Next Article in Journal
Influence of Supercritical Carbon Dioxide on the Activity and Conformational Changes of α-Amylase, Lipase, and Peroxidase in the Solid State Using White Wheat Flour as an Example
Previous Article in Journal
Utilization of Hyperspectral Imaging with Chemometrics to Assess Beef Maturity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a Gene-Based Soybean-Origin Discrimination Method Using Allele-Specific Polymerase Chain Reaction

1
Experiment & Research Institute, National Agricultural Products Quality Management Service, Gimcheon 39660, Republic of Korea
2
Division of Animal, Horticultural and Food Sciences, Graduate School of Chungbuk National University, Cheongju 28644, Republic of Korea
3
National Institute of Crop Science, Rural Development Administration, Suwon 16429, Republic of Korea
*
Authors to whom correspondence should be addressed.
Foods 2023, 12(24), 4497; https://doi.org/10.3390/foods12244497
Submission received: 25 October 2023 / Revised: 7 December 2023 / Accepted: 11 December 2023 / Published: 16 December 2023
(This article belongs to the Section Food Analytical Methods)

Abstract

:
A low soybean self-sufficiency rate in South Korea has caused a high import dependence and considerable price variation between domestic and foreign soybeans, causing the false labeling of foreign soybeans as domestic. Conventional soybean origin discrimination methods prevent a single-grain analysis and rely on the presence or absence of several compounds or concentration differences. This limits the origin discrimination of mixed samples, demonstrating the need for a method that analyzes individual grains. Therefore, we developed a method for origin discrimination using genetic analysis. The whole-genome sequencing data of the Williams 82 reference cultivar and 15 soybean varieties cultivated in South Korea were analyzed to identify the dense variation blocks (dVBs) with a high single-nucleotide polymorphism density. The PCR primers were prepared and validated for the insertion–deletion (InDel) sequences of the dVBs to discriminate each soybean variety. Our method effectively discriminated domestic and foreign soybean varieties, eliminating their false labeling.

1. Introduction

Soybean is an important food ingredient and a primary source of nutrients worldwide, with an abundance of isoflavones, carbohydrates, fats, and proteins. Soybean has been utilized mainly in the production of vegetable oil and as an ingredient in fermented foods, such as soybean paste, soy sauce, red pepper paste, fermented soybean paste, and fermented whole soybean. It has also been consumed in the form of processed foods, including soybean milk and soybean curd. Owing to its enrichment with the essential amino acid lysine, soybean is the main protein source in countries that consume rice as a staple food [1].
The soybean self-sufficiency rate in South Korea is ≤30%, resulting in a high import rate. The main producers of soybeans are the United States of America (U.S.), Brazil, Argentina, India, and China. Thus, South Korea primarily imports soybeans from the U.S., Canada, and China. The wholesale price of imported soybeans is considerably low, at 25% of the price of domestic soybeans [2].
Owing to the substantial price difference between domestic and imported soybeans, sellers might falsely label the country of origin to earn unfair profits. In 2022, the National Agricultural Products Quality Management Service (NAQS) in South Korea announced that soybean curd ranked sixth and soybean ranked seventh among the 156 items violating the Act on Origin Labeling of Agricultural and Fishery Products [3].
The origin of soybean is currently discriminated based on the difference in inorganic compounds using energy dispersive X-ray fluorescence spectrometry (ED-XRF). Furthermore, the absorbance difference across organic compounds is determined using Fourier transform near-infrared spectroscopy (FT-NIRS) [4,5,6]. The conventional physicochemical method of analysis enables a markedly simple and rapid analysis that requires no pretreatment besides the grinding of samples. However, a single grain of soybean cannot be analyzed. Additionally, the minimum sample mass required for analysis is 5–50 g. These limitations could pose difficulties in the origin discrimination of mixed samples.
Extensive research has been conducted to distinguish growing plant varieties through morphological classification. Experts in origin determination have traditionally relied on distinguishing varieties based on seed shape, gloss, and color. However, a challenge arises as results tend to vary depending on the evaluator’s level of expertise and experience. To address this issue, the field has turned to DNA molecular marker technology for breed identification [7].
The most frequently used method in soybean variety analysis is the simple sequence repeat (SSR), or microsatellite, approach used to establish barcode systems. However, this method requires expensive equipment such as a DNA sequencer or chip electrophoresis and a large number of markers, making it difficult to adopt as a general laboratory method [8,9]. The second most used PCR method is the cleaved amplified polymorphic sequence (CAPS) with a single-nucleotide polymorphisms (SNPs) approach. This method is time-consuming owing to the involvement of restriction enzymes in addition to PCR [10]. Recently, insertion–deletion (InDel) markers have achieved high reproducibility and are recognized as efficient molecular markers for distinguishing cultivars based on codominance [11]. In particular, these markers are attracting attention from researchers because they are relatively simple compared to other molecular markers. Soybeans possess 20 chromosomes with a known genome euchromatic DNA size of 705 Mb. These chromosomes are categorized into sVB (sparse variation block), characterized by the absence of chromosomal mutation, and dVB (dense variation block), which occurs infrequently. Notably, studies have indicated the presence of dVB within 100 kb of the chromosome, and that genetic recombination does not occur often during the breeding process compared to the linkage disequilibrium block of 90–574 kb in soybean varieties [12]. In a previous study, a method was proposed to differentiate between dVB and sVB, focusing on the identification of InDel markers within dVB to develop soybean variety identification methods [13,14]. Some studies have proposed a DNA barcode method for discriminating 147 soybean varieties using the genomic DNA extracted from soybean leaves by using a selected set of InDel markers of dense variation blocks (dVB). However, this method focuses on domestic soybean varieties, and there is a limitation in identifying genetic diversity patterns of the imported varieties [15]. Therefore, this study aimed to utilize genetic analysis to discriminate the varieties of soybean cultivated in South Korea. Unlike the physicochemical analysis techniques known to date, the gene-based analysis technology developed in this study can analyze each individual grain, thereby ensuring a high identification accuracy. Therefore, it is likely that a quantitative analysis will be able to identify the origin of mixed samples. The proposed origin discrimination table could eliminate the false labeling of foreign soybean varieties as domestic ones, thereby reducing unethical price markups by sellers.

