Exposure to Bacillus cereus in Water Buffalo Mozzarella Cheese
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Bacterial Counting and Identification
2.3. Estimation of the Probability of Growth
2.4. Gene Detection in B. cereus Strains
2.5. Exposure Assessment
- Rxp = exposure risk;
- MC = mozzarella per capita average consumption;
- Rc = risk classes (prevalence).
3. Results
3.1. Bacterial Counts
3.2. Estimation of the Probability of Growth
3.3. Gene Detection in B. cereus Strains
3.4. Exposure Assessment
4. Discussions
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Fayad, N.; Kallassy Awad, M.; Mahillon, J. Diversity of Bacillus cereus sensu lato mobilome. BMC Genom. 2019, 20, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Guinebretière, M.H.; Auger, S.; Galleron, N.; Contzen, M.; de Sarrau, B.; de Buyser, M.L.; Lamberet, G.; Fagerlund, A.; Granum, P.E.; Lereclus, D.; et al. Bacillus cytotoxicus sp. nov. is a novel thermotolerant species of the Bacillus cereus group occasionally associated with food poisoning. Int. J. Syst. Evol. Microbiol. 2013, 63, 31–40. [Google Scholar] [CrossRef] [PubMed]
- Lapidus, A.; Goltsman, E.; Auger, S.; Galleron, N.; Ségurens, B.; Dossat, C.; Land, M.L.; Broussolle, V.; Brillard, J.; Guinebretiere, M.H.; et al. Extending the Bacillus cereus group genomics to putative food-borne pathogens of different toxicity. Chem. Biol. Interact. 2008, 171, 236–249. [Google Scholar] [CrossRef] [PubMed]
- Oren, A.; Garrity, G.M. List of new names and new combinations previously effectively, but not validly, published. Int. J. Syst. Evol. Microbiol. 2016, 66, 2463–2466. [Google Scholar] [CrossRef]
- Heini, N.; Stephan, R.; Ehling-Schulz, M.; Johler, S. Characterization of Bacillus cereus group isolates from powdered food products. Int. J. Food Microbiol. 2018, 283, 59–64. [Google Scholar] [CrossRef]
- Ehling-Schulz, M.; Lereclus, D.; Koehler, T.M. The Bacillus cereus Group: Bacillus Species with Pathogenic Potential. Microbiol. Spectr. 2019, 7. [Google Scholar] [CrossRef]
- Lund, T.; Granum, P.E. Comparison of biological effect of the two different enterotoxin complexes isolated from three different strains of Bacillus cereus. Microbiology 1997, 143, 3329–3336. [Google Scholar] [CrossRef]
- Schoeni, J.L.; Lee Wong, A.C. Bacillus cereus food poisoning and its toxins. J. Food Prot. 2005, 68, 636–648. [Google Scholar] [CrossRef]
- Stenfors Arnesen, L.P.; Fagerlund, A.; Granum, P.E. From soil to gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Rev. 2008, 32, 579–606. [Google Scholar] [CrossRef]
- Tran, S.L.; Guillemet, E.; Gohar, M.; Lereclus, D.; Ramarao, N. CwpFM (EntFM) is a Bacillus cereus potential cell wall peptidase implicated in adhesion, biofilm formation, and virulence. J. Bacteriol. 2010, 192, 2638–2642. [Google Scholar] [CrossRef]
- Jessberger, N.; Kranzler, M.; Da Riol, C.; Schwenk, V.; Buchacher, T.; Dietrich, R.; Ehling-Schulz, M.; Märtlbauer, E. Assessing the toxic potential of enteropathogenic Bacillus cereus. Food Microbiol. 2019, 84, 103276. [Google Scholar] [CrossRef] [PubMed]
- Ramarao, N.; Tran, S.L.; Marin, M.; Vidic, J. Advanced methods for detection of Bacillus cereus and its pathogenic factors. Sensors 2020, 20, 2667. [Google Scholar] [CrossRef] [PubMed]
- Molva, C.; Sudagidan, M.; Okuklu, B. Extracellular enzyme production and enterotoxigenic gene profiles of Bacillus cereus and Bacillus thuringiensis strains isolated from cheese in Turkey. Food Control 2009, 20, 829–834. [Google Scholar] [CrossRef]
- Van der Auwera, G.A.; Timmery, S.; Hoton, F.; Mahillon, J. Plasmid exchanges among members of the Bacillus cereus group in foodstuffs. Int. J. Food Microbiol. 2007, 113, 164–172. [Google Scholar] [CrossRef]
- Webb, M.D.; Barker, G.C.; Goodburn, K.E.; Peck, M.W. Risk presented to minimally processed chilled foods by psychrotrophic Bacillus cereus. Trends Food Sci. Technol. 2019, 93, 94–105. [Google Scholar] [CrossRef]
- EFSA. Opinion of the Scientific Panel on biological hazards (BIOHAZ) on Bacillus cereus and other Bacillus spp. in foodstuffs. EFSA J. 2005, 3, 175. [Google Scholar] [CrossRef]
