Protective Effect of Ganjang, a Traditional Fermented Soy Sauce, on Colitis-Associated Colorectal Cancer in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Information on Ganjang
2.2. Animal Experiments
2.3. Animal Grouping and Introduction of Colitis-Associated Colorectal Cancer (CAC)
2.4. Bacterial Community Analysis Using Next-Generation Sequencing (NGS)
2.5. Determination of Inflammatory Cytokines in the Serum
2.6. Hematoxylin–Eosin (HE) Staining
2.7. Western Blot (WB) Analysis
2.8. Quantitative Real-Time PCR (qRT-PCR) Analysis
2.9. Immunohistochemistry (IHC) Assay
2.10. Statistical Analysis
3. Results
3.1. Bacteria Composition in Ganjang Samples
3.2. Effect of Ganjang on Symptoms in AOM/DSS-Induced CAC Mice
3.3. Effect of Ganjang on Tumor Formation and Growth in AOM/DSS-Induced CAC Mice
3.4. Effect of Ganjang on Inflammatory Cytokines in AOM/DSS-Induced CAC Mice
3.5. Effect of Ganjang on Intestinal Epithelial Barrier in AOM/DSS-Induced CAC Mice
3.6. Effect of Ganjang on the Gut Microbiota in AOM/DSS-Induced CAC Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Wagle, N.S.; Cercek, A.; Smith, R.A.; Jemal, A. Colorectal cancer statistics, 2023. CA Cancer J. Clin. 2023, 73, 233–254. [Google Scholar] [CrossRef] [PubMed]
- Masdor, N.A.; Mohammed Nawi, A.; Hod, R.; Wong, Z.; Makpol, S.; Chin, S.F. The link between food environment and colorectal Cancer: A Systematic Review. Nutrients 2022, 14, 3954. [Google Scholar] [CrossRef]
- Thursby, E.; Juge, N. Introduction to the human gut microbiota. Biochem. J. 2017, 474, 1823–1836. [Google Scholar] [CrossRef]
- Rowland, I.; Gibson, G.; Heinken, A.; Scott, K.; Swann, J.; Thiele, I.; Tuohy, K. Gut microbiota functions: Metabolism of nutrients and other food components. Eur. J. Nutr. 2018, 57, 1–24. [Google Scholar] [CrossRef]
- Valdes, A.M.; Walter, J.; Segal, E.; Spector, T.D. Role of the gut microbiota in nutrition and health. BMJ 2018, 361, k2179. [Google Scholar] [CrossRef]
- Fan, X.; Jin, Y.; Chen, G.; Ma, X.; Zhang, L. Gut Microbiota Dysbiosis Drives the Development of Colorectal Cancer. Digestion 2021, 102, 508–515. [Google Scholar] [CrossRef]
- Zhao, L.Y.; Mei, J.X.; Yu, G.; Lei, L.; Zhang, W.H.; Liu, K.; Chen, X.L.; Kołat, D.; Yang, K.; Hu, J.K. Role of the gut microbiota in anticancer therapy: From molecular mechanisms to clinical applications. Signal Transduct. Target. Ther. 2023, 8, 201. [Google Scholar] [CrossRef] [PubMed]
- Yadav, M.K.; Kumari, I.; Singh, B.; Sharma, K.K.; Tiwari, S.K. Probiotics, prebiotics and synbiotics: Safe options for next-generation therapeutics. Appl. Microbiol. Biotechnol. 2022, 106, 505–521. [Google Scholar] [CrossRef]
- Chun, B.H.; Han, D.M.; Kim, H.M.; Park, D.; Jeong, D.M.; Kang, H.A.; Jeon, C.O. Metabolic features of ganjang (a Korean traditional soy sauce) fermentation revealed by genome-centered metatranscriptomics. mSystems 2021, 6, e0044121. [Google Scholar] [CrossRef]
- Mannaa, M.; Han, G.; Seo, Y.S.; Park, I. Evolution of food fermentation processes and the use of multi-omics in deciphering the roles of the microbiota. Foods 2021, 10, 2861. [Google Scholar] [CrossRef]
