Bisphenol S Impairs Oestradiol Secretion during In Vitro Basal Folliculogenesis in a Mono-Ovulatory Species Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Ovaries and Isolation and In Vitro Culture of Preantral Follicles
2.2. Morphological Evaluation of Follicles
2.3. In Vitro Follicular Hormonal Secretion Assays
2.3.1. Anti-Müllerian Hormone
2.3.2. Oestradiol
2.3.3. Progesterone
2.4. Gene Expression Analysis
2.4.1. RNA Extraction and Reverse Transcription
2.4.2. Quantitative PCR Amplification
2.5. Statistical Analysis
3. Results
3.1. BPS Effects on Ovine Follicular Survival, Follicular Growth and Antrum Appearance
3.2. BPS Effects on Ovine Follicular Hormonal Secretions: Oestradiol, Progesterone and AMH
3.3. BPS Effects on Ovine Basal Stage Gene Expressions after 15 Days Treatment
4. Discussion
4.1. BPS Disrupted Oestradiol Secretion without Impairing Progesterone Secretion
4.2. BPS Did Not Impair Anti-Müllerian Hormone (AMH) Secretion
4.3. BPS Did Not Impair Follicular Survival, Follicular Growth and Antral Formation
4.4. BPS Did Not Impair mRNA Expression of Key Markers of Follicular Development
4.5. BPS Did Not Impair mRNA Expression of Key Players of Redox Status
4.6. Limitations and Strengths of the Study
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Monniaux, D.; Cadoret, V.; Clément, F.; Dalbies-Tran, R.; Elis, S.; Fabre, S.; Maillard, V.; Monget, P.; Uzbekova, S. Folliculogenesis. In Ilpo Huhtaniemi and Luciano Martini, Encyclopedia of Endocrine Diseases, 2nd ed.; Academic Press (Elsevier): Oxford, UK, 2019; Volume 2, pp. 377–398. ISBN 978-0-12-812200-6. [Google Scholar]
- Dalbies-Tran, R.; Cadoret, V.; Desmarchais, A.; Elis, S.; Maillard, V.; Monget, P.; Monniaux, D.; Reynaud, K.; Saint-Dizier, M.; Uzbekova, S. A Comparative Analysis of Oocyte Development in Mammals. Cells 2020, 9, E1002. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McGee, E.A.; Hsueh, A.J. Initial and Cyclic Recruitment of Ovarian Follicles. Endocr. Rev. 2000, 21, 200–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uzumcu, M.; Zachow, R. Developmental Exposure to Environmental Endocrine Disruptors: Consequences within the Ovary and on Female Reproductive Function. Reprod. Toxicol. 2007, 23, 337–352. [Google Scholar] [CrossRef] [Scilit]
- Hahladakis, J.N.; Iacovidou, E.; Gerassimidou, S. An Overview of the Occurrence, Fate, and Human Risks of the Bisphenol-A Present in Plastic Materials, Components, and Products. Integr. Environ. Assess. Manag. 2022, 1–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geens, T.; Goeyens, L.; Covaci, A. Are Potential Sources for Human Exposure to Bisphenol-A Overlooked? Int. J. Hyg. Environ. Health 2011, 214, 339–347. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.; Park, M.; Nam, D.J.; Yang, E.H.; Ryoo, J.-H. Relationship between Seafood Consumption and Bisphenol A Exposure: The Second Korean National Environmental Health Survey (KoNEHS 2012–2014). Ann. Occup. Environ. Med. 2020, 32, e10. [Google Scholar] [CrossRef] [Scilit]
- Velázquez-Gómez, M.; Lacorte, S. Nasal Lavages as a Tool for Monitoring Exposure to Organic Pollutants. Environ. Res. 2019, 178, 108726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vasiljevic, T.; Harner, T. Bisphenol A and Its Analogues in Outdoor and Indoor Air: Properties, Sources and Global Levels. Sci. Total Environ. 2021, 789, 148013. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Martin, J.W. Prolonged Exposure to Bisphenol A from Single Dermal Contact Events. Environ. Sci. Technol. 2017, 51, 9940–9949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Champmartin, C.; Marquet, F.; Chedik, L.; Décret, M.-J.; Aubertin, M.; Ferrari, E.; Grandclaude, M.-C.; Cosnier, F. Human in Vitro Percutaneous Absorption of Bisphenol S and Bisphenol A: A Comparative Study. Chemosphere 2020, 252, 126525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hwang, S.; Lim, J.-E.; Choi, Y.; Jee, S.H. Bisphenol A Exposure and Type 2 Diabetes Mellitus Risk: A Meta-Analysis. BMC Endocr. Disord. 2018, 18, 81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abraham, A.; Chakraborty, P. A Review on Sources and Health Impacts of Bisphenol A. Rev. Environ. Health 2020, 35, 201–210. [Google Scholar] [CrossRef] [Scilit]
- Meli, R.; Monnolo, A.; Annunziata, C.; Pirozzi, C.; Ferrante, M.C. Oxidative Stress and BPA Toxicity: An Antioxidant Approach for Male and Female Reproductive Dysfunction. Antioxidants 2020, 9, E405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.-F.; Shan, C.; Wang, Y.; Qian, L.-L.; Jia, D.-D.; Zhang, Y.-F.; Hao, X.-D.; Xu, H.-M. Cardiovascular Toxicity and Mechanism of Bisphenol A and Emerging Risk of Bisphenol S. Sci. Total Environ. 2020, 723, 137952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliviero, F.; Marmugi, A.; Viguié, C.; Gayrard, V.; Picard-Hagen, N.; Mselli-Lakhal, L. Are BPA Substitutes as Obesogenic as BPA? Int. J. Mol. Sci. 2022, 23, 4238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flint, S.; Markle, T.; Thompson, S.; Wallace, E. Bisphenol A Exposure, Effects, and Policy: A Wildlife Perspective. J. Environ. Manag. 2012, 104, 19–34. [Google Scholar] [CrossRef] [Scilit]
- European Chemicals Agency. General Report 2017; European Chemicals Agency: Helsinki, Finland, 2018; ECHA-18-R-08-EN; ISBN 978-92-9020-506-7. [Google Scholar] [CrossRef]
- Wu, L.-H.; Zhang, X.-M.; Wang, F.; Gao, C.-J.; Chen, D.; Palumbo, J.R.; Guo, Y.; Zeng, E.Y. Occurrence of Bisphenol S in the Environment and Implications for Human Exposure: A Short Review. Sci. Total Environ. 2018, 615, 87–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, C.; Liu, F.; Guo, Y.; Moon, H.-B.; Nakata, H.; Wu, Q.; Kannan, K. Occurrence of Eight Bisphenol Analogues in Indoor Dust from the United States and Several Asian Countries: Implications for Human Exposure. Environ. Sci. Technol. 2012, 46, 9138–9145. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Yan, Z.; Zhang, Q.; Song, N.; Cheng, J.; Torres, O.L.; Chen, J.; Zhang, S.; Guo, R. Urinary Levels, Composition Profile and Cumulative Risk of Bisphenols in Preschool-Aged Children from Nanjing Suburb, China. Ecotoxicol. Environ. Saf. 2019, 172, 444–450. [Google Scholar] [CrossRef] [Scilit]
- Mendy, A.; Salo, P.M.; Wilkerson, J.; Feinstein, L.; Ferguson, K.K.; Fessler, M.B.; Thorne, P.S.; Zeldin, D.C. Association of Urinary Levels of Bisphenols F and S Used as Bisphenol A Substitutes with Asthma and Hay Fever Outcomes. Environ. Res. 2020, 183, 108944. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sol, C.M.; van Zwol-Janssens, C.; Philips, E.M.; Asimakopoulos, A.G.; Martinez-Moral, M.-P.; Kannan, K.; Jaddoe, V.W.V.; Trasande, L.; Santos, S. Maternal Bisphenol Urine Concentrations, Fetal Growth and Adverse Birth Outcomes: A Population-Based Prospective Cohort. Environ. Health Glob. Access Sci. Source 2021, 20, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khmiri, I.; Côté, J.; Mantha, M.; Khemiri, R.; Lacroix, M.; Gely, C.; Toutain, P.-L.; Picard-Hagen, N.; Gayrard, V.; Bouchard, M. Toxicokinetics of Bisphenol-S and Its Glucuronide in Plasma and Urine Following Oral and Dermal Exposure in Volunteers for the Interpretation of Biomonitoring Data. Environ. Int. 2020, 138, 105644. [Google Scholar] [CrossRef] [Scilit]
- Li, A.; Zhuang, T.; Shi, W.; Liang, Y.; Liao, C.; Song, M.; Jiang, G. Serum Concentration of Bisphenol Analogues in Pregnant Women in China. Sci. Total Environ. 2020, 707, 136100. [Google Scholar] [CrossRef] [Scilit]
- Claessens, J.; Pirard, C.; Charlier, C. Determination of Contamination Levels for Multiple Endocrine Disruptors in Hair from a Non-Occupationally Exposed Population Living in Liege (Belgium). Sci. Total Environ. 2022, 815, 152734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amar, S.; Binet, A.; Téteau, O.; Desmarchais, A.; Papillier, P.; Lacroix, M.Z.; Maillard, V.; Guérif, F.; Elis, S. Bisphenol S Impaired Human Granulosa Cell Steroidogenesis in Vitro. Int. J. Mol. Sci. 2020, 21, 1821. [Google Scholar] [CrossRef] [Scilit]
- Rochester, J.R.; Bolden, A.L. Bisphenol S and F: A Systematic Review and Comparison of the Hormonal Activity of Bisphenol A Substitutes. Environ. Health Perspect. 2015, 123, 643–650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thoene, M.; Dzika, E.; Gonkowski, S.; Wojtkiewicz, J. Bisphenol S in Food Causes Hormonal and Obesogenic Effects Comparable to or Worse than Bisphenol A: A Literature Review. Nutrients 2020, 12, E532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Žalmanová, T.; Hošková, K.; Nevoral, J.; Adámková, K.; Kott, T.; Šulc, M.; Kotíková, Z.; Prokešová, Š.; Jílek, F.; Králíčková, M.; et al. Bisphenol S Negatively Affects the Meotic Maturation of Pig Oocytes. Sci. Rep. 2017, 7, 485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campen, K.A.; Lavallee, M.; Combelles, C. The Impact of Bisphenol S on Bovine Granulosa and Theca Cells. Reprod. Domest. Anim. Zuchthyg. 2018, 53, 450–457. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sabry, R.; Saleh, A.C.; Stalker, L.; LaMarre, J.; Favetta, L.A. Effects of Bisphenol A and Bisphenol S on MicroRNA Expression during Bovine (Bos Taurus) Oocyte Maturation and Early Embryo Development. Reprod. Toxicol. 2021, 99, 96–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nevoral, J.; Kolinko, Y.; Moravec, J.; Žalmanová, T.; Hošková, K.; Prokešová, Š.; Klein, P.; Ghaibour, K.; Hošek, P.; Štiavnická, M.; et al. Long-Term Exposure to Very Low Doses of Bisphenol S Affects Female Reproduction. Reprod. Camb. Engl. 2018, 156, 47–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prokešová, Š.; Ghaibour, K.; Liška, F.; Klein, P.; Fenclová, T.; Štiavnická, M.; Hošek, P.; Žalmanová, T.; Hošková, K.; Řimnáčová, H.; et al. Acute Low-Dose Bisphenol S Exposure Affects Mouse Oocyte Quality. Reprod. Toxicol. 2020, 93, 19–27. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.-Y.; Tian, Y.; Yan, Z.-H.; Li, W.-D.; Zang, C.-J.; Li, L.; Sun, X.-F.; Shen, W.; Cheng, S.-F. Maternal Bisphenol S Exposure Affects the Reproductive Capacity of F1 and F2 Offspring in Mice. Environ. Pollut. 2020, 267, 115382. [Google Scholar] [CrossRef] [Scilit]
- Desmarchais, A.; Téteau, O.; Kasal-Hoc, N.; Cognié, J.; Lasserre, O.; Papillier, P.; Lacroix, M.; Vignault, C.; Jarrier-Gaillard, P.; Maillard, V.; et al. Chronic Low BPS Exposure through Diet Impairs in Vitro Embryo Production Parameters According to Metabolic Status in the Ewe. Ecotoxicol. Environ. Saf. 2022, 229, 113096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Téteau, O.; Jaubert, M.; Desmarchais, A.; Papillier, P.; Binet, A.; Maillard, V.; Elis, S. Bisphenol A and S Impaired Ovine Granulosa Cell Steroidogenesis. Reprod. Camb. Engl. 2020, 159, 571–583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berni, M.; Gigante, P.; Bussolati, S.; Grasselli, F.; Grolli, S.; Ramoni, R.; Basini, G. Bisphenol S, a Bisphenol A Alternative, Impairs Swine Ovarian and Adipose Cell Functions. Domest. Anim. Endocrinol. 2019, 66, 48–56. [Google Scholar] [CrossRef] [Scilit]
- Bujnakova Mlynarcikova, A.; Scsukova, S. Bisphenol Analogs AF, S and F: Effects on Functional Characteristics of Porcine Granulosa Cells. Reprod. Toxicol. 2021, 103, 18–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, M.; Sekulovski, N.; MacLean, J.A.; Hayashi, K. Effects of Bisphenol A Analogues on Reproductive Functions in Mice. Reprod. Toxicol. 2017, 73, 280–291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, M.; Sekulovski, N.; MacLean, J.A.; Whorton, A.; Hayashi, K. Prenatal Exposure to Bisphenol A Analogues on Female Reproductive Functions in Mice. Toxicol. Sci. Off. J. Soc. Toxicol. 2019, 168, 561–571. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahsan, N.; Ullah, H.; Ullah, W.; Jahan, S. Comparative Effects of Bisphenol S and Bisphenol A on the Development of Female Reproductive System in Rats; a Neonatal Exposure Study. Chemosphere 2018, 197, 336–343. [Google Scholar] [CrossRef] [Scilit]
- Ijaz, S.; Ullah, A.; Shaheen, G.; Jahan, S. Exposure of BPA and Its Alternatives like BPB, BPF, and BPS Impair Subsequent Reproductive Potentials in Adult Female Sprague Dawley Rats. Toxicol. Mech. Methods 2020, 30, 60–72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cimmino, I.; Fiory, F.; Perruolo, G.; Miele, C.; Beguinot, F.; Formisano, P.; Oriente, F. Potential Mechanisms of Bisphenol A (BPA) Contributing to Human Disease. Int. J. Mol. Sci. 2020, 21, 5761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Donini, C.F.; El Helou, M.; Wierinckx, A.; Győrffy, B.; Aires, S.; Escande, A.; Croze, S.; Clezardin, P.; Lachuer, J.; Diab-Assaf, M.; et al. Long-Term Exposure of Early-Transformed Human Mammary Cells to Low Doses of Benzo[a]Pyrene and/or Bisphenol A Enhances Their Cancerous Phenotype via an AhR/GPR30 Interplay. Front. Oncol. 2020, 10, 712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naderi, M.; Kwong, R. A Comprehensive Review of the Neurobehavioral Effects of Bisphenol S and the Mechanisms of Action: New Insights from in Vitro and in Vivo Models. Environ. Int. 2020, 145, 106078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amir, S.; Shah, S.T.A.; Mamoulakis, C.; Docea, A.O.; Kalantzi, O.-I.; Zachariou, A.; Calina, D.; Carvalho, F.; Sofikitis, N.; Makrigiannakis, A.; et al. Endocrine Disruptors Acting on Estrogen and Androgen Pathways Cause Reproductive Disorders through Multiple Mechanisms: A Review. Int. J. Environ. Res. Public Health 2021, 18, 1464. [Google Scholar] [CrossRef] [Scilit]
- Cooney, C.A. Epigenetics—DNA-Based Mirror of Our Environment? Dis. Markers 2007, 23, 121–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manikkam, M.; Tracey, R.; Guerrero-Bosagna, C.; Skinner, M.K. Plastics Derived Endocrine Disruptors (BPA, DEHP and DBP) Induce Epigenetic Transgenerational Inheritance of Obesity, Reproductive Disease and Sperm Epimutations. PLoS ONE 2013, 8, e55387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faulk, C.; Kim, J.H.; Anderson, O.S.; Nahar, M.S.; Jones, T.R.; Sartor, M.A.; Dolinoy, D.C. Detection of Differential DNA Methylation in Repetitive DNA of Mice and Humans Perinatally Exposed to Bisphenol A. Epigenetics 2016, 11, 489–500. [Google Scholar] [CrossRef] [Scilit]
- Beck, D.; Nilsson, E.E.; Ben Maamar, M.; Skinner, M.K. Environmental Induced Transgenerational Inheritance Impacts Systems Epigenetics in Disease Etiology. Sci. Rep. 2022, 12, 5452. [Google Scholar] [CrossRef] [Scilit]
- Maćczak, A.; Cyrkler, M.; Bukowska, B.; Michałowicz, J.; Bisphenol, A.; Bisphenol, S.; Bisphenol, F.; Bisphenol, A.F. Induce Different Oxidative Stress and Damage in Human Red Blood Cells (in Vitro Study). Toxicol. Vitr. 2017, 41, 143–149. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; He, J.; Xu, T.; Han, H.; Zhu, Z.; Meng, L.; Pang, Q.; Fan, R. Bisphenol A(BPA), BPS and BPB-Induced Oxidative Stress and Apoptosis Mediated by Mitochondria in Human Neuroblastoma Cell Lines. Ecotoxicol. Environ. Saf. 2021, 207, 111299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mączka, W.; Grabarczyk, M.; Wińska, K. Can Antioxidants Reduce the Toxicity of Bisphenol? Antioxidants 2022, 11, 413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, M.; Liu, S.; Fu, L.; Jiang, X.; Yang, M. Bisphenol A and Its Analogues Bisphenol S, Bisphenol F and Bisphenol AF Induce Oxidative Stress and Biomacromolecular Damage in Human Granulosa KGN Cells. Chemosphere 2020, 253, 126707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Padmanabhan, V.; Veiga-Lopez, A. Sheep Models of Polycystic Ovary Syndrome Phenotype. Mol. Cell. Endocrinol. 2013, 373, 8–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lunardi, F.O.; Bass, C.S.; Bernuci, M.P.; Chaves, R.N.; Lima, L.F.; da Silva, R.F.; de Figueiredo, J.R.; Rodrigues, A.P.R. Ewe Ovarian Tissue Vitrification: A Model for the Study of Fertility Preservation in Women. JBRA Assist. Reprod. 2015, 19, 241–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cadoret, V.; Frapsauce, C.; Jarrier, P.; Maillard, V.; Bonnet, A.; Locatelli, Y.; Royère, D.; Monniaux, D.; Guérif, F.; Monget, P. Molecular Evidence That Follicle Development Is Accelerated in Vitro Compared to in Vivo. Reprod. Camb. Engl. 2017, 153, 493–508. [Google Scholar] [CrossRef] [Scilit]
- Thayer, K.A.; Taylor, K.W.; Garantziotis, S.; Schurman, S.H.; Kissling, G.E.; Hunt, D.; Herbert, B.; Church, R.; Jankowich, R.; Churchwell, M.I.; et al. Bisphenol A, Bisphenol S, and 4-Hydro Xyphenyl 4-Isopro Oxyphenyl Sulfone (BPSIP) in Urine and Blood of Cashiers. Environ. Health Perspect. 2016, 124, 437–444. [Google Scholar] [CrossRef] [Scilit]
- Estienne, A.; Pierre, A.; di Clemente, N.; Picard, J.-Y.; Jarrier, P.; Mansanet, C.; Monniaux, D.; Fabre, S. Anti-Müllerian Hormone Regulation by the Bone Morphogenetic Proteins in the Sheep Ovary: Deciphering a Direct Regulatory Pathway. Endocrinology 2015, 156, 301–313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Canepa, S.; Laine, A.-L.; Bluteau, A.; Fagu, C.; Flon, C.; Monniaux, D. Validation d’une méthode immunoenzymatique pour le dosage de la progestérone dans le plasma des ovins et des bovins. Cah. Tech. INRA 2008, 64, 19–30. [Google Scholar]
- Elis, S.; Oseikria, M.; Vitorino Carvalho, A.; Bertevello, P.S.; Corbin, E.; Teixeira-Gomes, A.-P.; Lecardonnel, J.; Archilla, C.; Duranthon, V.; Labas, V.; et al. Docosahexaenoic Acid Mechanisms of Action on the Bovine Oocyte-Cumulus Complex. J. Ovarian Res. 2017, 10, 74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Téteau, O.; Liere, P.; Pianos, A.; Desmarchais, A.; Lasserre, O.; Papillier, P.; Vignault, C.; Lebachelier de la Riviere, M.-E.; Maillard, V.; Binet, A.; et al. Bisphenol S Alters the Steroidome in the Preovulatory Follicle, Oviduct Fluid and Plasma in Ewes with Contrasted Metabolic Status. Front. Endocrinol. 2022, 13, 892213. [Google Scholar] [CrossRef] [Scilit]
- Hu, P.; Pan, C.; Su, W.; Vinturache, A.; Hu, Y.; Dong, X.; Ding, G. Associations between Exposure to a Mixture of Phenols, Parabens, and Phthalates and Sex Steroid Hormones in Children 6-19 Years from NHANES, 2013–2016. Sci. Total Environ. 2022, 822, 153548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, C.; He, H.; Qiu, W.; Zheng, Y.; Chen, Y.; Hu, S.; Zhao, X. Oxidative Stress, Endocrine Disturbance, and Immune Interference in Humans Showed Relationships to Serum Bisphenol Concentrations in a Dense Industrial Area. Environ. Sci. Technol. 2021, 55, 1953–1963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vom Saal, F.S.; Vandenberg, L.N. Update on the Health Effects of Bisphenol A: Overwhelming Evidence of Harm. Endocrinology 2021, 162, bqaa171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chou, C.-H.; Chen, M.-J. The Effect of Steroid Hormones on Ovarian Follicle Development. Vitam. Horm. 2018, 107, 155–175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kolibianakis, E.M.; Papanikolaou, E.G.; Fatemi, H.M.; Devroey, P. Estrogen and Folliculogenesis: Is One Necessary for the Other? Curr. Opin. Obstet. Gynecol. 2005, 17, 249–253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weenen, C.; Laven, J.S.E.; Von Bergh, A.R.M.; Cranfield, M.; Groome, N.P.; Visser, J.A.; Kramer, P.; Fauser, B.C.J.M.; Themmen, A.P.N. Anti-Müllerian Hormone Expression Pattern in the Human Ovary: Potential Implications for Initial and Cyclic Follicle Recruitment. Mol. Hum. Reprod. 2004, 10, 77–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Monniaux, D.; Drouilhet, L.; Rico, C.; Estienne, A.; Jarrier, P.; Touzé, J.-L.; Sapa, J.; Phocas, F.; Dupont, J.; Dalbiès-Tran, R.; et al. Regulation of Anti-Müllerian Hormone Production in Domestic Animals. Reprod. Fertil. Dev. 2012, 25, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pankhurst, M.W. A Putative Role for Anti-Müllerian Hormone (AMH) in Optimising Ovarian Reserve Expenditure. J. Endocrinol. 2017, 233, R1–R13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saleh, A.C.; Sabry, R.; Mastromonaco, G.F.; Favetta, L.A. BPA and BPS Affect the Expression of Anti-Mullerian Hormone (AMH) and Its Receptor during Bovine Oocyte Maturation and Early Embryo Development. Reprod. Biol. Endocrinol. RBE 2021, 19, 119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Y.; Qu, X.; Ming, Z.; Yao, Y.; Zhang, Y. The Correlation between Exposure to BPA and the Decrease of the Ovarian Reserve. Int. J. Clin. Exp. Pathol. 2018, 11, 3375–3382. [Google Scholar] [PubMed]
- Silvestris, E.; Cohen, M.; Cornet, D.; Jacquesson-Fournols, L.; Clement, P.; Chouteau, J.; Schneider, M.; Besnard, T.; Ménézo, Y. Supporting the One-Carbon Cycle Restores Ovarian Reserve in Subfertile Women: Absence of Correlation with Urinary Bisphenol A Concentration. BioRes. Open Access 2017, 6, 104–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.-X.; Donatella, F.; Tan, S.-J.; Ge, W.; Wang, J.-J.; Sun, X.-F.; Cheng, S.-F.; Shen, W. Detrimental Effect of Bisphenol S in Mouse Germ Cell Cyst Breakdown and Primordial Follicle Assembly. Chemosphere 2021, 264, 128445. [Google Scholar] [CrossRef] [Scilit]
- Hernandez-Ochoa, I.; Barnett-Ringgold, K.R.; Dehlinger, S.L.; Gupta, R.K.; Leslie, T.C.; Roby, K.F.; Flaws, J.A. The Ability of the Aryl Hydrocarbon Receptor to Regulate Ovarian Follicle Growth and Estradiol Biosynthesis in Mice Depends on Stage of Sexual Maturity. Biol. Reprod. 2010, 83, 698–706. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Desmarchais, A.; Téteau, O.; Papillier, P.; Jaubert, M.; Druart, X.; Binet, A.; Maillard, V.; Elis, S. Bisphenol S Impaired In Vitro Ovine Early Developmental Oocyte Competence. Int. J. Mol. Sci. 2020, 21, 1238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, Z.-R.; Zhang, R.; Lian, Z.-X.; Deng, S.-L.; Yu, K. Estrogen-Receptor Expression and Function in Female Reproductive Disease. Cells 2019, 8, E1123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chauvin, C.; Cohen-Tannoudji, J.; Guigon, C.J. Estradiol Signaling at the Heart of Folliculogenesis: Its Potential Deregulation in Human Ovarian Pathologies. Int. J. Mol. Sci. 2022, 23, 512. [Google Scholar] [CrossRef] [Scilit]
- Grignard, E.; Lapenna, S.; Bremer, S. Weak Estrogenic Transcriptional Activities of Bisphenol A and Bisphenol S. Toxicol. Vitro Int. J. Publ. Assoc. BIBRA 2012, 26, 727–731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Molina-Molina, J.-M.; Amaya, E.; Grimaldi, M.; Sáenz, J.-M.; Real, M.; Fernández, M.F.; Balaguer, P.; Olea, N. In Vitro Study on the Agonistic and Antagonistic Activities of Bisphenol-S and Other Bisphenol-A Congeners and Derivatives via Nuclear Receptors. Toxicol. Appl. Pharmacol. 2013, 272, 127–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ullah, A.; Pirzada, M.; Jahan, S.; Ullah, H.; Shaheen, G.; Rehman, H.; Siddiqui, M.F.; Butt, M.A. Bisphenol A and Its Analogs Bisphenol B, Bisphenol F, and Bisphenol S: Comparative in Vitro and in Vivo Studies on the Sperms and Testicular Tissues of Rats. Chemosphere 2018, 209, 508–516. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Lin, L.; Gai, Y.; Hong, Y.; Li, L.; Weng, L. Subchronic Bisphenol S Exposure Affects Liver Function in Mice Involving Oxidative Damage. Regul. Toxicol. Pharmacol. RTP 2018, 92, 138–144. [Google Scholar] [CrossRef] [Scilit]
- Lu, J.; Wang, Z.; Cao, J.; Chen, Y.; Dong, Y. A Novel and Compact Review on the Role of Oxidative Stress in Female Reproduction. Reprod. Biol. Endocrinol. RBE 2018, 16, 80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wirth, C.; Brandt, U.; Hunte, C.; Zickermann, V. Structure and Function of Mitochondrial Complex I. Biochim. Biophys. Acta 2016, 1857, 902–914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hwang, M.-S.; Rohlena, J.; Dong, L.-F.; Neuzil, J.; Grimm, S. Powerhouse down: Complex II Dissociation in the Respiratory Chain. Mitochondrion 2014, 19 Pt A, 20–28. [Google Scholar] [CrossRef] [Scilit]
- Čunátová, K.; Reguera, D.P.; Houštěk, J.; Mráček, T.; Pecina, P. Role of Cytochrome c Oxidase Nuclear-Encoded Subunits in Health and Disease. Physiol. Res. 2020, 69, 947–965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bujnakova Mlynarcikova, A.; Scsukova, S. Bisphenol Analogs AF and S: Effects on Cell Status and Production of Angiogenesis-Related Factors by COV434 Human Granulosa Cell Line. Toxicol. Appl. Pharmacol. 2021, 426, 115634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Monniaux, D.; Huet, C.; Besnard, N.; Clément, F.; Bosc, M.; Pisselet, C.; Monget, P.; Mariana, J.C. Follicular Growth and Ovarian Dynamics in Mammals. J. Reprod. Fertil. Suppl. 1997, 51, 3–23. [Google Scholar] [PubMed]




| Abbrev. | Gene Name | Transcript Accession Number (Ensembl) | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Size (bp) | E (%) |
|---|---|---|---|---|---|---|
| Specific genes of follicle functionality | ||||||
| AHR | Aryl Hydrocarbon Receptor | ENSOART00020003479.1 | TGGGGCTGTTTCAATGTACC | TACAGGAATCCACCGGATGT | 233 | 81.8 |
| BMP15 | Bone morphogenetic protein 15 | ENSOART00020018955.1 | TCTATTGCCCACCTGCCTGAG | TGAAGCTGATGGCGGTAAACC | 326 | 89.2 |
| CYP19A1 | Cytochrome P450 Family 19 Subfamily A Member 1 | ENSOART00020040485.1 | GGTCATCCTGGTCACCCTTCTG | GCCGGTCGCTGGTCTCGTCTGG | 119 | 100 |
| ESR1 | Estrogen receptor 1 | ENSOART00020034283.1 | CCAGTTCCTCCTCCTCCTCT | GGCTCTGATTCACGTCTTCC | 158 | 87.2 |
| ESR2 | Estrogen receptor 2 | ENSOART00020022015.1 | ACTATGGAGTCTGGTCAT | GTCGGTTCTTATCTATGGTA | 114 | 97.3 |
| FSHR | Follicle-stimulating hormone receptor | ENSOART00000004728. | GGGCCAAGTCAACTTACCACT | TGCAAATTGGATGAAGGTCA | 144 | 88.5 |
| HSD3B1 | Hydroxy-Delta-5-Steroid Dehydrogenase | ENSOART00020002039.1 | TCATTGACGTCAGGAATGCT | CTCTATGGTGCTGGTGTGGA | 128 | 84 |
| Specific genes of redox status | ||||||
| CAT | Catalase | ENSOART00020018520.1 | GAAACGCCTGTGTGAGAACA | AGCTTTCTCCCTTGCAGACA | 208 | 91.2 |
| COX4I1 | Cytochrome C Oxidase Subunit 4I1 | ENSOART00020014820.1 | AGAGCTTTGCCGAGATGAAC | TCATGTCGAGCATCCTCTTG | 182 | 88.3 |
| COX5B | Cytochrome C Oxidase Subunit 5B | ENSOART00000014875.1 | GGGCTAGAGAGGGAGGTCAT | CAGCCAGAACCAGATGACAG | 180 | 91.2 |
| GPX3 | Glutathione Peroxidase 3 | ENSOART00020022210.1 | GATGTGAACGGGGAGAAAGA | CCCACCAGGAACTTCTCAAA | 152 | 90.4 |
| GPX8 | Glutathione Peroxidase 8 | ENSOART00020019722.1 | AAGGCATTTGCAGTCTTGCT | GACCTTCAGGGTTGACCAGA | 101 | 85.3 |
| NDUFB4 | NADH Dehydrogenase Ubiquinone 1 Beta Subcomplex Subunit 4 | ENSOART00020003605.1 | GGCCAGCCTACCTACTACCC | TGCATAGGTCCAACGAATCA | 181 | 90.7 |
| NDUFB5 | NADH Dehydrogenase Ubiquinone 1 Beta Subcomplex Subunit 5 | ENSOART00020014020.1 | GATTGCCCGAACTTTCTTTG | AGTGCCTTATCGATGGTTGG | 174 | 82.1 |
| NDUFV2 | NADH Ubiquinone Oxidoreductase Core Subunit V2 | ENSOART00020029984.1 | TCGAAAGCCTGTTGGAAAGT | ACACCAAACCCAGGTCCTTT | 205 | 60.8 |
| NDUFAF2 | NADH Ubiquinone Oxidoreductase Complex Assembly Factor 2 | ENSOART00020010561.1 | AACAGAATGGGAAGCTTGGA | AGAGGCGTGCCCTTTAATCT | 196 | 84.2 |
| SDHA | Succinate Dehydrogenase Complex Flavoprotein Subunit A | ENSOART00000016992.1 | AGCAGAAGAAGCCGTTTGAG | TCGGTCTCGTTCAAAGTCCT | 121 | 93.3 |
| SOD1 | Superoxide Dismutase 1 | ENSOART00020002019.1 | CAAAAATGGTGTTGCCATTG | CCAGCGTTTCCAGTCTTTGT | 153 | 94.0 |
| SOD2 | Superoxide Dismutase 2 | ENSOART00020009379.1 | GGTTGGCTTGGCTTCAATAA | ACATTCCAAATGGCCTTCAG | 178 | 90.6 |
| Housekeepinggenes | ||||||
| ACTB | Beta Actin | ENSOART00020013384.1 | CCAGCACGATGAAGATCAAG | ACATCTGCTGGAAGGTGGAC | 102 | 97.2 |
| RPL19 | Ribosomal Protein L19 | ENSOART00020024842.1 | CACAAGCTGAAGGCAGACAA | TGATGATTTCCTCCTTCTTGG | 129 | 95.3 |
| Gene Name Abbreviation | Gene Expression (Mean +/− SEM) | p | ||
|---|---|---|---|---|
| Control | BPS 0.1 µM | BPS 10 µM | ||
| Specific genes of follicle functionality | ||||
| AHR | 0.986 +/− 0.282 | 0.808 +/− 0.194 | 1.260 +/− 0.232 | 0.367 |
| BMP15 | 3.806 +/− 0.629 | 3.938 +/− 0.721 | 5.757 +/− 1.067 | 0.180 |
| ESR1 | 0.533 +/− 0.074 | 0.547 +/− 0.056 | 0.621 +/− 0.080 | 0.631 |
| ESR2 | 4.487 +/− 0.666 | 3.784 +/− 0.468 | 4.745 +/− 0.691 | 0.505 |
| FSHR | 2.461 +/− 0.400 | 2.552 +/− 0.473 | 2.245 +/− 0.466 | 0.876 |
| HSD3B1 | 0.039 +/− 0.011 | 0.034 +/− 0.009 | 0.047 +/− 0.012 | 0.691 |
| Specific genes of redox status | ||||
| CAT | 0.672 +/− 0.064 | 0.775 +/− 0.066 | 0.609 +/− 0.056 | 0.152 |
| COX4I1 | 0.619 +/− 0.042 | 0.614 +/− 0.056 | 0.602 +/− 0.049 | 0.970 |
| COX5B | 1.291 +/− 0.151 | 1.288 +/− 0.124 | 1.284 +/− 0.160 | 0.999 |
| GPX3 | 0.212 +/− 0.035 | 0.166 +/− 0.028 | 0.152 +/− 0.028 | 0.363 |
| NDUFB4 | 7.039 +/− 0.754 | 6.002 +/− 0.472 | 7.056 +/− 0.635 | 0.393 |
| NDUFB5 | 5.380 +/− 1.034 | 4.464 +/− 0.710 | 6.608 +/− 1.392 | 0.353 |
| NDUFV2 | 2.205 +/− 0.264 | 2.085 +/− 0.248 | 2.118 +/− 0.233 | 0.944 |
| SDHA | 1.038 +/− 0.066 | 0.991 +/− 0.088 | 1.139 +/− 0.116 | 0.502 |
| SOD1 | 3.517 +/− 0.362 | 3.387 +/− 0.234 | 3.853 +/− 0.316 | 0.518 |
| SOD2 | 0.753 +/− 0.098 | 0.701 +/− 0.059 | 0.708 +/− 0.073 | 0.885 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vignault, C.; Cadoret, V.; Jarrier-Gaillard, P.; Papillier, P.; Téteau, O.; Desmarchais, A.; Uzbekova, S.; Binet, A.; Guérif, F.; Elis, S.; et al. Bisphenol S Impairs Oestradiol Secretion during In Vitro Basal Folliculogenesis in a Mono-Ovulatory Species Model. Toxics 2022, 10, 437. https://doi.org/10.3390/toxics10080437
Vignault C, Cadoret V, Jarrier-Gaillard P, Papillier P, Téteau O, Desmarchais A, Uzbekova S, Binet A, Guérif F, Elis S, et al. Bisphenol S Impairs Oestradiol Secretion during In Vitro Basal Folliculogenesis in a Mono-Ovulatory Species Model. Toxics. 2022; 10(8):437. https://doi.org/10.3390/toxics10080437
Chicago/Turabian StyleVignault, Claire, Véronique Cadoret, Peggy Jarrier-Gaillard, Pascal Papillier, Ophélie Téteau, Alice Desmarchais, Svetlana Uzbekova, Aurélien Binet, Fabrice Guérif, Sebastien Elis, and et al. 2022. "Bisphenol S Impairs Oestradiol Secretion during In Vitro Basal Folliculogenesis in a Mono-Ovulatory Species Model" Toxics 10, no. 8: 437. https://doi.org/10.3390/toxics10080437
APA StyleVignault, C., Cadoret, V., Jarrier-Gaillard, P., Papillier, P., Téteau, O., Desmarchais, A., Uzbekova, S., Binet, A., Guérif, F., Elis, S., & Maillard, V. (2022). Bisphenol S Impairs Oestradiol Secretion during In Vitro Basal Folliculogenesis in a Mono-Ovulatory Species Model. Toxics, 10(8), 437. https://doi.org/10.3390/toxics10080437