2. Materials and Methods

2.1. Sample Collection

The 16 soybean varieties used as standard samples (15 Korean varieties and 1 American variety) were obtained from the Rural Development Administration. A total of 1096 samples (630 domestic and 466 imported) were collected from soybean farms, ports of entry, and large distributors between 2019 and 2021. The collected samples were used to construct the origin judgment value database. Furthermore, 60 soybean samples (30 domestic and 30 imported) were collected in 2022 to validate the origin discrimination table. The 30 domestic soybeans were obtained from 27 farms and local food markets nationwide. In addition, the imported soybeans included 11, 10, 4, 3, and 2 from the U.S., China, Canada, Thailand, and Vietnam, respectively. The collected samples were stored in a −20 °C freezer.

2.2. Genomic DNA Extraction

For DNA extraction from embryos of collected soybean samples, we used the Magnetic Bead System of an automatic nucleic acid extraction device (Hamilton Microlab Star®, Hamilton Co., Reno, NV, USA). The NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) was used to measure the concentration and purity of the extracted genomic DNA. Finally, the purity was validated at 260/230 nm and 260/280 nm before PCR analysis to ensure that it fell within the range of 1.8–2.0.

2.3. Selection of Test Varieties and Molecular Markers

The complete whole-genome sequencing data of the soybean Williams 82 cultivar reference genome and those of the 15 known domestic varieties (Daewon, Taekwang, Pungsannamul, Seonyu, Daepung, Sinhwa, Hwangkeum, Nampung, Cheonsang, Uram, Hwangkeumol, Saedanbaek, Pungwon, Cheongja1, and Cheongja3) were analyzed to compare dVB with a high SNP density. Based on the result, 11 InDel markers were selected to identify 16 standard samples.

2.4. Primer Preparation and PCR Analysis

The 11 selected InDel markers were used to prepare the primers via allele-specific PCR to allow for easy differentiation based on the state of PCR amplification (Figure 1). For the PCR mixture, 40 ng of genomic DNA, 0.2 pmol of primer, and 10 μL of anti-HS Taq Premix (2× reaction buffer, 4 mM MgCl2, 0.5 mM dNTP, and 1 unit of Anti HS Taq DNA polymerase (TNT Research, Jeonju-si, South Korea)) were used to perform 10 min pre-denaturation at 94 °C, 30 s denaturation at 94 °C, 30 s annealing at 56 °C, and 10 min extension at 72 °C. The PCR reaction was terminated at 4 °C. Afterward, the amplified PCR product was loaded to 3% agarose gel with GoldView (SBS Genentech, Beijing, China) for 30 min electrophoresis at 200 V. The PCR product was confirmed using ultraviolet light. Furthermore, confirmation of the PCR product was carried out through QIAxcel electrophoresis (QIAGEN, Hilden, Germany).

2.5. Determination of Judgment Values

Marker 1 is a specific marker for soybean’s endogenous genes, enabling the determination of whether the analyzed sample is soybean or not. In essence, successful amplification in PCR is essential for discerning the origin of soybeans. Therefore, marker 1 was exceptionally assigned a score of 1. Subsequently, markers 2 to 11 were scored as 2n with each marker obtaining the following points through allele-specific PCR amplification: marker 2 (2 points), marker 3 (4 points), marker 4 (8 points), marker 5 (16 points), marker 6 (32 points), marker 7 (64 points), marker 8 (128 points), marker 9 (256 points), marker 10 (512 points), and marker 11 (1024 points). The cumulative sum of scores from all amplified markers was then calculated to determine the overall judgment value. The calculated scores using 11 markers could theoretically allow for the genetic diversity pattern discrimination of 2048 species based on judgment values. After checking the genetic polymorphism of the 16 standard samples, 1096 collected soybean samples were used to generate the origin discrimination tables.

2.6. Validation of the Origin Discrimination Table

The origin discrimination formula was validated based on judgment values using the 11 markers applied to 30 domestic and 30 imported soybeans. For the discrimination formula, the sensitivity, selectivity, and efficiency were estimated through qualitative analysis [16,17].
S e n s i t i v i t y = T D T D   +   F D × 100
S e l e c t i v i t y = T F T F   +   F F × 100
E f f i c i e n c y = T D   +   T F T D   +   F D   +   T E   +   F F × 100
True Domestic Product (TD) indicates a domestic sample identified as domestic based on the discrimination result. False Domestic Product (FD) indicates an imported sample identified as domestic based on the discrimination result. True Foreign Product (TF) indicates an imported sample identified as foreign based on the discrimination result. False Foreign Product (FF) indicates a domestic sample identified as foreign based on the discrimination result. Sensitivity indicates the level at which the discrimination table can correctly identify a domestic sample. Similarly, selectivity indicates the level at which the discrimination table can correctly identify a foreign sample. To evaluate the prediction performance of the established discrimination table, the judgment values of the tested samples were applied to the table. The percentage of the discrimination of domestic samples as domestic was set as the domestic predictive rate and that of the discrimination of foreign samples as foreign was set as the foreign predictive rate.

3. Results and Discussion

3.1. Validation of the Selected Molecular Markers

Seventeen molecular markers were selected from the InDel region of dVB that was predicted to enable the identification of the 16 soybean varieties of standard samples through biodata analyses. The PCR amplification of the selected markers was checked against the Williams 82 reference. However, certain markers led to nonspecific reaction products unable to be used in allele-specific PCR, which relies on the presence or absence of PCR-amplified products for molecular markers. Ultimately, 11 molecular markers capable of allele-specific PCR were selected through verification, and these were used in tests to determine the origin discrimination (Table 1).

3.2. Multiplex Allele-Specific PCR Analysis

In previous studies, the interpretation of results obtained via PCR was complicated as both the presence or absence of amplification of the InDel marker and the size difference in the PCR amplification products were considered. In this study, the allele-specific PCR including the InDel sequences allowed for an intuitive result interpretation based on the state of PCR amplification. Although the results can be confirmed more easily than with existing analysis methods, it still takes much time and labor to confirm the origin of one sample because, to do this, PCR must be performed on 24 single soybean grains and confirmed via electrophoresis. To solve this problem, we set up six groups of 11 markers to enable multiplex PCR. To validate the feasibility of allele-specific PCR for InDel markers 1 to 11 at a single annealing temperature, amplification was assessed across a temperature range of 46 to 60 °C. Among these temperatures, we found that only the target product was amplified at 56 °C, without any non-specific PCR products (Figure 2). We attempted to confirm 11 InDel markers via a single multiplex PCR; however, because of the size of the amplified product and non-specific reaction, we optimized a total of six groups (Figure 3). Accordingly, we were able to significantly reduce the time to determine the geographical origin through multiplex allele-specific PCR.

3.3. Determination of Judgment Values for Standard and Test Samples

Because a minimum sample of 24 single grains is required for 95% reliability, 200 g of the collected sample was evenly distributed with a grain spreader, and 24 single grains were ultimately sampled [18]. After DNA extraction, multiplex PCR analysis was performed on the samples using the 11 InDel markers that were assigned unique scores. Then, the scores given to the amplified markers were calculated to confirm the judgment values.
First, we confirmed, through analysis, whether the 16 standard samples were clearly identified. Among the 16 varieties (15 domestic and 1 imported), 14 varieties (13 domestic and 1 imported) could be discriminated (Table 2). The two domestic varieties that could not be discriminated were Seonyu and Hwangkeumol, which shared an identical judgment value (655).
Second, to set the judgment value for a variety of soybean samples, 1096 soybean samples were collected to include the domestic soybeans cultivated in South Korea, those imported through the port of entry, and the foreign soybeans currently being distributed. As a result, domestic and imported soybean varieties could be classified based on 53 and 70 judgment values, respectively (Table 3 and Table 4). These varieties had four overlapping judgment values (671; 1183; 1215; and 1695) that prevented origin discrimination across the corresponding domestic and imported soybeans.
The aim of this study was to discriminate the origin of soybeans based on the variation of judgment values between domestic and imported varieties rather than accurately identify the variety of soybeans. For the two domestic varieties that could not be discriminated in the standard samples, the judgment value (655) did not overlap with the judgment values of imported soybeans. The four judgment values that were the same for domestic and foreign products accounted for approximately 3.4% of the total judgment values, and the samples for which judgment was impossible accounted for approximately 5% of the total sample. However, if foreign varieties (1215) with the same judgment value as Pungsannamul (domestic varieties) are excluded because they have obvious morphological differences (Figure 4), the rate of the inability to make a judgment decreases from approximately 3.4% of the total judgment value to approximately 2.5%. Therefore, the proportion of samples that could not be determined can be reduced from approximately 5% to approximately 3.2%.

3.4. Validation of the Origin Discrimination Table

In previous studies that used methods of inorganic content analysis, such as inductively coupled plasma-mass spectrometry or ED-XRF, the reported efficiency was 91.0–94.0%. Moreover, various statistical techniques were applied based on the concentration of 4–8 types of inorganic compounds [19,20,21]. Lee et al. [5] utilized FT-NIRS, a method of organic content analysis. The reported efficiency was 96.1–96.5% based on the difference in the absorbance spectra of organic compounds using the NIR. Through the gene-based analysis in this study, 595 out of 630 domestic samples were predicted as being domestic, with 94.4% sensitivity. In addition, 446 out of 466 imported samples were predicted as being foreign, with 95.7% selectivity. Finally, the efficiency of the origin discrimination table was 95.0%. Conversely, in the analysis based on 10 markers (marker 1–10), 506 of 630 domestic samples were predicted to be domestic, achieving a sensitivity of 80.3%. In addition, 411 of 466 imported samples were predicted to be foreign, demonstrating a selectivity of 88.2%. However, the overall efficiency of the origin discrimination table was 83.7%, and a significant reduction was observed when compared to the analysis with 11 markers. Thus, the analytical method developed in this study exhibited a similar level of efficiency to conventional physicochemical analyses (95.0% vs. 91.0–96.5%) (Table 5).
To determine the practicality of the origin discrimination table proposed in this study, soybean samples from 2019 to 2022, with accurately identified origins, were collected, and their judgment values were applied to the discrimination table.
The judgment values calculated using the 11 InDel markers selected for 30 domestic and 30 imported soybeans were applied to the discrimination table. As shown in Table 6, 29 out of 30 domestic soybeans were discriminated as domestic, showing a 96.7% domestic predictive rate. Furthermore, all 30 imported soybeans were discriminated as foreign, demonstrating a 100.0% foreign predictive rate. Substantially high levels of domestic and foreign predictive rates were obtained at 98.3% on average for the discrimination table using 11 gene-based markers. These results suggest that the discrimination table can effectively discriminate between domestic and imported soybean varieties despite the slightly low level of domestic soybean discrimination caused by a low sensitivity (94.4%) and domestic predictive rate (96.7%) compared to the selectivity (95.7%) and foreign predictive rate (100.0%).
The conventional physicochemical analyses of organic and inorganic compounds for soybean origin discrimination are classification methods for variation in cultivation conditions using statistical techniques. As such, the predictive rate and efficiency may vary [22,23,24]. By contrast, gene-based analyses are independent of compositional changes depending on the cultivation conditions. Soybeans that have been developed to adapt to the climate and pests of each country are known to be unable to be grown successfully in other countries. In particular, the production areas of soybeans imported into Korea are limited to some areas, and these areas have different latitudes and longitudes, compared to Korea. Therefore, it is highly unlikely that imported soybeans can be grown domestically. Therefore, it has been possible to accurately determine the country of origin by utilizing the unique genetic characteristics of soybean varieties.

4. Conclusions

In Korea, the price difference of soybeans is 3–5 times more or less than other countries, depending on the soybean origin. Due to the large price difference between domestic and imported soybeans, there is a good possibility that sellers will misrepresent the country of origin of the soybeans. Currently, the origin of soybeans is identified using physicochemical analysis methods such as NIR and XRF to prevent origin misrepresentation; however, because existing physicochemical methods involve the crushing and testing of large amounts of samples, there is a limitation to the extent to which the country of origin can be identified when domestic and imported soybeans are mixed. Consequently, sellers are taking advantage of this limitation and selling a mixture of soybeans from different origins. Therefore, we developed a gene-based analysis method that can identify the country of origin of soybeans on a grain-by-grain basis. In summary, the country-of-origin identification method developed with 11 InDel markers showed an efficiency of 95%, and the validation process of the country-of-origin identification table showed a prediction rate of 98.3%, confirming that the country-of-origin identification at the grain level has a high accuracy. Based on these results, the method developed in this study can be applied to identify the origin of soybeans, and, if combined with existing physicochemical methods, it is expected to prevent illegal acts including the misrepresentation of origin with a higher accuracy.
Furthermore, genetically modified soybeans with herbicide resistance are currently cultivated in several countries, and the use of herbicides, such as glyphosate, saflufenacil, and carfentrazone-ethyl, is rapidly increasing. Conversely, in Korea, the cultivation of genetically modified soybeans is prohibited, and the unintentional tolerance level is maintained below 3%. Therefore, by confirming the country of origin, it is possible to prevent the domestic distribution of genetically modified soybeans and mitigate exposure to harmful substances, such as herbicides [25,26].
Moreover, the genetics-based method for determining the origin of soybeans developed in this study can be applied in quality management during the food manufacturing process. In particular, it is expected to be applicable to intermediate stages (meju) or final products (soybean paste, natto, doenjang, gochujang, etc.) of fermented foods using soybeans.

Author Contributions

Conceptualization, Y.-H.K. and H.-M.P.; Methodology, N.-K.K.; Validation, M.-J.K.; Formal Analysis, B.-Y.K.; Investigation, J.K.; Writing—Original Draft Preparation, K.-C.J.; Supervision, H.-C.S. and T.-J.K.; Project Administration, H.-S.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Agricultural Products Quality Management Service, grant number NAQS-Origin-08.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflict of interest. The funder had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Kudełka, W.; Kowalska, M.; Popis, M. Quality of soybean products in terms of essential amino acids composition. Molecules 2021, 26, 5071. [Google Scholar] [CrossRef] [PubMed]
  2. Trade Statistics. Available online: https://stat.kita.net (accessed on 29 December 2022).
  3. NAQS (National Agricultural Products Quality Management Service). 2022 Annual Report. 11-1543145-000037-10; National Agricultural Products Quality Management Service: Gimcheon, Republic of Korea, 2022. [Google Scholar]
  4. Lee, J.-H.; Kang, D.-J.; Jang, E.-H.; Hur, S.-H.; Shin, B.-K.; Han, G.-T.; Lee, S.-H. Discrimination of geographical origin for soybean using ED-XRF. Korean J. Food Sci. Technol. 2020, 52, 125–129. [Google Scholar]
  5. Lee, J.H.; An, J.M.; Kim, H.J.; Shin, H.C.; Hur, S.H.; Lee, S.H. Rapid discrimination of the country origin of soybeans based on FT-NIR spectroscopy and data expansion. Food Anal. Methods 2022, 15, 3322–3333. [Google Scholar] [CrossRef]
  6. Ahn, H.-G.; Kim, Y.-H. Discrimination of Korean domestic and foreign soybeans using near infrared reflectance spectroscopy. Korean J. Crop Sci. 2012, 57, 296–300. [Google Scholar] [CrossRef]
  7. Agarwal, M.; Shrivastava, N.; Padh, H. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Rep. 2008, 27, 617–631. [Google Scholar] [CrossRef] [PubMed]
  8. Sohn, H.B.; Kim, S.J.; Hwang, T.Y.; Park, H.M.; Lee, Y.Y.; Markkandan, K.; Lee, D.; Lee, S.; Hong, S.Y.; Song, Y.H.; et al. Barcode system for genetic identification of soybean [Glycine max (L.) Merrill] cultivars using InDel markers specific to dense variation blocks. Front. Plant Sci. 2017, 8, 520. [Google Scholar] [CrossRef]
  9. Kwon, Y. DNA Fingerprinting analysis for soybean (Glycine max) varieties in Korea using a core set of microsatellite marker. J. Plant Biotechnol. 2016, 43, 457–465. [Google Scholar] [CrossRef]
  10. Tripathi, M.K.; Tripathi, N.; Tiwari, S.; Mishra, N.; Sharma, A.; Tiwari, S.; Singh, S. Identification of Indian soybean (Glycine max [L.] Merr.) genotypes for drought tolerance and genetic diversity analysis using SSR markers. Scientist 2023, 3, 31–46. [Google Scholar]
  11. Hou, X.; Li, L.; Peng, Z.; Wei, B.; Tang, S.; Ding, M.; Liu, J.; Zhang, F.; Zhao, Y.; Gu, H.; et al. A platform of high-density INDEL/CAPS markers for map-based cloning in Arabidopsis. Plant J. 2010, 63, 880–888. [Google Scholar] [CrossRef]
  12. Hyten, D.-L.; Choi, I.-Y.; Song, S.; Shoemaker, R.-C.; Nelson, R.-L.; Costa, J.-M.; Specht, J.-E.; Cregan, P.-B. Highly variable patterns of linkage disequilibrium in multiple soybean populations. Genetics 2007, 175, 1937–1944. [Google Scholar] [CrossRef]
  13. Chun, J.; Jin, M.; Jeong, N.; Cho, C.; Seo, M.-S.; Choi, M.-S.; Kim, D.-Y.; Sohn, H.-B.; Kim, Y.-H. Genetic Identification and Phylogenic Analysis of New Varieties and 149 Korean Cultivars Using 27. InDel markers selected from dense variation blocks in soybean (Glycine max (L.) Merrill). Korean J. Plant Res. 2019, 32, 519–542. [Google Scholar]
  14. Sohn, H.-B.; Song, Y.-H.; Kim, S.-J.; Hong, S.-Y.; Kim, K.-D.; Koo, B.-C.; Kim, Y.-H. Identification and chromosomal reshuffling patterns of soybean cultivars bred in Gangwon-do using 202. InDel markers specific to variation blocks. Korean J. Breed. Sci. 2018, 50, 396–405. [Google Scholar] [CrossRef]
  15. Sohn, H.-B.; Kim, S.-J.; Hwang, T.-Y.; Park, H.-M.; Lee, Y.-Y.; Koo, B.-C.; Kim, Y.-H. Chromosome reshuffling patterns of Korean soybean cultivars using genome-wide 202 InDel markers. Korean J. Breed. Sci. 2017, 49, 213–223. [Google Scholar] [CrossRef]
  16. NATA Technical Note 17. In Guidelines for the Validation and Verification of Quantitative and Qualitative Test Method; National Association of Testing Authorities (NATA): Rhodes, NSW, Australia, 2012.
  17. Pomerantsev, A.L.; Rodionova, O.Y. New trends in qualitative analysis: Performance, optimization, and validation of multi-class and soft models. TrAC Trends Anal. Chem. 2021, 143, 116372. [Google Scholar] [CrossRef]
  18. Kruglyak, L.; Nickerson, D.A. Variation is the spice of life. Nat. Genet. 2001, 27, 234–236. [Google Scholar] [CrossRef] [PubMed]
  19. Nguyen-Quang, T.; Bui-Quang, M.; Truong-Ngoc, M. Rapid identification of geographical origin of commercial soybean marketed in Vietnam by ICP-MS. J. Anal. Methods Chem. 2021, 5583860. [Google Scholar] [CrossRef] [PubMed]
  20. Otaka, A.; Hokura, A.; Nakai, I. Determination of trace elements in soybean by X-ray fluorescence analysis and its application to identification of their production areas. Food Chem. 2014, 147, 318–326. [Google Scholar] [CrossRef] [PubMed]
  21. Kang, D.-J.; Moon, J.-Y.; Lee, D.-G.; Lee, S.-H. Identification of the geographical origin of cheonggukjang by Using Fourier Transform Near-Infrared Spectroscopy and Energy Dispersive X-ray Fluorescence Spectrometry. Korean J. Food Sci. Technol. 2016, 48, 418–423. [Google Scholar] [CrossRef]
  22. Drivelos, S.A.; Georgiou, C.A. Multi-element and Multi-isotope-ratio analysis to Determine the geographical origin of foods in the European Union. TrAC Trends Anal. Chem. 2012, 40, 38–51. [Google Scholar] [CrossRef]
  23. Liu, X.; Zhao, Y.; Qi, P.; Liu, Y.; Li, X.; Deng, W.; Zhang, J.; Sadiq, F.A.; Sang, Y.; Zhang, A. Origin verification of Chinese concentrated apple juice using stable isotopic and mineral elemental fingerprints coupled with chemometrics. J. Food Compos. Anal. 2022, 109, 104424. [Google Scholar] [CrossRef]
  24. Schütz, D.; Riedl, J.; Achten, E.; Fischer, M. Fourier-transform near-infrared spectroscopy as a fast screening tool for the verification of the geographical origin of grain maize (Zea mays L.). Food Control 2022, 136, 108892. [Google Scholar] [CrossRef]
  25. Perry, E.-D.; Ciliberto, F.; Hennessy, D.-A.; Moschini, G. Genetically engineered crops and pesticide use in U.S. maize and soybeans. Sci. Adv. 2016, 2, e1600850. [Google Scholar] [CrossRef] [PubMed]
  26. Won, O.-J.; Hong, S.-Y.; Suh, E.-J.; Park, J.-S.; Lee, H.-S.; Park, J.-K.; Ryu, J.-S.; Han, W.-Y.; Han, K.-S.; Song, D.-Y. Possibility of using non-selective herbicides as desiccants for improving soybean harvest efficiency. Korean J. Crop Sci. 2021, 66, 358–364. [Google Scholar]
Figure 1. Confirmation of genetic patterns using allele-specific polymerase chain reaction (PCR) markers. The letters G, C, and A represent nucleotides.
Figure 1. Confirmation of genetic patterns using allele-specific polymerase chain reaction (PCR) markers. The letters G, C, and A represent nucleotides.
Foods 12 04497 g001
Figure 2. Polymerase chain reaction amplification of 11 markers for soybean origin discrimination. (A) Marker 1 (102 bp), (B) marker 2 (238 bp), (C) marker 3 (473 bp), (D) marker 4 (138 bp), (E) marker 5 (107 bp), (F) marker 6 (459 bp), (G) marker 7 (246 bp), (H) marker 8 (112 bp), (I) marker 9 (324 bp), (J) marker 10 (872 bp), (K) marker 11 (112 bp).
Figure 2. Polymerase chain reaction amplification of 11 markers for soybean origin discrimination. (A) Marker 1 (102 bp), (B) marker 2 (238 bp), (C) marker 3 (473 bp), (D) marker 4 (138 bp), (E) marker 5 (107 bp), (F) marker 6 (459 bp), (G) marker 7 (246 bp), (H) marker 8 (112 bp), (I) marker 9 (324 bp), (J) marker 10 (872 bp), (K) marker 11 (112 bp).
Foods 12 04497 g002
Figure 3. Simultaneous detection performance and specificity of multiplex PCR based on 11 InDel markers for soybean origin identification by (A) agarose gel electrophoresis and (B) capillary electrophoresis. Lane M: (A) 100 bp DNA ladder (ST-M100, TNT Research, Korea), (B) 15 bp to 3 kb DNA ladder (QIAxcel DNA Fast Analysis kit, QIAGEN, Hilden, Germany); lane A: marker 1 (102 bp); lane B: marker 3 (473 bp), marker 4 (138 bp), marker 11 (112 bp); lane C: marker 2 (238 bp), marker 5 (107 bp); lane D: marker 6 (459 bp), marker 7 (246 bp), marker 8 (112 bp); lane E: marker 9 (324 bp); lane F: marker 10 (872 bp).
Figure 3. Simultaneous detection performance and specificity of multiplex PCR based on 11 InDel markers for soybean origin identification by (A) agarose gel electrophoresis and (B) capillary electrophoresis. Lane M: (A) 100 bp DNA ladder (ST-M100, TNT Research, Korea), (B) 15 bp to 3 kb DNA ladder (QIAxcel DNA Fast Analysis kit, QIAGEN, Hilden, Germany); lane A: marker 1 (102 bp); lane B: marker 3 (473 bp), marker 4 (138 bp), marker 11 (112 bp); lane C: marker 2 (238 bp), marker 5 (107 bp); lane D: marker 6 (459 bp), marker 7 (246 bp), marker 8 (112 bp); lane E: marker 9 (324 bp); lane F: marker 10 (872 bp).
Foods 12 04497 g003
Figure 4. Morphological comparison between Pungsannamul and Chinese varieties with an overlapping judgment value (1215). Morphological comparison between (A) Pungsannamul and (B) Chinese varieties with an overlapping judgment value (1215).
Figure 4. Morphological comparison between Pungsannamul and Chinese varieties with an overlapping judgment value (1215). Morphological comparison between (A) Pungsannamul and (B) Chinese varieties with an overlapping judgment value (1215).
Foods 12 04497 g004
Table 1. A list of the eleven allele-specific PCR markers used for the origin discrimination of soybean in this study.
Table 1. A list of the eleven allele-specific PCR markers used for the origin discrimination of soybean in this study.
SetMarkerFinal Primer Conc. (ng/μL)Forward SequenceReverse SequenceSize (bp)
A11.05CCAATATCGATCTTTACCAATTCATAGCATATTAATCAAACATTTTCTAAA102
B30.09TTGGACTGGAGCGTGGAGCCACCCAAATGGTCATTAGCC473
40.35CAGAGCTTCAGTTCTTGACATCAGTCAAAGAAACAAAACATAGGAAGATG138
111.05CGAAATTTTGAAATATACTTGAGAGGAGCAGGTTCTCATGCAAAATG112
C20.18TGAGTGGGTGTGTGTAATAAGTCTTTGATGGGTTGGACGGTCTAT238
51.05CACCCACTCGTTTATCTCGTCGCGTGTTTGGACTTGGATTG107
D61.05TGTATTTGGGACAACTTATTACGTGCGCACATTAAACACATGTGAAC459
70.35CCTTGGTCTTCCACTGCGTTCGTATTGGGGGTTCAAAA246
80.35GGGCATGTCGTCAAGCTTGTCCCACCTACCCGCAAAACGAT112
E90.18TTCTTTCGAGTATTCCCTTTCGTAGGTGCCTTACGAAAGTTATTATAA324
F100.35GCGAATCCAAGACCTAAGTCAGAAACCACTTGGGTGCCTTTA872
Table 2. Assignment of judgment values for 16 standard samples using 11 InDel markers.
Table 2. Assignment of judgment values for 16 standard samples using 11 InDel markers.
No.Marker NameMarker
1
Marker
2
Marker
3
Marker
4
Marker
5
Marker
6
Marker
7
Marker
8
Marker
9
Marker
10
Marker
11
Judgment Value
Score12481632641282565121024
1Daewon124 16 128 51210241687
2Taekwang1 16 256512 785
3Pungsannamul12481632 128 10241215
4Seonyu *1 816 128 512 665
5Daepung1248 3264 512 623
6Sinhwa1 481632 128 189
7Hwangkeum124 1632 128 51210241719
8Nampung12 81632 256512 827
9Cheonsang12 1632 256512 819
10Uram12 816 51210241563
11Hwangkeumol *1 816 128 512 665
12Saedanbaek1 48 128 51210241677
13Pungwon1 4 163264 25651210241909
14Cheongja112 1632 128 10241203
15Cheongja312 16 256512 787
16Williams82124816326412825651210242047
* Standard samples with overlapping judgment values.
Table 3. Discrimination table of domestic soybean using judgment values of 11 markers for soybean origin.
Table 3. Discrimination table of domestic soybean using judgment values of 11 markers for soybean origin.
No.Judgment ValueMarker
1
Marker
2
Marker
3
Marker
4
Marker
5
Marker
6
Marker
7
Marker
8
Marker
9
Marker
10
Marker
11
Duplicate SampleNote
12481632641282565121024
1251 816 9
231124816 1
355124 1632 6
4891 816 64 8
5151124 16 128 14
61571 4816 128 6
71891 481632 128 12Sinhwa
84091 816 128256 4
94251 8 32 128256 1
105291 16 512 45Taekwang
115371 816 512 14
1265912 16 128 512 5
13663124 16 128 512 8
146651 816 128 512 10Hwangkeumol
/Seonyu
1566712 816 128 512 6
166691 4816 128 512 8
17671 *124816 128 512 10
187851 16 256512 4
1978712 16 256512 8Cheongja-3
2081912 1632 256512 27Cheonsang
2182712 81632 256512 16Nampung
228791248 3264 256512 21Daepung
239371 8 32 128256512 11
2493912 8 32 128256512 16
2510411 16 10245
2610451 4 16 10244
271047124 16 10247
2810491 816 102418
2910771 4 1632 10244
301079124 1632 10241
31117112 16 128 10246
321175124 16 128 102424
331183 *124816 128 10248
34120312 1632 128 10243Cheongja1
351207124 1632 128 10248
361215 *12481632 128 102411Pungsannamul
37133912 81632 256 10246
38142712 16 128256 10244
391431124 16 128256 102416
40145912 1632 128256 10242
41146712 81632 128256 10244
42147112481632 128256 102474
43156312 816 512102413Uram
441567124816 51210241
45159512 81632 51210246
4616771 48 128 512102432Saedanbaek
4716811 16 128 51210247
48168312 16 128 51210241
491687124 16 128 512102458Daewon
501695 *124816 128 51210246
511719124 1632 128 512102414Hwangkeum
5219091 4 163264 256512102416Pungwon
53193912 16 12825651210241
* Overlapping judgment values for domestic and foreign soybean varieties.
Table 4. Discrimination table of imported soybeans using judgment values of 11 markers for soybean origin.
Table 4. Discrimination table of imported soybeans using judgment values of 11 markers for soybean origin.
No.Judgment ValueMarker
1
Marker
2
Marker
3
Marker
4
Marker
5
Marker
6
Marker
7
Marker
8
Marker
9
Marker
10
Marker
11
Duplicate SampleNote
12481632641282565121024
12451 4 163264128 3
2247124 163264128 11
32531 48163264128 5
44291 48 32 128256 2
544712481632 128256 8
64931 48 3264128256 6
74951248 3264128256 12
85411 4816 512 2
95731 481632 512 1
106011 816 64 512 3
11671 *124816 128 512 4
127011 481632 128 512 1
1370312481632 128 512 1
147331 4816 64128 512 2
15735124816 64128 512 1
16743124 3264128 512 4
177511248 3264128 512 8
187571 4 163264128 512 1
197651 48163264128 512 6
207671248163264128 512 4
219431248 32 128256512 6
2210231248163264128256512 11
231055124816 10248
24105912 32 10241
2510851 481632 102412
2611651 48 128 10247
27117912 816 128 102421
2811811 4816 128 10248
291183 *124816 128 10246
3011971 48 32 128 102416
311215*12481632 128 10249
3212291 48 64128 10244
3312611 48 3264128 102410
3412631248 3264128 10247
3512771 48163264128 10245
3612791248163264128 102412
37132312 8 32 256 10242
38134312481632 256 10249
39138712 8 3264 256 102414
4014071248163264 256 10248
4114871248 64128256 102418
4215351248163264128256 10244
4315651 4816 512102414
441575124 32 512102412
4515971 481632 51210245
46159912481632 51210241
4716471248 3264 51210244
48169112 816 128 51210243
4916931 4816 128 51210248
501695 *124816 128 51210241
5117091 48 32 128 51210244
5217111248 32 128 51210247
5317251 481632 128 512102410
54172712481632 128 512102413
5517411 48 64128 51210248
5617571 4816 64128 512102414
571759124816 64128 512102413
5817731 48 3264128 512102419
5917751248 3264128 51210242
6017911248163264128 51210244
6117891 48163264128 51210241
621951124816 12825651210247
6319651 48 32 12825651210248
6419671248 32 128256512102413
6519811 481632 12825651210244
66198312481632 12825651210244
672015124816 6412825651210242
6820311248 326412825651210241
6920451 4816326412825651210241
702047124816326412825651210240Williams82
* Overlapping judgment values for domestic and foreign soybean varieties.
Table 5. Classification performance parameters of gene-based analysis for discriminating Korean and imported soybeans.
Table 5. Classification performance parameters of gene-based analysis for discriminating Korean and imported soybeans.
Statistical ValueNo. of Sample
ClassificationTD (True Domestic Product)595-
FD (False Domestic Product)35-
TF (True Foreign Product)-446
FF (False Foreign Product)-20
Total630466
Sensitivity = ( 595 595   +   35 ) × 100 = 94.4 % -
Selectivity- = ( 446 466   +   20 ) × 100 = 95.7 %
Efficiency = ( 595   +   446 595   +   35   +   446   +   20 ) × 100 = 95.0 %
Table 6. Validation results for the discrimination table using judgment values of 11 markers for soybeans.
Table 6. Validation results for the discrimination table using judgment values of 11 markers for soybeans.
ClassificationNo. of SamplesPredictive Rate
TotalDomesticForeign
Total603030 = 59 60 × 100 = 98.3 %
Domestic30291 = 29 30 × 100 = 96.7 %
Imported30030 = 30 30 × 100 = 100.0 %
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jung, K.-C.; Kim, B.-Y.; Kim, M.-J.; Kim, N.-K.; Kang, J.; Kim, Y.-H.; Park, H.-M.; Jang, H.-S.; Shin, H.-C.; Kim, T.-J. Development of a Gene-Based Soybean-Origin Discrimination Method Using Allele-Specific Polymerase Chain Reaction. Foods 2023, 12, 4497. https://doi.org/10.3390/foods12244497

AMA Style

Jung K-C, Kim B-Y, Kim M-J, Kim N-K, Kang J, Kim Y-H, Park H-M, Jang H-S, Shin H-C, Kim T-J. Development of a Gene-Based Soybean-Origin Discrimination Method Using Allele-Specific Polymerase Chain Reaction. Foods. 2023; 12(24):4497. https://doi.org/10.3390/foods12244497

Chicago/Turabian Style

Jung, Kie-Chul, Bo-Young Kim, Myoung-Jin Kim, Nam-Kuk Kim, Jihun Kang, Yul-Ho Kim, Hyang-Mi Park, Han-Sub Jang, Hee-Chang Shin, and Tae-Jip Kim. 2023. "Development of a Gene-Based Soybean-Origin Discrimination Method Using Allele-Specific Polymerase Chain Reaction" Foods 12, no. 24: 4497. https://doi.org/10.3390/foods12244497

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop