing PCR assays is undeniable. Thus, our work aimed to develop and validate PCR assays for the detection of pathogens in infectious coryza and ornithobacteriosis.

2. Materials and Methods

2.1. The Panel of Samples: Bacterial Isolates, Viruses, Hosts, and Clinical Samples

The panel of samples was formed, comprising isolates of O. rhinotracheale and A. paragallinarum (serogroups A, B, and C), strains of causative agents of bacterial diseases of animals and birds that are taxonomically close to the target ones, as well as causative agents of diseases with symptoms similar to infectious coryza and ornithobacteriosis, including viral ones. The strains of O. rhinotracheale and A. paragallinarum were obtained from the research collection of the Federal Center for Animal Health (ARRIAH). Table S1 presents more information about the strains. Samples of viral cDNA and genomic DNA from vaccine strains, field isolates, ATCC isolates, and animals were obtained from the research collection, which was formed in the Department of Biotechnology of the Russian State Center for Quality and Standardization of Veterinary Drugs and Feed (VGNKI). In addition, the panel included DNA samples from five avian species (Gallus gallus, Meleagris gallopavo, Anas platyrhynchos, Coturnix coturnix, and Columba livia), which are the primary hosts of the studied pathogens (Table S2).
Additionally, 120 clinical samples from chickens were obtained from ARRIAH. The type and number of samples are shown in Table 1. Sixty samples of pathological material were obtained from sick chickens. The diagnosis of ornithobacteriosis and infectious coryza was established based on clinical signs. Subsequent confirmation of these 60 positive clinical samples was performed through bacteriological isolation of O. rhinotracheale and A. paragallinarum, respectively. Sixty samples were also collected from healthy birds without clinical manifestations of any disease.

2.2. Design of Primers, Probes, and PCR Conditions

The selection of target genes was carried out using whole-genome sequences of A. paragallinarum and O. rhinotracheale deposited at NCBI (Tables S3 and S4). The selection and quality assessment of oligonucleotide primers and probes for targets was carried out using the online resources “Eurofinsgenomics PCR Primer Design” [17], “IDT OligoAnalyzer” [18], “PCR Primer Stats” [19], and “Eurofinsgenomics Oligo Analysis Tool” [20]. The optimal annealing temperature and the possibility of forming homo- and heterodimers and “hairpins” were assessed. The sequences and characteristics of the oligonucleotides are provided in Table 2 and Table 3.
An internal control (IC) whose nucleotide sequence was not homologous to any of the analyzed organisms was designed to provide confidence in successful DNA isolation and amplification. The IC sequence is presented in the Suppl. Materials. Recombinant phage λ with an inserted IC sequence was produced in GenTerra JSC (Russia).
PCR optimization was carried out on concentrations of oligonucleotides, concentration of magnesium chloride, and temperature parameters on a Rotor-Gene Q thermocycler (Qiagen, Hilden, Germany), with 10 μL of DNA per reaction volume of 25 μL (see Supplementary Materials). Optimized conditions for PCR assays for the detection of A. paragallinarum and O. rhinotracheale DNA are provided in Table 4.

2.3. Nucleic Acids Extraction

In this work, we tested two different methods for extracting DNA: precipitation and DNA sorption on silica gel (see Supplementary Materials).
DNA extraction was conducted from 100 μL of a bacterial suspension of pure cultures of isolates of O. rhinotracheale and A. paragallinarum (Section 2.1) using the AmpliSens® RIBO-prep kit according to the manufacturer’s instructions (CRIE, Moscow, Russia).
DNA was extracted directly from clinical specimens. Preliminarily, tissue fragments were minced using scissors, diluted 1:10 in sterile 0.9% NaCl solution, homogenized for 4 min using the automated homogenizer TissueLyser LT (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, and centrifuged at 1500× g for 2 min to obtain the supernatant. DNA was extracted from the supernatant using the AmpliSens® RIBO-prep kit.
Nucleic acids from vaccine strains, field isolates, and ATCC isolates (Section 2.1) were extracted previously and stored at −40 °C in the VGNKI research collection.
Host DNA extraction was conducted from bird muscle tissue fragments using the AmpliSens® DNA-sorb-C-M kit following the manufacturer’s instructions (CRIE, Moscow, Russia).
Before DNA extraction, 10 μL of IC containing 2 × 105 copies/mL recombinant phages λ was added to each test tube containing the tested samples.

2.4. Validation of PCR Assays

Validation of diagnostic assays was carried out for compliance with the decision-making criteria for PCR methods according to a standard scheme, assessing the analytical and diagnostic characteristics of PCR [21,22,23].

2.5. Analytical Specificity

To confirm the specificity of the PCR assays, we used the panel of samples of bacterial isolates, viruses, and hosts described in Section 2.1. The studies were carried out in three independent rounds of PCR, each of which contained two replicates of each sample.

