Screening and Characteristics Analysis of Polysaccharides from Orah Mandarin (Citrus reticulata cv. Orah)
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Preparation of Polysaccharides
2.2.1. Extraction of Polysaccharides
2.2.2. Isolation of Polysaccharides
2.3. Cell Culture
2.3.1. NK-92MI Cell
2.3.2. Calu-1 Cell
2.4. Determination of NK-92MI Cell Activity
2.4.1. Effects of OPs on NK-92MI Cell Proliferation
2.4.2. Effect of OPs on NK-92MI Cell Cytotoxicity
2.4.3. Effect of OPs on Gene Expression of NK-92MI Cell
2.5. Characteristics Analysis of Polysaccharide
2.5.1. Monosaccharide Composition
2.5.2. Fourier Transform-Infrared Spectroscopy (FT-IR) and Nuclear Magnetic Resonance (NMR) Analysis
2.6. Statistical Analysis
3. Results and Discussion
3.1. Screening of Polysaccharide with the Highest Ability to Activate NK Cell
3.2. Characteristics of OP5
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Goldenberg, L.; Yaniv, Y.; Porat, R.; Carmi, N. Mandarin fruit quality: A review. J. Sci. Food Agric. 2018, 98, 18–26. [Google Scholar] [CrossRef] [Scilit]
- Kaya, M.; Sousa, A.G.; Crépeau, M.J.; Sørensen, S.O.; Ralet, M.C. Characterization of citrus pectin samples extracted under different conditions: Influence of acid type and pH of extraction. Ann. Bot. 2014, 114, 1319–1326. [Google Scholar] [CrossRef] [Scilit]
- Peng, B.; Yang, J.; Huang, W.; Peng, D.; Bi, S.; Song, L.; Wen, Y.; Zhu, J.; Chen, Y.; Yu, R. Structural characterization and immunoregulatory activity of a novel heteropolysaccharide from bergamot (Citrus medica L. var. sarcodactylis) by alkali extraction. Ind. Crop. Prod. 2019, 140, 111617. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Chen, J.; Li, J.; Yan, L.; Li, S.; Ye, X.; Liu, D.; Ding, T.; Linhardt, R.J.; Orfila, C.; et al. Extraction and characterization of RG-I enriched pectic polysaccharides from mandarin citrus peel. Food Hydrocoll. 2018, 79, 579–586. [Google Scholar] [CrossRef] [Scilit]
- Park, H.R.; Shin, K.S. Structural elucidation of an anti-metastatic polysaccharide from the peels of Korean citrus Hallabong. Carbohydr. Polym. 2019, 225, 115222. [Google Scholar] [CrossRef] [Scilit]
- Gao, Y.; Peng, B.; Xu, Y.; Yang, J.N.; Song, L.Y.; Bi, S.X.; Chen, Y.; Zhu, J.H.; Wen, Y.; Yu, R.M. Structural characterization and immunoregulatory activity of a new polysaccharide from Citrus medica L. var. sarcodactylis. RSC Adv. 2019, 9, 6603–6612. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Zheng, J.; Zhang, L.; Cheng, H.; Orfila, C.; Ye, X.; Chen, J. Synergistic gelling mechanism of RG-I rich citrus pectic polysaccharide at different esterification degree in calcium-induced gelation. Food Chem. 2021, 350, 129177. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Shuai, M.; Ma, P.; Huang, J.; Sun, C.; Yao, X.; Chen, Z.; Min, X.; Yan, S. Purification, chemical analysis and antioxidative activity of polysaccharides from pH-modified citrus pectin after dialyzation. LWT Food Sci. Technol. 2020, 128, 109513. [Google Scholar] [CrossRef] [Scilit]
- Park, H.R.; Shin, K.S. Inhibitory effects of orally administered pectic polysaccharides extracted from the citrus Hallabong peel on lung metastasis. Food Biosci. 2021, 43, 101301. [Google Scholar] [CrossRef] [Scilit]