- EFSA. Risks for public health related to the presence of Bacillus cereus and other Bacillus spp. including Bacillus thuringiensis in foodstuffs–EFSA Panel on Biological Hazards (BIOHAZ). EFSA J. 2016, 14, 4524. [Google Scholar] [CrossRef]
- EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2011. EFSA J. 2013, 11, 3129. [Google Scholar] [CrossRef]
- Martinelli, D.; Fortunato, F.; Tafuri, S.; Cozza, V.; Chironna, M.; Germinario, C.; Pedalin, B.; Prato, R. Lessons learnt from a birthday party: A Bacillus cereus outbreak, Bari, Italy, January 2012. Ann. dell’Istituto Super. Sanità 2013, 49, 391–394. [Google Scholar] [CrossRef]
- Zicari, G.; Gorrasi, I.; Di Gioia, S.; Rossi, M.V.; Traversi, D.; Rivetti, D.; Soardo, V.; Cerrato, E.; Carraro, E.; Gilli, G.; et al. Foodborne outbreaks surveillance in the Piedmont Region, Italy (2002–2009). Ig. Sanità Pubblica 2011, 67, 721–742. [Google Scholar]
- Ombui, J.N.; Gitahi, J.N.; Gicheru, M.M. Direct detection of bacillus cereus enterotoxin genes in food by multiplex polymerase chain reaction. Int. J. Integr. Biol. 2008, 2, 172–181. [Google Scholar]
- EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2012. EFSA J. 2014, 12, 312. [Google Scholar] [CrossRef]
- Bonerba, E.; Di Pinto, A.; Novello, L.; Montemurro, F.; Terio, V.; Colao, V.; Ciccarese, G.; Tantillo, G. Detection of potentially enterotoxigenic food-related Bacillus cereus by PCR analysis. Int. J. Food Sci. Technol. 2010, 45, 1310–1315. [Google Scholar] [CrossRef]
- Aponte, M.; Pepe, O.; Blaiotta, G. Short communication: Identification and technological characterization of yeast strains isolated from samples of water buffalo Mozzarella cheese. J. Dairy Sci. 2010, 93, 2358–2361. [Google Scholar] [CrossRef] [PubMed]
- Murru, N.; Peruzy, M.F.; De Carlo, E.; Mercogliano, R.; Aponte, M.; Morena, C.; Serluca, G.; Fraulo, P. Listeria monocytogenes survival during production and storage of water buffalo Mozzarella cheese. Int. J. Dairy Technol. 2018, 71, 356–361. [Google Scholar] [CrossRef]
- Serraino, A.; Finazzi, G.; Marchetti, G.; Daminelli, P.; Riu, R.; Giacometti, F.; Losio, M.N.; Rosmini, R. Behaviour of Salmonella Typhimurium during production and storage of artisan water buffalo mozzarella cheese. Ital. J. Anim. Sci. 2012, 11, 285–289. [Google Scholar] [CrossRef]
- De Santis, E.P.L.; Foddai, A.; Virdis, S.; Marongiu, P.; Pilo, A.L.; Scarano, C. Toxin gene pattern in Bacillus cereus group strains isolated from sheep ricotta cheese. Vet. Res. Commun. 2008, 32, 323–326. [Google Scholar] [CrossRef]
- Berthold-Pluta, P.; Garbowska, S. Prevalence and toxicity characterization of Bacillus cereus in food products from Poland. Foods 2019, 8, 269. [Google Scholar] [CrossRef]
- Rea, S.; Marino, L.; Stocchi, R.; Branciari, R.; Loschi, A.R.; Miraglia, D.; Ranucci, D. Differences in chemical, physical and microbiological characteristics of Italian Burrata cheeses made in artisanal and industrial plants of the Apulia Region. Ital. J. Food Saf. 2016, 5. [Google Scholar] [CrossRef]
- Nava, D.; Capo, S.; Caligiuri, V.; Giaccone, V.; Biondi, L.; Vaccaro, G.F.; Guarino, A.; Capuano, F. Study of the population dynamics of Listeria monocytogenes and pseudomonas fluorescens in buffalo-milk mozzarella cheese by means of challenge testing. Ital. J. Food Saf. 2016, 5, 2–4. [Google Scholar] [CrossRef]
- Ngamwongsatit, P.; Buasri, W.; Pianariyanon, P.; Pulsrikarn, C.; Ohba, M.; Assavanig, A.; Panbangred, W. Broad distribution of enterotoxin genes (hblCDA, nheABC, cytK, and entFM) among Bacillus thuringiensis and Bacillus cereus as shown by novel primers. Int. J. Food Microbiol. 2008, 121, 352–356. [Google Scholar] [CrossRef] [PubMed]
- Ehling-Schulz, M.; Frenzel, E.; Gohar, M. Food-bacteria interplay: Pathometabolism of emetic Bacillus cereus. Front. Microbiol. 2015, 6, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Wielicka, A.; Gorynska-Goldmann, E. World and Poland Per Capita Cheese Consumption. Rocz. Akad. Rol. Pozaniu 2005, 4, 157–166. [Google Scholar]
- Global Mozzarella Cheese Market 2020 by Manufacturers, Regions, Type and Application, Forecast to 2025. Available online: https://www.bharatbook.com/marketreports/global-mozzarella-cheese-market-2019-by-manufacturers-regions-type-and-application-forecast-to-2024/1409689 (accessed on 15 July 2020).
- Lammerding, A.; Fazil, A. Hazard identification and exposure assessment for microbial food safety risk assessment, in Food Microbiology and Food Safety into the next Millennium. Int. Comm. Food Microbiol. 2000, 58, 433–437. [Google Scholar] [CrossRef]
- Guinebretière, M.H.; Broussolle, V.; Nguyen-The, C. Enterotoxigenic profiles of food-poisoning and food-borne Bacillus cereus strains. J. Clin. Microbiol. 2002, 40, 3053–3056. [Google Scholar] [CrossRef] [PubMed]
- Fagerlund, A.; Ween, O.; Lund, T.; Hardy, S.P.; Granum, P.E. Genetic and functional analysis of the cytK family of genes in Bacillus cereus. Microbiology 2004, 150, 2689–2697. [Google Scholar] [CrossRef] [PubMed]
- Lindbäck, T.; Økstad, O.A.; Rishovd, A.L.; Kolstø, A.B. Insertional inactivation of hblC encoding the L2 component of Bacillus cereus ATCC 14579 haemolysin BL strongly reduces enterotoxigenic activity, but not the haemolytic activity against human erythrocytes. Microbiology 1999, 145, 3139–3146. [Google Scholar] [CrossRef]
- Amor, M.G.B.; Jan, S.; Baron, F.; Grosset, N.; Culot, A.; Gdoura, R.; Gautier, M.; Techer, C. Toxigenic potential and antimicrobial susceptibility of Bacillus cereus group bacteria isolated from Tunisian foodstuffs. BMC Microbiol. 2019, 19, 196. [Google Scholar]
- Granum, P.E.; Lund, T. Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Lett. 1997, 157, 223–228. [Google Scholar] [CrossRef]
- Ceuppens, S.; Uyttendaele, M.; Hamelink, S.; Boon, N.; Van De Wiele, T. Inactivation of Bacillus cereus vegetative cells by gastric acid and bile during in vitro gastrointestinal transit. Gut Pathog. 2012, 4, 5–11. [Google Scholar] [CrossRef]

| Toxin | Target Gene | Primer Sequence (5′–3′) | Product Size (bp) | Reference |
|---|---|---|---|---|
| HBL | hblA | F-GCAAAATCTATGAATGCCTA | 884 | [31] |
| R-GCATCTTGTTCGTAATGTTTT | ||||
| hblD | F-GAAACAGGGTCTCATATTCT | 1018 | ||
| R-CTGCATCTTTATGAATATCA | ||||
| hblC | F-CCTATCAATACTCTCGCAA | 695 | ||
| R-TTTCCTTTGTTATACGCTGC | ||||
| NHE | nheA | F-TAAGGAGGGGCAAACAGAAG | 759 | |
| R-TGAATGCGAAGAGCTGCTTC | ||||
| nheB | F-CAAGCTCCAGTTCATGCGG | 935 | ||
| R-GATCCCATTGTGTACCATTG | ||||
| nheC | F-ACATCCTTTTGCAGCAGAAC | 618 | ||
| R-CCACCAGCAATGACCATATC | ||||
| CytK | cytK | F-CGACGTCACAAGTTGTAACA | 565 | |
| R-CGTGTGTAAATACCCCAGTT | ||||
| EntFM | entFM | F-GTTCGTTCAGGTGCTGGTTAC | 486 | |
| R-AGCTGGGCCTGTACGTACTT | ||||
| Ces | ces | F-GGTGACACATTATCATATAAGGTG | 1271 | [32] |
| R- GTAAGCGAACCTGTCTGTAACAACA |
| B. cereus CFU/g | ||||||||
|---|---|---|---|---|---|---|---|---|
| Haplotypes | Molecular Profile | Negative Samples | Positive Samples | <103 | 103–104 | 104–105 | 105–106 | >106 |
| H1 | nhe(A,B,C); hbl (A,C,D); cytK; entFM | - | 22 | 13 | 5 | 1 | 2 | 1 |
| H2 | nhe(A,B,C); hbl (A,C,D) | - | 6 | 3 | 2 | 1 | - | - |
| H3 | nhe(A,B,C); cytK; entFM | - | 19 | 10 | 5 | 1 | 1 | 2 |
| H4 | nhe(A,B,C); entFM | - | 32 | 27 | 3 | 2 | - | - |
| H5 | nhe(A,B,C); entFM; ces | - | 1 | - | - | 1 | - | - |
| H6 | nhe (A,C); hbl (A,C,D); entFM | - | 5 | 3 | 2 | - | - | - |
| H7 | No genes detected | - | 2 | 2 | - | - | - | - |
| H8 | nheC; entFM | - | 2 | 1 | 1 | - | - | - |
| 251 | 89 | 59 | 18 | 6 | 3 | 3 | ||
| Concentration (Log Cells/g) at Different Temperatures | ||||||
|---|---|---|---|---|---|---|
| Time (Hours) | 22 °C | 18 °C | 15 °C | |||
| Log CFU/g | Log CFU/g | Log CFU/g | Log CFU/g | Log CFU/g | Log CFU/g | |
| 0.00 | 3.00 | 2.00 | 3.00 | 2.00 | 3.00 | 2.00 |
| 20.62 | 5.01 | 4.01 | 3.2 | 2.2 | 3.01 | 2.02 |
| 24.60 | 6.06 | 5.07 | 3.55 | 2.55 | 3.04 | 2.04 |
| 34.73 | 7.58 | 7.4 | 5.03 | 4.04 | 3.35 | 2.35 |
| 40.88 | 7.6 | 7.6 | 6.01 | 5.02 | 3.81 | 2.81 |
| 53.19 | 7.6 | 7.6 | 7.46 | 6.9 | 5.02 | 4.03 |
| 62.59 | 7.6 | 7.6 | 7.6 | 7.56 | 6.00 | 5.01 |
| Gene Target | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| hbl | nhe | cytK | entFM | ces | |||||
| A | C | D | A | B | C | ||||
| No. | 33 | 33 | 33 | 85 | 80 | 87 | 41 | 87 | 1 |
| % | 37.1 | 37.1 | 37.1 | 95.5 | 89.9 | 97.7 | 46.1 | 97.7 | 1.1 |
| Degree of Risk | ||||
|---|---|---|---|---|
| High | Moderate | Low | No Risk | |
| B. cereus contamination | >5 log CFU/g | >3 log to 5 log CFU/g | <3 log CFU/g | No B. cereus isolate |
| No. mozzarella samples | 6 (1.8%) | 24 (7.1%) | 59 (17.3%) | 251 (73.8%) |
| Virulence profile of isolates | haplotype 1 | haplotypes 2 and 3 | haplotypes 4, 5 and 6 | Negative samples, and isolates without any virulence determinants |
| No. mozzarella samples | 22 (6.5%) | 25 (7.3%) | 38 (11.2%) | 255 (75%) |
| Combination: bacterial contamination and isolate virulotype | >3 log CFU/g and haplotype 1 >5 log CFU/g and haplotypes 2 and 3 | <3 log CFU/g and haplotype 1 from 3 log to 5 log CFU/g and haplotypes 2 and 3 | >5 log and haplotypes 4,5 and 6 | All remaining conditions |
| No. mozzarella samples | 12 (3.5%) | 22 (6.5%) | 0 (0.0%) | 306 (90.0%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Montone, A.M.I.; Capuano, F.; Mancusi, A.; Di Maro, O.; Peruzy, M.F.; Proroga, Y.T.R.; Cristiano, D. Exposure to Bacillus cereus in Water Buffalo Mozzarella Cheese. Foods 2020, 9, 1899. https://doi.org/10.3390/foods9121899
Montone AMI, Capuano F, Mancusi A, Di Maro O, Peruzy MF, Proroga YTR, Cristiano D. Exposure to Bacillus cereus in Water Buffalo Mozzarella Cheese. Foods. 2020; 9(12):1899. https://doi.org/10.3390/foods9121899
Chicago/Turabian StyleMontone, Angela Michela Immacolata, Federico Capuano, Andrea Mancusi, Orlandina Di Maro, Maria Francesca Peruzy, Yolande Thérèse Rose Proroga, and Daniela Cristiano. 2020. "Exposure to Bacillus cereus in Water Buffalo Mozzarella Cheese" Foods 9, no. 12: 1899. https://doi.org/10.3390/foods9121899
APA StyleMontone, A. M. I., Capuano, F., Mancusi, A., Di Maro, O., Peruzy, M. F., Proroga, Y. T. R., & Cristiano, D. (2020). Exposure to Bacillus cereus in Water Buffalo Mozzarella Cheese. Foods, 9(12), 1899. https://doi.org/10.3390/foods9121899