2.6. Analytical Sensitivity (Limit of Detection), Efficiency, and Coefficient of Determination (R2)

To determine the PCR analytical characteristics, we used DNA of plasmids containing cloned PCR fragments of the O. rhinotracheale rnaP and A. paragallinarum lysS genes and genomic DNA of A. paragallinarum and O. rhinotracheale. The recombinant pAL2-TA plasmids were produced in Evrogen (Moscow, Russia). The plasmids were sequenced to confirm the presence of the intended insert. The concentration of plasmids and genomic DNA was measured on a Quantus fluorimeter (Promega, Madison, WI, USA) following the manufacturer’s instructions. The genomic and plasmid DNA copy numbers were calculated using the following equation:
Number of copies = (X ng/µL × 6.0221 × 1023 molecules/mol)/
(N × 660 g/mol × 1 × 109 ng/g),
where X = Quantus read (ng/µL); N = length of the plasmid or bacterial genome size in bp; and 660 g/mol = average mass of one bp dsDNA.
Tenfold serial dilutions of plasmid DNA in the concentration range of 108–102 copies/mL were prepared. Dilutions of genomic DNA from A. paragallinarum and O. rhinotracheale in the concentration range of 108 (107)–102 copies/mL, respectively, were prepared. To generate a standard dose-dependent curve, two replicates of each tenfold serial dilution of plasmid or genomic DNA were used, and the mean threshold cycle (Ct) value and standard deviation (SD) were calculated. The mean Ct values were plotted against log10 of DNA copy number per reaction, and linear curves were generated to estimate the curve slope, PCR efficiency, and coefficient of determination (R2).
PCR efficiency (E) was assessed using the standard curve slope, as shown in the following equation:
Efficiency = [10(−1/slope)] − 1] × 100,
Repeatability and reproducibility were assessed by the coefficient of variability of Ct values, CV(Ct), and the coefficient of variability of the number of genomic copies per reaction, CV(N).

2.7. Diagnostic Specificity and Diagnostic Sensitivity

The diagnostic characteristics of the PCR assays were determined based on the analysis of the pathological tissues of chickens, in which the presence or absence of pathogens of infectious coryza and ornithobacteriosis was clinically confirmed. The type and number of specimens are shown in Section 2.1 (Table 1). The studies were performed in three independent rounds of PCR, each containing two replicates of each sample. Indices were calculated according to Formulas (3) and (4).
Diagnostic specificity = True negatives/(true negatives + false positives) × 100
Diagnostic sensitivity = True positives/(true positives + false negatives) × 100

3. Results

3.1. Design of Real-Time PCR Assays

We chose housekeeping genes with conservative sequences within species to design the PCR assays. Specifically, we chose genes that participate in translation since translation is one of the most essential processes in the cell [24]. As of February 2023, the NCBI refseq database had whole-genome data for 45 isolates of A. paragallinarum (Table S3). Approximately one-third of the genomes were assembled completely; the rest were at the contig or scaffold level. Among the sequenced whole-genome isolates, there were representatives of A. paragallinarum from all three serogroups (A, B, and C). The primers and probe used for detecting A. paragallinarum DNA (Table 3) were matched to the housekeeping gene lysS, which encodes a lysine-tRNA ligase involved in the translation process. Forward and reverse primers were designed to amplify a 139 bp segment from nt number 699,152 to 699,290 (numbering according to accession number NZ_CP050316.1). The primers were selected based on the analysis of multiple sequence alignments of the lys gene of A. paragallinarum isolates and strains from the NCBI refseq database. Figure S1A presents the annealing regions of the primers and probe, showing 100% homology between the selected oligonucleotides and all A. paragallinarum sequences from the NCBI refseq database.
The specificity of the oligonucleotides was assessed by aligning the selected primers and probe to the lysS gene sequence of A. paragallinarum-related bacteria (Figure S1B). The oligonucleotides have from two to six mismatches with the sequence of the lysS gene of the closest relatives. Thus, PCR with the selected primers and probe should specifically detect the DNA of A. paragallinarum.
For the PCR detection of O. rhinotracheale, we selected primers and a probe (Table 3) for a region of the rnaP gene (ribozyme RNase P gene), which is highly conserved in this species. The target fragment is 101 bp long, from nt number 72,116 to 72,216 (numbering according to accession number NZ_CP006828.1). The rnaP gene is a housekeeping gene that belongs to the category of non-coding RNA genes. The sequence of this gene consists of sub-sequences that are highly conservative among bacteria and sub-sequences that are specific to more narrow taxonomic groups [25]. The primers were selected by analyzing multiple sequence alignments of the rnaP gene of all isolates and strains of O. rhinotracheale, whose whole-genome sequences were deposited in the NCBI refseq database. Figure S2A shows the annealing region of the selected primers and probe. The forward primer at positions 5 and 17 has mismatches in the sequence with the genome of the isolate FARPER-174b (NZ_CP CP035107.1). We decided to ignore this since this isolate was isolated from the discharge of the paranasal sinuses of laying hens in Peru, i.e., in an agrarian region remote from Russia.
In silico, the primer specificity was assessed using the Primer-BLAST online resource. Figure S2B shows multiple alignment in the region of primer and probe annealing in the rnaP gene sequence taken from the representative genome of O. rhinotracheale and representative genomes of some related species with a high similarity in the rnaP gene (Ornithobacterium hominis, Riemerella anatipestifer, Bergeyella cardium, and Capnocytophaga gingivalis). The primers and probe have many mismatches with the rnaP gene sequence of other bacterial species. Thus, PCR with the selected primers and probe should effectively detect the DNA of O. rhinotracheale.

3.2. Analytical Specificity

To confirm the specificity of the PCR assays, a panel of DNA samples was used. The PCR results are presented in Table 5.
In our sample panel, the PCR assays detected the pathogens of infectious coryza and ornithobacteriosis with 100% specificity. DNA amplification was observed only for the target microorganisms.

3.3. Analytical Sensitivity (Limit of Detection), Efficiency, and Coefficient of Determination (R2)

In the experiments to determine analytical characteristics, it became apparent that the LOD of detection for A. paragallinarum was 7 × 103 copies/mL, and for O. rhinotracheale it was 4 × 103 copies/mL. The efficiency, slope, and coefficient of determination for PCR detection of A. paragallinarum DNA and O. rhinotracheale DNA corresponded to the accepted criteria (efficiency > 90%, slope 3.3–3.6, R2 > 0.98) (Table 6 and Table 7).