- Park, S.; Kwak, H.S.; Oh, M.; Lee, Y.; Jeong, Y.; Kim, M. Physicochemical, microbiological, and sensory characteristics of soy sauce fermented in different regional ceramics. Appl. Biol. Chem. 2016, 59, 33–41. [Google Scholar] [CrossRef]
- Byeon, Y.S.; Heo, J.; Park, K.; Chin, Y.W.; Hong, S.P.; Lim, S.D.; Kim, S.S. Consumer preference of traditional Korean soy sauce (ganjang) and its relationship with sensory attributes and physicochemical properties. Foods 2023, 12, 2361. [Google Scholar] [CrossRef] [PubMed]
- Lim, H.J.; Park, I.S.; Seo, J.W.; Ha, G.; Yang, H.J.; Jeong, D.Y.; Kim, S.Y.; Jung, C.H. Anti-inflammatory effect of Korean soybean sauce (Ganjang) on mice with induced colitis. J. Microbiol. Biotechnol. 2024, 34, 1501–1510. [Google Scholar] [CrossRef] [PubMed]
- Mun, E.G.; Sohn, H.S.; Kim, M.S.; Cha, Y.S. Antihypertensive effect of Ganjang (traditional Korean soy sauce) on Sprague-Dawley Rats. Nutr. Res. Pract. 2017, 11, 388–395. [Google Scholar] [CrossRef]
- Lee, E.J.; Song, J.; Park, C.H.; Mun, E.G.; Wang, J.; Han, A.; Park, J.E.; Cha, Y.S. Soy sauce lowers body weight and fat mass in high-fat diet-induced obese rats. J. Med. Food 2023, 26, 858–867. [Google Scholar] [CrossRef]
- Wang, H.; Jenner, A.M.; Lee, C.Y.; Shui, G.; Tang, S.Y.; Whiteman, M.; Wenk, M.R.; Halliwell, B. The identification of antioxidants in dark soy sauce. Free Radic. Res. 2007, 41, 479–488. [Google Scholar] [CrossRef]
- Chin, Y.W.; Hong, S.P.; Lim, S.D.; Yi, S.H. Investigation of Microbial Community of Korean Soy Sauce (Ganjang) Using Shotgun Metagenomic Sequencing and Its Relationship with Sensory Characteristics. Microorganisms 2024, 12, 2559. [Google Scholar] [CrossRef]
- Lee, R.; Ha, G.; Jeong, H.J.; Jeong, D.Y.; Yang, H.J. Metagenomic Analysis of Jang Using Next-generation Sequencing: A Comparative Microbial Study of Korean Traditional Fermented Soybean Foods. J. Life Sci. 2024, 34, 254–263. [Google Scholar]
- Nguyen, P.T.; Nguyen-Thi, T.U.; Nguyen, H.T.; Pham, M.N.; Nguyen, T.T. Halophilic lactic acid bacteria—Play a vital role in the fermented food industry. Folia Microbiol. 2024, 69, 305–321. [Google Scholar] [CrossRef]
- Wen, Y.; Zhu, Y.; Zhang, C.; Yang, X.; Gao, Y.; Li, M.; Yang, H.; Liu, T.; Tang, H. Chronic inflammation, cancer development and immunotherapy. Front. Pharmacol. 2022, 13, 1040163. [Google Scholar] [CrossRef]
- Lasry, A.; Zinger, A.; Ben-Neriah, Y. Inflammatory networks underlying colorectal cancer. Nat. Immunol. 2016, 17, 230–240. [Google Scholar] [CrossRef] [PubMed]
- Sankarapandian, V.; Venmathi Maran, B.A.; Rajendran, R.L.; Jogalekar, M.P.; Gurunagarajan, S.; Krishnamoorthy, R.; Gangadaran, P.; Ahn, B.C. An Update on the effectiveness of probiotics in the prevention and treatment of cancer. Life 2022, 12, 59. [Google Scholar] [CrossRef]
- Li, L.; Li, X.; Zhong, W.; Yang, M.; Xu, M.; Sun, Y.; Ma, J.; Liu, T.; Song, X.; Dong, W.; et al. Gut microbiota from colorectal cancer patients enhances the progression of intestinal adenoma in Apcmin/+ mice. EBioMedicine 2019, 48, 301–315. [Google Scholar] [CrossRef]