- Zhou, T.; Jiang, Y.; Wen, L.; Yang, B. Characterization of polysaccharide structure in Citrus reticulate ‘Chachi’ peel during storage and their bioactivity. Carbohydr. Res. 2021, 508, 108398. [Google Scholar] [CrossRef] [Scilit]
- Fan, R.; Xie, Y.; Zhu, C.; Qiu, D.; Zeng, J.; Liu, Z. Structural elucidation of an acidic polysaccharide from Citrus grandis ‘Tomentosa’ and its anti-proliferative effects on LOVO and SW620 cells. Int. J. Biol. Macromol. 2019, 138, 511–518. [Google Scholar] [CrossRef] [Scilit]
- Fan, R.; Zhu, C.; Qiu, D.; Mao, G.; Zeng, J. Activation of RAW264.7 macrophages by an acidic polysaccharide derived from Citrus grandis ‘Tomentosa’. Int. J. Biol. Macromol. 2020, 156, 1323–1329. [Google Scholar] [CrossRef] [Scilit]
- Park, H.R.; Lee, S.J.; Im, S.B.; Shin, M.S.; Choi, H.J.; Park, H.Y.; Shin, K.S. Signaling pathway and structural features of macrophage-activating pectic polysaccharide from Korean citrus, Cheongkyool peels. Int. J. Biol. Macromol. 2019, 137, 657–665. [Google Scholar] [CrossRef] [Scilit]
- Park, H.R.; Hwang, D.; Suh, H.J.; Yu, K.W.; Kim, T.Y.; Shin, K.S. Antitumor and antimetastatic activities of rhamnogalacturonan-II-type polysaccharide isolated from mature leaves of green tea via activation of macrophages and natural killer cells. Int. J. Biol. Macromol. 2017, 99, 179–186. [Google Scholar] [CrossRef] [Scilit]
- Liu, S.; Zhuang, X.; Zhang, X.; Han, W.; Liu, Y.; Sun, D.; Guo, W. Enzymatic modification of rice bran polysaccharides by enzymes from Grifola frondosa: Natural killer cell cytotoxicity and antioxidant activity. J. Food Sci. 2018, 83, 1948–1955. [Google Scholar] [CrossRef] [Scilit]
- Bi, S.; Jing, Y.; Zhou, Q.; Hu, X.; Zhu, J.; Guo, Z.; Song, L.; Yu, R. Structural elucidation and immunostimulatory activity of a new polysaccharide from Cordyceps militaris. Food Funct. 2018, 9, 279–293. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.Y.; Park, C.W.; Lee, S.J.; Park, H.R.; Kim, S.H.; Son, S.U.; Park, J.; Shin, K.S. Anti-cancer effects of Panax ginseng berry polysaccharides via activation of immune-related cells. Front. Pharmacol. 2019, 10, 1411. [Google Scholar] [CrossRef] [Scilit]
- Kwak, B.S.; Hwang, D.; Lee, S.J.; Choi, H.J.; Park, H.Y.; Shin, K.S. Rhamnogalacturonan-I-Type polysaccharide purified from broccoli exerts anti-metastatic activities via innate immune cell activation. J. Med. Food 2019, 22, 451–459. [Google Scholar] [CrossRef] [Scilit]
- Grudzien, M.; Rapak, A. Effect of natural compounds on NK cell activation. J. Immunol. Res. 2018, 2018, 4868417. [Google Scholar] [CrossRef] [Scilit]
- Huang, L.; Shen, M.; Morris, G.A.; Xie, J. Sulfated polysaccharides: Immunomodulation and signaling mechanisms. Trends Food Sci. Technol. 2019, 92, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Bryceson, Y.T.; Chiang, S.C.; Darmanin, S.; Fauriat, C.; Schlums, H.; Theorell, J.; Wood, S.M. Molecular mechanisms of natural killer cell activation. J. Innate Immun. 2011, 3, 216–226. [Google Scholar] [CrossRef] [Scilit]
- Oh, S.C.; Kim, S.E.; Jang, I.H.; Kim, S.M.; Lee, S.Y.; Lee, S.; Chu, I.S.; Yoon, S.R.; Jung, H.; Choi, I.; et al. NgR1 is an NK cell inhibitory receptor that destabilizes the immunological synapse. Nat. Immunol. 2023, 24, 463–473. [Google Scholar] [CrossRef] [Scilit]
- Perussia, B. Lymphokine-activated killer cells, natural killer cells and cytokines. Curr. Opin. Immunol. 1991, 3, 49–55. [Google Scholar] [CrossRef] [Scilit]
- Surayot, U.; You, S.G. Structural effects of sulfated polysaccharides from Codium fragile on NK cell activation and cytotoxicity. Int. J. Biol. Macromol. 2017, 98, 117–124. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Liu, G.; Wei, P.; Tang, Y.; Pang, Y.; Sun, J.; Li, J.; Rao, C.; Wu, C.; He, X.; Li, L.; et al. Evaluation of bioactive compounds and bioactivities in plum (Prunus salicina Lindl.) wine. Front. Nutr. 2021, 8, 766415. [Google Scholar] [CrossRef] [Scilit]
- Xiong, C.; Li, P.; Luo, Q.; Yan, J.; Zhang, J.; Jin, X.; Huang, W. Effect of γ-irradiation on the structure and antioxidant activity of polysaccharide isolated from the fruiting bodies of Morchella sextelata. Biosci. Rep. 2020, 40, BSR20194522. [Google Scholar] [CrossRef] [Scilit]
- Kou, F.; Ge, Y.; Wang, W.; Mei, Y.; Cao, L.; Wei, X.; Xiao, H.; Wu, X. A review of Ganoderma lucidum polysaccharides: Health benefit, structure–activity relationship, modification, and nanoparticle encapsulation. Int. J. Biol. Macromol. 2023, 243, 125199. [Google Scholar] [CrossRef] [Scilit]
- Huo, J.; Wu, J.; Huang, M.; Zhao, M.; Sun, W.; Sun, X.; Zheng, F. Structural characterization and immuno-stimulating activities of a novel polysaccharide from Huangshui, a byproduct of Chinese Baijiu. Food Res. Int. 2020, 136, 109493. [Google Scholar] [CrossRef] [Scilit]
- Mirzaie, S.; Tabarsa, M.; Safavi, M. Effects of extracted polysaccharides from a Chlorella vulgaris biomass on expression of interferon-γ and interleukin-2 in chicken peripheral blood mononuclear cells. J. Appl. Phycol. 2021, 33, 409–418. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Wang, L.; Zhang, C.; Wang, H.; Zhang, X.; Li, Y. Structure characterization and antitumor activity of a polysaccharide from the alkaline extract of king oyster mushroom. Carbohydr. Polym. 2015, 118, 101–106. [Google Scholar] [CrossRef] [Scilit]
- Yang, T.; Jia, M.; Meng, J.; Wu, H.; Mei, Q. Immunomodulatory activity of polysaccharide isolated from Angelica sinensis. Int. J. Biol. Macromol. 2006, 39, 179–184. [Google Scholar] [CrossRef] [Scilit]
- Zhou, G.; Sun, Y.; Xin, H.; Zhang, Y.; Li, Z.; Xu, Z. In vivo antitumor and immunomodulation activities of different molecular weight lambda-carrageenans from Chondrus ocellatus. Pharmacol. Res. 2004, 50, 47–53. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Recalde, M.; Matulewicz, M.C.; Pujol, C.A.; Carlucci, M.J. In vitro and in vivo immunomodulatory activity of sulfated polysaccharides from red seaweed Nemalion helminthoides. Int. J. Biol. Macromol. 2014, 63, 38–42. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Jiao, G.; Yang, Y.; Li, M.; Li, Q.; Wang, X.; Cai, C.; Li, G.; Hao, J.; Yu, G. Structure and immunomodulatory activity of a sulfated agarose with pyruvate and xylose substitutes from Polysiphonia senticulosa Harvey. Carbohydr. Polym. 2017, 176, 29–37. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Zhu, P.; Zhao, S.; Nie, C.; Wang, N.; Du, X.; Zhou, Y. Characterization, antioxidant activity and immunomodulatory activity of polysaccharides from the swollen culms of Zizania latifolia. Int. J. Biol. Macromol. 2017, 95, 809–817. [Google Scholar] [CrossRef] [Scilit]
- Ma, F.; Zhang, Y.; Yao, Y.; Wen, Y.; Hu, W.; Zhang, J.; Liu, X.; Bell, A.E.; Tikkanen-Kaukanen, C. Chemical components and emulsification properties of mucilage from Dioscorea opposita Thunb. Food Chem. 2017, 228, 315–322. [Google Scholar] [CrossRef] [Scilit]
- Huang, F.; Liu, Y.; Zhang, R.; Dong, L.; Yi, Y.; Deng, Y.; Wei, Z.; Wang, G.; Zhang, M. Chemical and rheological properties of polysaccharides from litchi pulp. Int. J. Biol. Macromol. 2018, 112, 968–975. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Hu, Y.; Duan, X.; Tang, T.; Shen, Y.; Hu, B.; Liu, A.; Chen, H.; Li, C.; Liu, Y. Characterization and antioxidant activities of polysaccharides from thirteen boletus mushrooms. Int. J. Biol. Macromol. 2018, 113, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Z.; Deng, Q.; Zhou, W.; Zhang, Y. Immune activities of polysaccharides isolated from Lycium barbarum L. What do we know so far? Pharmacol. Ther. 2022, 229, 107921. [Google Scholar] [CrossRef] [Scilit]
- Liu, G.; Sun, J.; He, X.; Tang, Y.; Li, J.; Ling, D.; Li, C.; Li, L.; Zheng, F.; Sheng, J.; et al. Fermentation process optimization and chemical constituent analysis on longan (Dimocarpus longan Lour.) wine. Food Chem. 2018, 256, 268–279. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Zhao, J.; Liu, G.; Li, Y.; Liang, L.; Liu, X.; Xu, X.; Wen, C. Advance in Morchella sp. polysaccharides: Isolation, structural characterization and structure-activity relationship: A review. Int. J. Biol. Macromol. 2023, 247, 125819. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Zhang, Z.H.; Qi, X.; Li, L.; Zhu, J.; Brennan, C.S.; Yan, J.K. Application of nonthermal processing technologies in extracting and modifying polysaccharides: A critical review. Compr. Rev. Food Sci. Food Saf. 2021, 20, 4367–4389. [Google Scholar] [CrossRef] [Scilit]
- Leong, Y.K.; Yang, F.C.; Chang, J.S. Extraction of polysaccharides from edible mushrooms: Emerging technologies and recent advances. Carbohydr. Polym. 2021, 251, 117006. [Google Scholar] [CrossRef] [Scilit]
- Huyan, T.; Li, Q.; Yang, H.; Jin, M.L.; Zhang, M.J.; Ye, L.J.; Li, J.; Huang, Q.S.; Yin, D.C. Protective effect of polysaccharides on simulated microgravity-induced functional inhibition of human NK cells. Carbohydr. Polym. 2014, 101, 819–827. [Google Scholar] [CrossRef] [Scilit]
- Vetvicka, V.; Thornton, B.P.; Ross, G.D. Soluble β-glucan polysaccharide binding to the lectin site of neutrophil or natural killer cell complement receptor type 3 (CD11b/CD18) generates a primed state of the receptor capable of mediating cytotoxicity of iC3b-opsonized target cells. J. Clin. Investig. 1996, 98, 50–61. [Google Scholar] [CrossRef] [Scilit]
- Wu, L.; Zhao, J.; Zhang, X.; Liu, S.; Zhao, C. Antitumor effect of soluble β-glucan as an immune stimulant. Int. J. Biol. Macromol. 2021, 179, 116–124. [Google Scholar] [CrossRef] [Scilit]
- Ishikawa, M.; Hashimoto, Y. Improvement in aqueous solubility in small molecule drug discovery programs by disruption of molecular planarity and symmetry. J. Med. Chem. 2011, 54, 1539–1554. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Tang, D.; Wei, R.; Zhao, S.; Mu, W.; Qiang, S.; Zhang, Z.; Chen, Y. Polysaccharides production from soybean curd residue via Morchella esculenta. J. Food Biochem. 2019, 43, e12791. [Google Scholar] [CrossRef] [Scilit]
- Spector, P.E.; Fox, S.; Penney, L.M.; Bruursema, K.; Goh, A.; Kessler, S. The dimensionality of counterproductivity: Are all counterproductive behaviors created equal? J. Vocat. Behav. 2006, 68, 446–460. [Google Scholar] [CrossRef] [Scilit]







| Gene | Sequences of the Primers | Product Size (bp) |
|---|---|---|
| GAPDH | Forward: GAGTCCACTGGCGTCTTCAC Reverse: TGCTGATGATCTTGAGGCTGTT | 157 |
| Perforin | Forward: GACTGCCTGACTGTCGAGG Reverse: TCCCGGTAGGTTTGGTGGAA | 128 |
| Granzyme B | Forward: CCCTGGGAAAACACTCACACA Reverse: GCACAACTCAATGGTACTGTCG | 110 |
| IFN-γ | Forward: TCGGTAACTGACTTGAATGTCCA Reverse: TCGCTTCCCTGTTTTAGCTGC | 93 |
| Molecular Weight (kDa) | Named as | Proportion (%) |
|---|---|---|
| 3–5 | OP1 | 1.05 ± 0.08 |
| 5–10 | OP2 | 2.56 ± 0.19 |
| 10–30 | OP3 | 3.38 ± 0.21 |
| 30–50 | OP4 | 8.82 ± 0.50 |
| 50–70 | OP5 | 3.93 ± 0.29 |
| 70–100 | OP6 | 9.64 ± 0.56 |
| 100–300 | OP7 | 6.55 ± 0.43 |
| 300–500 | OP8 | 10.25 ± 0.87 |
| 500–1000 | OP9 | 5.41 ± 0.38 |
| >1000 | OP10 | 48.41 ± 1.88 |
| Total | 100.00 | |
| Polysaccharide | NK-92MI Cell Activity | ||||
|---|---|---|---|---|---|
| Proliferation (%) | Perforin | Granzyme B | IFN-γ | Calu-1 Cell Viability (%) | |
| OP1 (3–5 kDa) | 143.36 ± 0.81 | 0.63 ± 0.10 | 0.85 ± 0.08 | 5.19 ± 0.20 | 93.55 ± 4.00 |
| OP2 (5–10 kDa) | 151.04 ± 2.23 | 3.75 ± 0.21 | 1.50 ± 0.10 | 3.41 ± 0.35 | 88.54 ± 6.60 |
| OP3 (10–30 kDa) | 128.25 ± 1.00 | 1.52 ± 0.06 | 0.68 ± 0.07 | 3.91 ± 0.20 | 96.53 ± 4.98 |
| OP4 (30–50 kDa) | 150.44 ± 3.36 | 3.17 ± 0.47 | 0.58 ± 0.03 | 5.80 ± 0.27 | 92.78 ± 8.88 |
| OP5 (50–70 kDa) | 145.09 ± 0.17 | 4.07 ± 0.34 | 1.32 ± 0.08 | 7.40 ± 0.33 | 83.94 ± 4.14 |
| OP6 (70–100 kDa) | 136.56 ± 0.59 | 1.25 ± 0.13 | 0.88 ± 0.07 | 2.51 ± 0.20 | 98.42 ± 8.05 |
| OP7 (100–300 kDa) | 148.20 ± 0.48 | 0.49 ± 0.03 | 0.80 ± 0.07 | 1.51 ± 0.15 | 100.63 ± 5.98 |
| OP8 (300–500 kDa) | 157.16 ± 1.05 | 0.24 ± 0.03 | 0.60 ± 0.07 | 0.84 ± 0.08 | 109.45 ± 9.68 |
| OP9 (500–1000 kDa) | 160.40 ± 0.96 | 0.41 ± 0.05 | 0.85 ± 0.09 | 1.07 ± 0.03 | 102.55 ± 10.02 |
| OP10 (>1000 kDa) | 125.03 ± 1.52 | 1.04 ± 0.08 | 0.99 ± 0.08 | 0.97 ± 0.09 | 101.11 ± 6.11 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, G.; Wei, P.; Tang, Y.; Li, J.; Yi, P.; Deng, Z.; He, X.; Ling, D.; Sun, J.; Zhang, L. Screening and Characteristics Analysis of Polysaccharides from Orah Mandarin (Citrus reticulata cv. Orah). Foods 2024, 13, 82. https://doi.org/10.3390/foods13010082
Liu G, Wei P, Tang Y, Li J, Yi P, Deng Z, He X, Ling D, Sun J, Zhang L. Screening and Characteristics Analysis of Polysaccharides from Orah Mandarin (Citrus reticulata cv. Orah). Foods. 2024; 13(1):82. https://doi.org/10.3390/foods13010082
Chicago/Turabian StyleLiu, Guoming, Ping Wei, Yayuan Tang, Jiemin Li, Ping Yi, Zhonglin Deng, Xuemei He, Dongning Ling, Jian Sun, and Lan Zhang. 2024. "Screening and Characteristics Analysis of Polysaccharides from Orah Mandarin (Citrus reticulata cv. Orah)" Foods 13, no. 1: 82. https://doi.org/10.3390/foods13010082
APA StyleLiu, G., Wei, P., Tang, Y., Li, J., Yi, P., Deng, Z., He, X., Ling, D., Sun, J., & Zhang, L. (2024). Screening and Characteristics Analysis of Polysaccharides from Orah Mandarin (Citrus reticulata cv. Orah). Foods, 13(1), 82. https://doi.org/10.3390/foods13010082