3.4. Repeatability

We determined repeatability using PCR with plasmid and genomic DNA, whose copy numbers per reaction were close to the limit of PCR sensitivity. PCR with 70–170 copies of DNA from A. paragallinarum per reaction (N) was performed in 10 replicates along with PCR with calibration samples of plasmid or genomic DNA serially diluted from 108 to 104 copies/mL. PCR with 40–105 copies of DNA from O. rhinotracheale per reaction (N) was performed in 10 replicates along with PCR with calibration samples of plasmid DNA serially diluted from 108 to 104 copies/mL or genomic DNA serially diluted from 107 to 104 copies/mL. After that, CV(Ct) and CV(N) were calculated. The results are presented in Table 8.
For both PCR assays, good values of Ct repeatability were obtained; the coefficient of variability CV(Ct) ranged from 0.5% to 1.4%. The coefficient of variability for DNA copies per reaction CV(N) ranged from 10.7% to 25%, which corresponds to the accepted criteria.
Thus, ~70 copies of the A. paragallinarum lysS gene and ~40 copies of the O. rhinotracheale rnaP gene were reproducibly detected in the respective PCR assays. In other words, the LOD of the PCR assay for A. paragallinarum was 70 genomic copies per reaction (=7 × 103 copies/mL), and for O. rhinotracheale it was 42 genomic copies per reaction (=4.2 × 103 copies/mL) (Table 6 and Table 7).
To obtain reproducible results in laboratory practice, samples with target DNA content above the LOD should be considered “positive”. This requires setting the cutoff limit of the cycle. We considered the cutoff cycle limit at Ct ≤ 33 for the PCR assay for A. paragallinarum detection and at Ct ≤ 32 for the PCR assay for O. rhinotracheale detection.

3.5. Reproducibility

We assessed PCR reproducibility using three independent experiments performed on different days by different operators using different thermal cyclers. In each experiment, we used two replicates of each tenfold serial dilution of plasmid DNA and genomic DNA, as well as DNA samples diluted close to the PCR sensitivity limit. The results are presented in Table 9 and Table 10.
For the A. paragallinarum PCR assay, the coefficient of variability CV(Ct) ranged from 0.3 to 1.4% and the CV(N) from 1.9% to 20.7%. For the O. rhinotracheale PCR assay, the coefficient of variability CV(Ct) ranged from 0.4% to 1.9% and the CV(N) from 2.2% to 22.7%. These values indicate acceptable reproducibility for both PCR assays.

3.6. Diagnostic Specificity and Sensitivity

To assess the diagnostic characteristics of the PCR assays, 30 known positive and known negative clinical samples from chickens were analyzed for each pathogen separately. The results are presented in Tables S5 and S6. All known positive samples containing A. paragallinarum or O. rhinotracheale were found to contain DNA of A. paragallinarum or O. rhinotracheale. All known negative samples that did not contain A. paragallinarum or O. rhinotracheale tested negative. The indices of diagnostic sensitivity and specificity calculated from the obtained results with a 95% confidence level are presented in Table 11.

4. Discussion

The common avian bacterial pathogens, A. paragallinarum and O. rhinotracheale, are challenging to diagnose. Not surprisingly, the first PCR-based test for A. paragallinarum identification was developed in the 1990s. To identify A. paragallinarum DNA, Chen et al. developed a PCR-based assay with detection using gel electrophoresis in 1996. The primers were selected for the region of the pyrG gene that encodes a glutamine-hydrolyzing enzyme [26]. In 2008, Corney et al. developed another assay for the detection of A. paragallinarum DNA based on real-time PCR with primers for the pyrG gene [27]. Clothier et al. successfully validated this assay as a diagnostic one in 2019 [28]. In 2021, Kuchipudi et al. [29] developed an assay based on real-time PCR with primers for a region of the A. paragallinarum recN gene encoding a repair protein. During validation, the assay was more sensitive compared to the assay of Corney et al. [27]. Bogomazova et al. [30] found that the primers perfectly matched recN gene sequences from all 50 A. paragallinarum genomes deposited in the NCBI refseq database. However, the recN gene is not part of the minimal set of genes required for the bacterial cell [24], and its loss may be compatible with the preservation of viability.
To detect O. rhinotracheale DNA, a real-time PCR assay with primers for the 16S ribosomal RNA gene (16S rRNA) was developed in 2013 [31]. In 2022, Hashish et al. improved this technique by changing the probe position and proposing their own unique set of primers and probe for the same target [32]. It should be noted that the 16S rRNA gene is traditionally used for bacterial identification and phylogenic studies; it belongs to the category of non-coding RNA genes, is conservative, and has multiple copies [33]. The genome of O. rhinotracheale contains three copies of the 16S rRNA gene. We tested the design of Hashish et al. [32] on all 16 O. rhinotracheale whole genomes deposited in the NCBI database and found that in 14 out of 16 cases (88%), the primers and probe annealed perfectly to the 16S rRNA gene sequence. However, in 2 strains out of 16, we found 1–2 mismatches between the 16S rRNA gene sequence and the probe sequence, which can significantly reduce PCR efficiency.
Bogomazova A. et al. [30] described several principles for in silico analysis in the design of PCR assays for the diagnosis of infectious animal diseases. Namely, it is necessary to (1) take into account the intraspecies genetic polymorphism of the bacterial pathogen; (2) indicate the NCBI database (nt/nr or refseq genomes or wgs) for BLAST searches and the number of bacterial gene sequences available for analysis; and (3) indicate the presence or absence of polymorphism at the sites of primer and probe annealing. The design of the assays for identifying pathogens of infectious coryza and ornithobacteriosis in this work was carried out considering these principles. As target genes for PCR, we chose genes participating in translation since these genes are part of a minimal gene set essential for bacterial viability [24]. This approach should provide the necessary robustness to the PCR assays developed.

5. Conclusions

In this work, we developed and validated two efficient and sensitive diagnostic assays for the rapid and accurate detection of A. paragallinarum and O. rhinotracheale DNA, both in bacterial isolates and in clinical samples, using real-time PCR with TaqMan-like probes. The use of these diagnostic assays will improve the differential diagnosis of respiratory diseases in chickens and turkeys. PCR-based diagnostic assays can be considered an alternative to microbiological culturing and significantly reduce the time required to obtain results.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vetsci11010007/s1, Table S1: The sample panel of bacterial isolates from the research collection of ARRIAH; Figure S1: Multiple alignment of lysS gene sequences in the region of annealing of primers and probe; Table S2: The DNA sample panel from the research collection of the Department of Biotechnology at VGNKI; Figure S2: Multiple alignment of rnaP gene sequences in the region of annealing of primers and probe; Table S3: List of whole-genome sequences of A. paragallinarum isolates in the NCBI refseq database [34,35,36,37,38,39,40,41,42,43,44,45]; Table S4: List of whole-genome sequences of O. rhinotracheale isolates in the NCBI refseq database [46,47,48]; Table S5: Test results for clinical samples of A paragallinarum (A.pg) (fragments of chicken beaks and sinuses); Table S6: Test results for clinical samples of O. rhinotracheale (ORT) (chicken tracheal homogenate).

Author Contributions

Conceptualization, A.B. and I.S.; Data curation, E.K., N.K., A.P., O.P. and I.S.; Funding acquisition, O.I.; Methodology, I.S.; Project administration, O.I.; Validation, N.K., A.P. and N.G.; Writing—original draft, E.K.; Writing—review and editing, A.B. and I.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grant # 075-15-2021-1054 from the Ministry of Science and Higher Education of the Russian Federation.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Acknowledgments