- Oh, N.S.; Lee, J.Y.; Kim, Y.T.; Kim, S.H.; Lee, J.H. Cancer-protective effect of a synbiotic combination between Lactobacillus gasseri 505 and a Cudrania tricuspidata leaf extract on colitis-associated colorectal cancer. Gut Microbes 2020, 12, 1785803. [Google Scholar] [CrossRef]
- Zhu, J.; Paul, W.E. CD4 T cells: Fates, functions, and faults. Blood 2008, 112, 1557–1569. [Google Scholar] [CrossRef]
- Rébé, C.; Ghiringhelli, F. Interleukin-1β and cancer. Cancers 2020, 12, 1791. [Google Scholar] [CrossRef]
- Braumüller, H.; Mauerer, B.; Andris, J.; Berlin, C.; Wieder, T.; Kesselring, R. The cytokine network in colorectal cancer: Implications for new treatment strategies. Cells 2022, 12, 138. [Google Scholar] [CrossRef]
- Kang, Y.; Park, H.; Choe, B.H.; Kang, B. The role and function of mucins and its relationship to inflammatory bowel disease. Front. Med. (Lausanne) 2022, 9, 848344. [Google Scholar] [CrossRef]
- Chelakkot, C.; Ghim, J.; Ryu, S.H. Mechanisms regulating intestinal barrier integrity and its pathological implications. Exp. Mol. Med. 2018, 50, 1–9. [Google Scholar] [CrossRef]
- Peterson, L.W.; Artis, D. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 2014, 14, 141–153. [Google Scholar] [CrossRef]
- Hu, F.J.; Li, Y.J.; Zhang, L.; Ji, D.B.; Liu, X.Z.; Chen, Y.J.; Wang, L.; Wu, A.W. Single-cell profiling reveals differences between human classical adenocarcinoma and mucinous adenocarcinoma. Commun. Biol. 2023, 6, 85. [Google Scholar] [CrossRef] [PubMed]
- Espinoza, I.; Agarwal, S.; Reddy, A.; Shenoy, V.; Subramony, C.; Sakiyama, M.; Fair, L.; Poosarla, T.; Zhou, X.; Shannon, O.W.; et al. Expression of trefoil factor 3 is decreased in colorectal cancer. Oncol. Rep. 2021, 45, 254–264. [Google Scholar] [CrossRef] [PubMed]
- Cipe, G.; Idiz, U.O.; Firat, D.; Bektasoglu, H. Relationship between intestinal microbiota and colorectal cancer. World J. Gastrointest. Oncol. 2015, 7, 233–240. [Google Scholar] [CrossRef] [PubMed]
- Zackular, J.P.; Baxter, N.T.; Iverson, K.D.; Sadler, W.D.; Petrosino, J.F.; Chen, G.Y.; Schloss, P.D. The gut microbiome modulates colon tumorigenesis. mBio 2013, 4, e00692-13. [Google Scholar] [CrossRef]
- Saffarian, A.; Mulet, C.; Regnault, B.; Amiot, A.; Tran-Van-Nhieu, J.; Ravel, J.; Sobhani, I.; Sansonetti, P.J.; Pédron, T. Crypt- and mucosa-associated core microbiotas in humans and their alteration in colon cancer patients. mBio 2019, 10, e01315-19. [Google Scholar] [CrossRef]
- Kim, D.H.; Kim, S.A.; Jo, Y.M.; Seo, H.; Kim, G.Y.; Cheon, S.W.; Yang, S.H.; Jeon, C.O.; Han, N.S. Probiotic potential of Tetragenococcus halophilus EFEL7002 isolated from Korean soy Meju. BMC Microbiol. 2022, 22, 149. [Google Scholar] [CrossRef]
- Leñini, C.; Rodriguez Ayala, F.; Goñi, A.J.; Rateni, L.; Nakamura, A.; Grau, R.R. Probiotic properties of Bacillus subtilis DG101 isolated from the traditional Japanese fermented food nattō. Front. Microbiol. 2023, 14, 1253480. [Google Scholar] [CrossRef]
- Jeong, D.W.; Jeong, M.; Lee, J.H. Antibiotic susceptibilities and characteristics of Bacillus licheniformis isolates from traditional Korean fermented soybean foods. LWT 2017, 75, 565–568. [Google Scholar] [CrossRef]
- Kazou, M.; Alexandraki, V.; Pot, B.; Tsakalidou, E.; Papadimitriou, K. Whole-Genome Sequence of the Cheese Isolate Lactobacillus rennini ACA-DC 565. Genome Announc. 2017, 5, e01579-16. [Google Scholar] [CrossRef]
- Elshaghabee, F.M.F.; Ghadimi, D.; Habermann, D.; de Vrese, M.; Bockelmann, W.; Kaatsch, H.J.; Heller, K.J.; Schrezenmeir, J. Effect of Oral Administration of Weissella confusa on Fecal and Plasma Ethanol Concentrations, Lipids and Glucose Metabolism in Wistar Rats Fed High Fructose and Fat Diet. Hepat. Med. 2020, 12, 93–106. [Google Scholar] [CrossRef]









| Production Method | Production Region | Water Content (%) | pH | Nutrition Facts | |||
|---|---|---|---|---|---|---|---|
| Calories (kcal/100 g) | Fat (g/100 g) | Sodium (mg/100 g) | |||||
| Ganjang 1 | Traditional | Hadong-gun, Gyeongsangnam-do | 64.06 | 5.73 ± 0.01 | 29.87 | 0.19 | 6.49 | 
| Ganjang 2 | Traditional | Gurye-gun, Jeollanam-do | 68.13 | 5.19 ± 0.01 | 48.00 | 0.18 | 7.81 | 
| Ganjang 3 | Traditional | Cheongwon-gun, Chungcheongbuk-do | 71.43 | 4.48 ± 0.01 | 30.59 | 0.11 | 7.89 | 
| Ganjang 4 | Industrial | Sunchang-gun, Jeollabuk-do | 69.60 | 4.77 ± 0.01 | 51.70 | 0.10 | 7.73 | 
| Gene | Forward (5′-3′) | Reverse (5′-3′) | 
|---|---|---|
| p53 | CCCCTGTCATCTTTTGTCCCT | AGCTGGCAGAATAGCTTATTGAG | 
| Bax | AGACAGGGGCCTTTTTGCTAC | AATTCGCCGGAGACACTCG | 
| Bcl-2 | GCTACCGTCGTGACTTCGC | CCCCACCGAACTCAAAGAAGG | 
| Bcl-XL | GGCACTGTGCGTGGAAAGCGTA | CCGCCGTTCTCCTGGATCCA | 
| TNF-α | CTGAACTTCGGGGTGATCGG | GGCTTGTCACTCGAATTTTGAGA | 
| IL-1β | CAACCAACAAGTGATATTCTCCATG | GATCCACACTCTCCAGCTGCA | 
| IL-6 | TGTCTATACCACTTCACAAGTCGGAG | GCACAACTCTTTTCTCATTTCCAC | 
| MUC-2 | ATGCCCACCTCCTCAAAGAC | GTAGTTTCCGTTGGAACAGTGAA | 
| TFF-3 | TAATGCTGTTGGTGGTCCTG | CAGCCACGGTTGTTACACTG | 
| β-actin | CGGTTCCGATGCCCTGAGGCTCTT | CGTCACACTTCATGATGGAATTGA | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, H.-J.; Park, I.-S.; Kim, M.J.; Seo, J.W.; Ha, G.; Yang, H.-J.; Jeong, D.-Y.; Kim, S.-Y.; Jung, C.-H. Protective Effect of Ganjang, a Traditional Fermented Soy Sauce, on Colitis-Associated Colorectal Cancer in Mice. Foods 2025, 14, 632. https://doi.org/10.3390/foods14040632
Lim H-J, Park I-S, Kim MJ, Seo JW, Ha G, Yang H-J, Jeong D-Y, Kim S-Y, Jung C-H. Protective Effect of Ganjang, a Traditional Fermented Soy Sauce, on Colitis-Associated Colorectal Cancer in Mice. Foods. 2025; 14(4):632. https://doi.org/10.3390/foods14040632
Chicago/Turabian StyleLim, Hyeon-Ji, In-Sun Park, Min Ju Kim, Ji Won Seo, Gwangsu Ha, Hee-Jong Yang, Do-Youn Jeong, Seon-Young Kim, and Chan-Hun Jung. 2025. "Protective Effect of Ganjang, a Traditional Fermented Soy Sauce, on Colitis-Associated Colorectal Cancer in Mice" Foods 14, no. 4: 632. https://doi.org/10.3390/foods14040632
APA StyleLim, H.-J., Park, I.-S., Kim, M. J., Seo, J. W., Ha, G., Yang, H.-J., Jeong, D.-Y., Kim, S.-Y., & Jung, C.-H. (2025). Protective Effect of Ganjang, a Traditional Fermented Soy Sauce, on Colitis-Associated Colorectal Cancer in Mice. Foods, 14(4), 632. https://doi.org/10.3390/foods14040632
 
        


 
       