The authors express their gratitude to V.A. Evgrafova from the Laboratory for the Prevention of Pig and Cattle Diseases of the Federal Center for Animal Health (ARRIAH) and S.P. Yatsentyuk from the Department of Gene Diagnostics of Infectious Animal Diseases (VGNKI) for providing material (bacterial isolates, tissue samples, etc.) for this study.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Blackall, P.J.; Eaves, L.E.; Rogers, D.G. Proposal of a new serovar and altered nomenclature for Haemophilus paragallinarum in the Kume hemagglutinin scheme. J. Clin. Microbiol. 1990, 28, 1185–1187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Saif, Y.M. Diseases of Poultry, 12th ed.; Blackwell Publishing: Ames, IA, USA, 2008. [Google Scholar]
  3. Deshmukh, S.; Banga, H.S.; Sodhi, S.; Brar, R.S. An update on avian infectious coryza: It’s re-emerging trends on epidemiology, etiologic characterization, diagnostics, therapeutic and prophylactic advancements. J. Dairy Vet. Anim. Res. 2015, 2, 86–92. [Google Scholar] [CrossRef] [Scilit]
  4. Sun, H.; Xie, S.; Li, X.; Xu, F.; Li, Y.; Boucher, C.E.; Chen, X. Selection of Avibacterium paragallinarum Page serovar B strains for an infectious coryza vaccine. Vet. Immunol. Immunopathol. 2018, 199, 77–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Conde, M.D.; Huberman, Y.D.; Espinoza, A.M.; Delgado, R.I.; Terzolo, H.R. Vaccination of one-day-old broiler chicks against infectious coryza. Avian Dis. 2011, 55, 119–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Kumar, A.; Rawat, M.; Verma, R. Studies on absolute requirement of NAD and reduced oxygen tension for growth of field isolates of Avibacterium paragallinarum of poultry origin. Indian J. Poult. Sci. 2012, 47, 90–92. [Google Scholar]
  7. Tu, T.Y.; Hsieh, M.K.; Tan, D.H.; Ou, S.C.; Shien, J.H.; Yen, T.Y.; Chang, P.C. Loss of the capsule increases the adherence activity but decreases the virulence of Avibacterium paragallinarum. Avian Dis. 2015, 59, 87–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Firsova, M.S.; Potekhin, A.V.; Evgrafova, V.; Pruntova, O.V.; Rusaleyev, V.S.; Yashin, R.V. Properties of experimental samples of vaccine against avian infectious coryza. Agric. Biol. 2021, 56, 315–325. [Google Scholar] [CrossRef] [Scilit]
  9. Numee, S.; Hauck, R.; Hafez, H.M. Detection and typing of Ornithobacterium rhinotracheale from German poultry flocks. Avian Dis. 2012, 56, 654–658. [Google Scholar] [CrossRef] [Scilit]
  10. De la Rosa-Ramos, M.A.; Muñoz-Solís, K.; Palma-Zepeda, M.; Gutierrez-Castillo, A.C.; López Villegas, E.O.; Guerra-Infante, F.M.; Castro-Escarpulli, G. Adherence of Ornithobacterium rhinotracheale to chicken embryo lung cells as a pathogenic mechanism. Avian Pathol. 2018, 47, 172–178. [Google Scholar] [CrossRef] [Scilit]
  11. Banani, M.; Pourbakhsh, S.A.; Khaki, P. Characterization of Ornithobacterium rhinotracheale isolates from commercial chickens. Arch. Razi Inst. 2001, 52, 27–36. [Google Scholar]
  12. Shurahova, Y.N.; Kononenko, A.B.; Vitkova, O.N. Ornithobacterium rhinotracheale: Distribution and diagnosis. In Proceedings of the International Veterinary Poultry Congress, Moscow, Russia, 10–13 April 2007; pp. 181–183. [Google Scholar]
  13. Chin, R.P.; van Empel, P.C.M.; Hafez, H.M. Ornithobacterium rhinotracheale infection. In Diseases of Poultry, 13th ed.; Swayne, D.E., Ed.; Wiley-Blackwell: Hoboken, NJ, USA, 2013; pp. 807–858. [Google Scholar]
  14. Barbosa, E.V.; Cardoso, C.V.; Silva, R.d.C.F.; Cerqueira, A.d.M.F.; Liberal, M.H.T.; Castro, H.C. Ornithobacterium rhinotracheale: An update review about an emerging poultry pathogen. Vet. Sci. 2019, 7, 3. [Google Scholar] [CrossRef] [Scilit]
  15. Sarika, N.; Devigasri, C.; Sankar, S.; Mini, M. A report of natural concurrent infection with Avibacterium paragallinarum and Mycoplasma gallisepticum in chicken. Pharma Innov. J. 2019, 8, 16–18. [Google Scholar]
  16. Silva, R.L.; Figueira, A.A.; Silva, M.M.; Dias, T.S.; Machado, L.S.; Soares, N.M.; Pereira, V.L.A. Detection of Mycoplasma Synoviae and other pathogens in laying hens with respiratory signs in the rearing and production phases. Braz. J. Poult. Sci. 2021, 23, 1–6. [Google Scholar] [CrossRef] [Scilit]
  17. Eurofinsgenomics PCR Primer Design. Available online: https://eurofinsgenomics.eu/en/ecom/tools/qpcr-assay-design (accessed on 15 February 2023).
  18. IDT OligoAnalyzer. Available online: https://eu.idtdna.com/PrimerQuest/Home/Index (accessed on 15 February 2023).
  19. PCR Primer Stats. Available online: http://bioinformatics.org/sms2/pcr_primer_stats.html (accessed on 15 February 2023).
  20. Eurofinsgenomics Oligo Analysis Tool. Available online: https://eurofinsgenomics.eu/en/ecom/tools/oligo-analysis (accessed on 15 February 2023).
  21. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Wittwer, C.T. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit]
  22. OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 1.1.6 Principles and Methods of Validation of Diagnostic Assays for Infectious Disease, 12th ed.; The World Organisation for Animal Health: Paris, France, 2023; Available online: https://www.woah.org/fileadmin/Home/eng/Health_standards/tahm/1.01.06_VALIDATION.pdf (accessed on 9 October 2023).
  23. OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.2.3 Development and Optimisation of Nucleic Acid Detection Assays, 12th ed.; The World Organisation for Animal Health: Paris, France, 2023; Available online: https://www.woah.org/fileadmin/Home/eng/Health_standards/aahm/current/GUIDELINE_3.6.3_NAD_ASSAYS.pdf (accessed on 9 October 2023).
  24. Mushegian, A.R.; Koonin, E.V. A minimal gene set for cellular life derived by comparison of complete bacterial genomes. Proc. Natl. Acad. Sci. USA 1996, 93, 10268–10273. [Google Scholar] [CrossRef] [Scilit]
  25. Pace, N.R.; Brown, J.W. Evolutionary perspective on the structure and function of ribonuclease P, a ribozyme. J. Bacteriol. 1995, 177, 1919–1928. [Google Scholar] [CrossRef] [Scilit]
  26. Chen, X.; Miflin, J.K.; Zhang, P.; Blackall, P.J. Development and application of DNA probes and PCR tests for Haemophilus paragallinarum. Avian Dis. 1996, 40, 398–407. [Google Scholar] [CrossRef] [Scilit]
  27. Corney, B.G.; Diallo, I.S.; Wright, L.; Hewitson, G.; De Jong, A.; Tolosa, X.; Blackall, P.J. Rapid and sensitive detection of Avibacterium paragallinarum in the presence of other bacteria using a 5′ Taq nuclease assay: A new tool for diagnosing infectious coryza. Avian Pathol. 2008, 37, 599–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Clothier, K.A.; Stoute, S.; Torain, A.; Crossley, B. Validation of a real-time PCR assay for high-throughput detection of Avibacterium paragallinarum in chicken respiratory sites. J. Vet. Diagn. Investig. 2019, 31, 714–718. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Kuchipudi, S.V.; Yon, M.; Surendran Nair, M.; Byukusenge, M.; Barry, R.M.; Nissly, R.H.; Jayarao, B.M. A highly sensitive and specific probe-based real-time PCR for the detection of Avibacterium paragallinarum in clinical samples from poultry. Front. Vet. Sci. 2021, 8, 609126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Bogomazova, A.; Krylova, E.; Soltynskaya, I.; Prasolova, O.; Ivanova, O. In silico analysis to develop PCR assays for identification of bacterial pathogens in animals: What can we improve? Front. Vet. Sci. 2023, 10, 1235837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Abdelwhab, E.M.; Lüschow, D.; Hafez, H.M. Development of real-time polymerase chain reaction assay for detection of Ornithobacterium rhinotracheale in poultry. Avian Dis. 2013, 57, 663–666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Hashish, A.; Sinha, A.; Sato, Y.; Macedo, N.R.; El-Gazzar, M. Development and validation of a new TaqMan real-time PCR for the detection of Ornithobacterium rhinotracheale. Microorganisms 2022, 10, 341. [Google Scholar] [CrossRef] [Scilit]
  33. Janda, J.M.; Abbott, S.L. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: Pluses, perils, and pitfalls. J. Clin. Microbiol. 2007, 45, 2761–2764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Aguilar-Bultet, L.; Calderon-Copete, S.P.; Frey, J.; Falquet, L. Draft genome sequence of the virulent Avibacterium paragallinarum Serotype A strain JF4211 and identification of two toxins. Genome Announc. 2013, 1, 10–1128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. NCTC_3000. BioProject PRJEB6403. Available online: http://www.sanger.ac.uk/resources/downloads/bacteria/nctc/ (accessed on 9 October 2023).
  36. Xu, F.; Miao, D.; Du, Y.; Chen, X.; Zhang, P.; Sun, H. Draft genome sequence of Avibacterium paragallinarum strain 221. Genome Announc. 2013, 1, 10–1128. [Google Scholar] [CrossRef] [Scilit]
  37. Horta-Valerdi, G.; Sanchez-Alonso, M.P.; Perez-Marquez, V.M.; Negrete-Abascal, E.; Vaca-Pacheco, S.; Hernandez-Gonzalez, I.; Vázquez-Cruz, C. The genome sequence of Avibacterium paragallinarum strain CL has a large repertoire of insertion sequence elements. Genome Announc. 2017, 5, 10–1128. [Google Scholar] [CrossRef] [Scilit]
  38. Roodt, Y.; Bragg, R.R.; Albertyn, J. Identification of prophages and prophage remnants within the genome of Avibacterium paragallinarum bacterium. Sequencing 2012, 2012, 953609. [Google Scholar] [CrossRef] [Scilit]
  39. Christensen, H.; Bisgaard, M. Classification of genera of Pasteurellaceae using conserved predicted protein sequences. Int. J. Syst. Evol. Microbiol. 2018, 68, 2692–2696. [Google Scholar] [CrossRef] [Scilit]
  40. Tataje-Lavanda, L.; Montalván, Á.; Montesinos, R.; Morales-Erasto, V.; Zimic-Peralta, M.; Fernández-Sánchez, M.; Fernández-Díaz, M. Genomic islands in the full-genome sequence of an NAD-hemin-independent Avibacterium paragallinarum strain isolated from Peru. Microbiol. Resour. Announc. 2019, 8, 10–1128. [Google Scholar] [CrossRef] [Scilit]
  41. Mei, C.; Sun, A.H.; Blackall, P.J.; Xian, H.; Li, S.F.; Gong, Y.M.; Wang, H.J. Component identification and functional analysis of outer membrane vesicles released by Avibacterium paragallinarum. Front. Microbiol. 2020, 11, 518060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Byukusenge, M.; Nissly, R.H.; Li, L.; Pierre, T.; Mathews, T.; Wallner-Pendleton, E.; Kuchipudi, S.V. Complete genome sequences of seven Avibacterium paragallinarum isolates from poultry farms in Pennsylvania, USA. Microbiol. Resour. Announc. 2020, 9, 10–1128. [Google Scholar] [CrossRef] [Scilit]
  43. Requena, D.; Chumbe, A.; Torres, M.; Alzamora, O.; Ramirez, M.; Valdivia-Olarte, H.; Fernández-Díaz, M. Genome sequence and comparative analysis of Avibacterium paragallinarum. Bioinformation 2013, 9, 528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Wu, Y.; Wang, Y.; Yang, H.; Li, Q.; Gong, X.; Zhang, G.; Zhu, K. Resident bacteria contribute to opportunistic infections of the respiratory tract. PLoS Pathog. 2021, 17, e1009436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Xu, J.; Mei, C.; Zhi, Y.; Liang, Z.X.; Zhang, X.; Wang, H.J. Outer membrane vesicle mediated multidrug resistance gene transfer in Avibacterium paragallinarum. bioRxiv 2022. [Google Scholar] [CrossRef] [Scilit]
  46. Zehr, E.S.; Bayles, D.O.; Boatwright, W.D.; Tabatabai, L.B.; Register, K.B. Complete genome sequence of Ornithobacterium rhinotracheale strain ORT-UMN 88. Stand. Genom. Sci. 2014, 9, 16. [Google Scholar] [CrossRef] [Scilit]
  47. Alispahic, M.; Endler, L.; Hess, M.; Hess, C. Ornithobacterium rhinotracheale: MALDI-TOF MS and whole genome sequencing confirm that serotypes K, L and M deviate from well-known reference strains and numerous field isolates. Microorganisms 2021, 9, 1006. [Google Scholar] [CrossRef] [Scilit]
  48. Salter, S.J.; Scott, P.; Page, A.J.; Tracey, A.; de Goffau, M.C.; Cormie, C.; Parkhill, J. Candidatus Ornithobacterium hominis: Insights gained from draft genomes obtained from nasopharyngeal swabs. Microb. Genom. 2019, 5, e000247. [Google Scholar] [CrossRef] [Scilit]
Table 1. Clinical samples of A. paragallinarum and O. rhinotracheale.
Table 1. Clinical samples of A. paragallinarum and O. rhinotracheale.
PathogenClinical Sample TypeNumber
Known PositivesKnown Negatives
A. paragallinarumfragments of chicken beaks and sinuses3030
O. rhinotrachealefragments of chicken trachea3030
Table 2. Characteristics of targets and oligonucleotides for the PCR assays for detecting A. paragallinarum DNA.
Table 2. Characteristics of targets and oligonucleotides for the PCR assays for detecting A. paragallinarum DNA.
PathogenTarget GeneGene DescriptionOligoSequence (5′–3′)Length, bpAmplicon Size, bp
Avibacterium paragallinarumlysSLysine-tRNA ligaseLysS-F 1GTGAAAGAGGATCTGTACGAC21139
LysS-P 2ROX–
TCGATCGTGCCAAAGCCTTGG–BHQ2
21
LysS-R 3GCTGAATTAAGTGATGTTCTGC22
Internal
control
synthetic
construct
IC-FGTGCGATGGTCCGACTTAT1990
IC-PR6G–CTAGCTGGGCGTCAGGAATCC–BHQ121
IC-RGGTCAGTTATTTACCTACGACAG23
1 F—forward primer; 2 P—probe; 3 R—reverse primer.
Table 3. Characteristics of targets and oligonucleotides for the PCR assays for detecting O. rhinotracheale DNA.
Table 3. Characteristics of targets and oligonucleotides for the PCR assays for detecting O. rhinotracheale DNA.
PathogenTarget GeneGene DescriptionOligoSequence (5′–3′)Length, bpAmplicon Size, bp
Ornithobacterium rhinotrachealernaPDNA-
directed RNA
polymerase
RnaP-F 1TAACACCCGCCACTTGTTT19101
RnaP-P 2ROX–
TTCTGCTGCACTAGTCCTCCTT
GC–BHQ2
24
RnaP-R 3CCACGCAGAGTTTACCTGATT21
Internal
control
synthetic
construct
IC-FGTGCGATGGTCCGACTTAT1990
IC-PR6G–CTAGCTGGGCGTCAGGAATCC–BHQ121
IC-RGGTCAGTTATTTACCTACGACAG23
1 F—forward primer; 2 P—probe; 3 R—reverse primer.
Table 4. PCR conditions.
Table 4. PCR conditions.
PathogenTarget GeneF/R/P, nMMgCl2, mMPCR Program
Ornithobacterium rhinotrachealernaP240/240/1202.595 °C for 15 min, 40 cycles of 95 °C for 15 s, and 62 °C for 45 s
Internal controlsynthetic
construct
120/120/60
Avibacterium paragallinarumlysS240/240/1202.595 °C for 15 min, 40 cycles of 95 °C for 15 s, and 62 °C for 45 s
Internal controlsynthetic
construct
120/120/60
Table 5. Results of PCR for detection of A. paragallinarum lysS and O. rhinotracheale rnaP gene fragments.
Table 5. Results of PCR for detection of A. paragallinarum lysS and O. rhinotracheale rnaP gene fragments.
No.OrganismSample TypeDescriptionMean Ct
rnaPlysS
1A.paragallinarum ser. Bbacterial
suspension
collection strain 1116-14.23
2A.paragallinarum ser. Bbacterial
suspension
collection strain 1818-17.93
3A.paragallinarum ser. Bbacterial
suspension
collection strain 5111-18.54
4A.paragallinarum ser. Abacterial
suspension
collection strain 6261-14.77
5A.paragallinarum ser. Abacterial
suspension
ATCC 29545-17.41
6A.paragallinarum ser. Cbacterial
suspension
collection strain 1919-18.98
7A.paragallinarumbacterial
suspension
collection strain Kostroma-30.12
8O.rhinotrachealebacterial
suspension
collection strain OR-2122.36-
9Avian encephalomyelitisviral cDNAvaccine strain
Calnec 1143 M
--
10Avian metapneumovirusviral cDNAvaccine strain
TRT 11/94 ser. B;
--
11Avian metapneumovirusviral cDNAvaccine strain
Clone K ser. A
--
12Avian metapneumovirusviral cDNAvaccine strain PV03-B--
13Infectious laryngotracheitis virusviral gDNAvaccine strain CHP 50--
14Avian poxvirusviral gDNAvaccine strain KEM-7--
15Chicken anemia virusviral gDNAvaccine strain Cux-1--
16Infectious bronchitis virusviral cDNAvaccine strain H120
ser Massachusetts
--
17Infectious bursal
disease virus
viral cDNAvaccine strain
Winterfield 2512
--
18Newcastle virusviral cDNAvaccine strain La-Sota--
19Egg drop syndrome virusviral gDNAvaccine strain
EDS-76 B-93
--
20Influenza virus
type A
viral cDNAvaccine strain
Chicken/USSR/315/70
--
21Influenza virus
type A H14N6
viral cDNAvaccine strain
Mallard/Astrakhan 263/82
--
22Turkey herpes virusviral gDNAfield isolate--
23Avian reovirusviral cDNAfield isolate--
24Mycoplasma gallisepticumbacterial gDNAfield isolate--
25Salmonella Typhimuriumbacterial gDNAATCC 14028--
26Staphylococcus aureusbacterial gDNAATCC 39591--
27Streptococcus sp.bacterial gDNAfield isolate--
28Mannhemia haemolyticabacterial gDNAfield isolate--
29Arcanobacterium pyogenesbacterial gDNAATCC 8164--
30Pasterella multocidabacterial gDNAfield isolate--
31Glaesserella parasuisbacterial gDNAATCC 19417--
32Mycobacterium aviumbacterial gDNAfield isolate--
33Enterococcus aviumbacterial gDNAATCC 14025--
34Escherichia colibacterial gDNAATCC 25922--
35Aspergillus brasiliensisbacterial gDNAATCC 16404--
36Bordetella bronchisepticabacterial gDNAATCC 10580--
37Histophilus somnibacterial gDNAfield isolate--
38Gallus gallusgDNAisolated from
muscle tissue
--
39Meleagris gallopavogDNAisolated from
muscle tissue
--
40Anas platyrhynchosgDNAisolated from
muscle tissue
--
41Coturnix coturnixgDNAisolated from
muscle tissue
--
42Columba liviagDNAisolated from
muscle tissue
--
43Internal controlphage λ gDNArecombinant phage λ--
Table 6. Limit of detection and standard curve parameters of PCR assay for A. paragallinarum.
Table 6. Limit of detection and standard curve parameters of PCR assay for A. paragallinarum.
DNA TypeTarget GeneSerotypeLODLinear EquationR2Efficiency
plasmid with A. paragallinarum lysS fragmentlysSnd7000 copies/mLy = −3.349x + 37.2010.99999%
A. paragallinarum genomic DNAAy = −3.336x + 38.5100.99699%
By = −3.464x + 38.6150.99994%
Cy = −3.413x + 37.6680.99996%
Table 7. Limit of detection and standard curve parameters of PCR assay for O. rhinotracheale.
Table 7. Limit of detection and standard curve parameters of PCR assay for O. rhinotracheale.
DNA TypeTarget GeneLODLinear EquationR2Efficiency
plasmid with O. rhinotracheale rnaP fragmentrnaP4000 copies/mLy = −3.362x + 38.4480.99998%
O. rhinotracheale OR21 genomic DNAy = −3.308x + 37.7290.999101%
Table 8. Assessment of repeatability of PCR assays.
Table 8. Assessment of repeatability of PCR assays.
DNA TypeCopy Number/PCRReplicatesMean CtCV(Ct),
%
Mean Copy Number/
PCR (N)
CV(N), %
plasmid with A. paragallinarum lysS fragment1701029.830.8223.316.9
851030.781.4120.524.6
genomic DNA of A. paragallinarum, ser. B 1431032.100.8141.217.4
701033.141.474.224.1
plasmid with O. rhinotracheale rnaP fragment1051031.520.793.214.6
421032.160.560.311.1
genomic DNA of O. rhinotracheale OR21921031.790.5107.910.0
461032.781.058.120.7
Table 9. Assessment of reproducibility of the PCR assay for A. paragallinarum detection.
Table 9. Assessment of reproducibility of the PCR assay for A. paragallinarum detection.
DNA TypeCopy Number /PCRMean CtCV(Ct), %Mean Copy Number/PCR (N)CV(N), %
plasmid with A. paragallinarum lysS fragment1.7 × 10616.551.41,714,4655.8
1.7 × 10519.970.8166,9315.7
1.7 × 10423.300.917,0671.9
1.7 × 10326.650.517317.6
1.7 × 10229.971.11797.3
8531.021.210220.7
genomic DNA of
A. paragallinarum ser. B
5.7 × 10615.191.15,632,8224.1
5.7 × 10518.561.1572,3443.7
5.7 × 10421.960.756,5993.6
5.7 × 10325.290.859155.0
5.7 × 10228.720.357514.0
7032.970.77215.3
Table 10. Assessment of reproducibility of the PCR assay for O. rhinotracheale detection.
Table 10. Assessment of reproducibility of the PCR assay for O. rhinotracheale detection.
DNA TypeCopy Number/PCRMean CtCV(Ct), %Mean Copy Number/PCR (N)CV(N), %
plasmid with O. rhinotracheale rna P fragment4.2 × 10615.971.14,839,04810.6
4.2 × 10519.410.8431,1286.9
4.2 × 10422.900.437,32814.7
4.2 × 10326.100.4396514.0
4.2 × 10229.481.03699.0
4232.541.64422.7
genomic DNA of
O. rhinotracheale OR21
1.8 × 10520.141.2203,1076.5
1.8 × 10424.081.316,0987.7
1.8 × 10327.511.517482.2
1.8 × 10230.891.919913.2
4632.851.15519.2
Table 11. Diagnostic specificity and diagnostic sensitivity of the PCR assays for A. paragallinarum and O. rhinotracheale DNA detection.
Table 11. Diagnostic specificity and diagnostic sensitivity of the PCR assays for A. paragallinarum and O. rhinotracheale DNA detection.
PathogenDiagnostic Sensitivity
(95% Confidence Level)
Diagnostic Specificity
(95% Confidence Level)
O. rhinotracheale100% (88.4–100%)100% (88.4–100%)
A. paragallinarum100% (88.4–100%)100% (88.4–100%)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Krylova, E.; Bogomazova, A.; Kirsanova, N.; Putintseva, A.; Gorbacheva, N.; Prasolova, O.; Soltynskaya, I.; Ivanova, O. Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale. Vet. Sci. 2024, 11, 7. https://doi.org/10.3390/vetsci11010007

AMA Style

Krylova E, Bogomazova A, Kirsanova N, Putintseva A, Gorbacheva N, Prasolova O, Soltynskaya I, Ivanova O. Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale. Veterinary Sciences. 2024; 11(1):7. https://doi.org/10.3390/vetsci11010007

Chicago/Turabian Style

Krylova, Ekaterina, Alexandra Bogomazova, Nataliya Kirsanova, Anastasiya Putintseva, Natalia Gorbacheva, Olga Prasolova, Irina Soltynskaya, and Olga Ivanova. 2024. "Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale" Veterinary Sciences 11, no. 1: 7. https://doi.org/10.3390/vetsci11010007

APA Style

Krylova, E., Bogomazova, A., Kirsanova, N., Putintseva, A., Gorbacheva, N., Prasolova, O., Soltynskaya, I., & Ivanova, O. (2024). Development and Validation of PCR Diagnostic Assays for Detection of Avibacterium paragallinarum and Ornithobacterium rhinotracheale. Veterinary Sciences, 11(1), 7. https://doi.org/10.3390/vetsci11010007

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop