Protective Effects of Fermented Soybeans (Cheonggukjang) on Dextran Sodium Sulfate (DSS)-Induced Colitis in a Mouse Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Antibodies
2.2. Preparation of Cheonggukjang Samples
2.3. Bacterial Community Analysis of Cheonggukjang by Next-Generation Sequencing (NGS)
2.4. Experimental Animals
2.5. DSS-Induced Colitis and Cheonggukjang Treatment
2.6. Disease Activity Index (DAI)
2.7. ELISA
2.8. Quantitative Real-Time PCR (qRT-PCR)
2.9. Western Blot Assay
2.10. Histological Analysis
2.11. IHC Staining
2.12. Statistical Analysis
3. Results and Discussion
3.1. Bacterial Community Structure in Cheonggukjang Samples
3.2. Cheonggukjang Attenuates the Progression of DSS-Induced Colitis
3.3. Cheonggukjang Improves Histological Changes on DSS-Induced Colitis
3.4. Cheonggukjang Reduces the Expression of Proinflammatory Cytokines on DSS-Induced Colitis
3.5. Cheonggukjang Suppresses Activation of NF-κB and MAPKs Signaling Pathways on DSS-Induced Colitis
3.6. Cheonggukjang Improves Intestinal Epithelial Barrier Integrity by Modulating Mucins and Tight Junction Proteins in DSS-Induced Mice
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ferguson, L.R.; Shelling, A.N.; Browning, B.L.; Huebner, C.; Petermann, I. Genes, diet and inflammatory bowel disease. Mutat. Res. Fundam. Mol. Mech. Mutagen. 2007, 622, 70–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harris, K.G.; Chang, E.B. The intestinal microbiota in the pathogenesis of inflammatory bowel diseases: New insights into complex disease. Clin. Sci. 2018, 132, 2013–2028. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Owczarek, D.; Rodacki, T.; Domagała-Rodacka, R.; Cibor, D.; Mach, T. Diet and nutritional factors in inflammatory bowel diseases. World J. Gastroenterol. 2016, 22, 895–905. [Google Scholar] [CrossRef] [Scilit]
- Younis, N.; Zarif, R.; Mahfouz, R. Inflammatory bowel disease: Between genetics and microbiota. Mol. Biol. Rep. 2020, 47, 3053–3063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ng, S.C.; Shi, H.Y.; Hamidi, N.; Underwood, F.E.; Tang, W.; Benchimol, E.I.; Panaccione, R.; Ghosh, S.; Wu, J.C.Y.; Chan, F.K.L.; et al. Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: A systematic review of population-based studies. Lancet 2017, 390, 2769–2778. [Google Scholar] [CrossRef] [Scilit]
- Damman, C.J.; Miller, S.I.; Surawicz, C.M.; Zisman, T.L. The microbiome and inflammatory bowel disease: Is there a therapeutic role for fecal microbiota transplantation? Off. J. Am. Coll. Gastroenterol. 2012, 107, 1452–1459. [Google Scholar] [CrossRef] [Scilit]
- Knights, D.; Lassen, K.G.; Xavier, R.J. Advances in inflammatory bowel disease pathogenesis: Linking host genetics and the microbiome. Gut 2013, 62, 1505–1510. [Google Scholar] [CrossRef] [Scilit]
- Stecher, B. The Roles of Inflammation, Nutrient Availability and the Commensal Microbiota in Enteric Pathogen Infection. Microbiol. Spectr. 2015, 3, 3. [Google Scholar] [CrossRef] [Scilit]
- Feng, J.; Guo, C.; Zhu, Y.; Pang, L.; Yang, Z.; Zou, Y.; Zheng, X. Baicalin down regulates the expression of TLR4 and NFkB-p65 in colon tissue in mice with colitis induced by dextran sulfate sodium. Int. J. Clin. Exp. Med. 2014, 7, 4063–4072. [Google Scholar]
- Masterson, J.C.; McNamee, E.N.; Fillon, S.A.; Hosford, L.; Harris, R.; Fernando, S.D.; Jedlicka, P.; Iwamoto, R.; Jacobsen, E.; Protheroe, C.; et al. Eosinophil-mediated signalling attenuates inflammatory responses in experimental colitis. Gut 2015, 64, 1236–1247. [Google Scholar] [CrossRef] [Scilit]
- Schottelius, A.J.; Dinter, H. Cytokines, NF-kappaB, microenvironment, intestinal inflammation and cancer. Cancer Treat. Res. 2006, 130, 67–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baek, J.G.; Shim, S.M.; Kwon, D.Y.; Choi, H.K.; Lee, C.H.; Kim, Y.S. Metabolite profiling of Cheonggukjang, a fermented soybean paste, inoculated with various Bacillus strains during fermentation. Biosci. Biotechnol. Biochem. 2010, 74, 1860–1868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, I.S.; Hwang, C.W.; Yang, W.S.; Kim, C.H. Current Perspectives on the Physiological Activities of Fermented Soybean-Derived Cheonggukjang. Int. J. Mol. Sci. 2021, 22, 5746. [Google Scholar] [CrossRef] [Scilit]
- Jang, C.H.; Oh, J.; Lim, J.S.; Kim, H.J.; Kim, J.S. Fermented Soy Products: Beneficial Potential in Neurodegenerative Diseases. Foods 2021, 10, 636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeong, D.Y.; Ryu, M.S.; Yang, H.J.; Park, S. γ-PGA-Rich Chungkookjang, Short-Term Fermented Soybeans: Prevents Memory Impairment by Modulating Brain Insulin Sensitivity, Neuro-Inflammation, and the Gut-Microbiome-Brain Axis. Foods 2021, 10, 221. [Google Scholar] [CrossRef] [Scilit]
- Nam, Y.-D.; Yi, S.-H.; Lim, S.-I. Bacterial diversity of Cheonggukjang, a traditional Korean fermented food, analyzed by barcoded pyrosequencing. Food Control 2012, 28, 135–142. [Google Scholar] [CrossRef] [Scilit]
- Kwoji, I.D.; Aiyegoro, O.A.; Okpeku, M.; Adeleke, M.A. Multi-Strain Probiotics: Synergy among Isolates Enhances Biological Activities. Biology 2021, 10, 322. [Google Scholar] [CrossRef] [Scilit]
- Jakubczyk, D.; Leszczyńska, K.; Górska, S. The Effectiveness of Probiotics in the Treatment of Inflammatory Bowel Disease (IBD)—A Critical Review. Nutrients 2020, 12, 1973. [Google Scholar] [CrossRef] [Scilit]
- Lee, N.K.; Cho, I.J.; Park, J.W.; Kim, B.Y.; Hahm, Y.T. Characteristics of Cheonggukjang produced by the rotative fermentation method. Food Sci. Biotechnol. 2010, 19, 115–119. [Google Scholar] [CrossRef] [Scilit]
- Yang, H.J.; Kim, H.J.; Kim, M.J.; Kang, S.; Kim, D.S.; Daily, J.W.; Jeong, D.Y.; Kwon, D.Y.; Park, S. Standardized chungkookjang, short-term fermented soybeans with Bacillus lichemiformis, improves glucose homeostasis as much as traditionally made chungkookjang in diabetic rats. J. Clin. Biochem. Nutr. 2013, 52, 49–57. [Google Scholar] [CrossRef] [Scilit]
- Ha, G.; Yang, H.J.; Ryu, M.S.; Jeong, S.J.; Jeong, D.Y.; Park, S. Bacterial Community and Anti-Cerebrovascular Disease-Related Bacillus Species Isolated from Traditionally Made Kochujang from Different Provinces of Korea. Microorganisms 2021, 9, 2238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonçalves, F.C.; Schneider, N.; Mello, H.F.; Passos, E.P.; Meurer, L.; Cirne-Lima, E.; Paz, A.H.R. Characterization of acute murine dextran sodium sulfate (DSS) colitis: Severity of inflammation is dependent on the DSS molecular weight and concentration. Acta Sci. Vet. 2013, 41, 1142. [Google Scholar]
- Erben, U.; Loddenkemper, C.; Doerfel, K.; Spieckermann, S.; Haller, D.; Heimesaat, M.M.; Zeitz, M.; Siegmund, B.; Kühl, A.A. A guide to histomorphological evaluation of intestinal inflammation in mouse models. Int. J. Clin. Exp. Pathol. 2014, 7, 4557–4576. [Google Scholar] [PubMed]
- Zheng, L.; Wen, X.L. Gut microbiota and inflammatory bowel disease: The current status and perspectives. World J. Clin. Cases 2021, 9, 321–333. [Google Scholar] [CrossRef] [Scilit]
- Kanwal, S.; Joseph, T.P.; Aliya, S.; Song, S.; Saleem, M.Z.; Nisar, M.A.; Wang, Y.; Meyiah, A.; Ma, Y.; Xin, Y. Attenuation of DSS induced colitis by Dictyophora indusiata polysaccharide (DIP) via modulation of gut microbiota and inflammatory related signaling pathways. J. Funct. Foods 2020, 64, 103641. [Google Scholar] [CrossRef] [Scilit]
- Urushima, H.; Nishimura, J.; Mizushima, T.; Hayashi, N.; Maeda, K.; Ito, T. Perilla frutescens extract ameliorates DSS-induced colitis by suppressing proinflammatory cytokines and inducing anti-inflammatory cytokines. Am. J. Physiol.-Gastrointest. Liver Physiol. 2015, 308, G32–G41. [Google Scholar] [CrossRef] [Scilit]
- Vanderpool, C.; Yan, F.; Polk, D.B. Mechanisms of probiotic action: Implications for therapeutic applications in inflammatory bowel diseases. Inflamm. Bowel Dis. 2008, 14, 1585–1596. [Google Scholar] [CrossRef] [Scilit]
- González-Mauraza, H.; Martín-Cordero, C.; Alarcón-de-la-Lastra, C.; Rosillo, M.A.; León-González, A.J.; Sánchez-Hidalgo, M. Anti-inflammatory effects of Retama monosperma in acute ulcerative colitis in rats. J. Physiol. Biochem. 2014, 70, 163–172. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Ghosh, S. Toll-like receptor-mediated NF-kappaB activation: A phylogenetically conserved paradigm in innate immunity. J. Clin. Investig. 2001, 107, 13–19. [Google Scholar] [CrossRef] [Scilit]
- Grondin, J.A.; Kwon, Y.H.; Far, P.M.; Haq, S.; Khan, W.I. Mucins in Intestinal Mucosal Defense and Inflammation: Learning From Clinical and Experimental Studies. Front. Immunol. 2020, 11, 2054. [Google Scholar] [CrossRef] [Scilit]
- Van Klinken, B.J.; Van der Wal, J.W.; Einerhand, A.W.; Büller, H.A.; Dekker, J. Sulphation and secretion of the predominant secretory human colonic mucin MUC2 in ulcerative colitis. Gut 1999, 44, 387–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Förster, C. Tight junctions and the modulation of barrier function in disease. Histochem. Cell Biol. 2008, 130, 55–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Score | Body Weight Decrease (%) | Stool Consistency | Fecal Bleeding |
|---|---|---|---|
| 0 | 0 | Normal | No bleeding |
| 1 | 1–5 | ||
| 2 | 5–10 | Soft stools | Slight bleeding |
| 3 | 11–15 | ||
| 4 | >15 | Diarrhea | Gross bleeding |
| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| TNF-α | AACTAGTGGTGCCAGCCGAT | CTTCACAGAGCAATGACTCC |
| IL-6 | TGTCTATACCACTTCACAAGTCGGAG | GCACAACTCTTTTCTCATTTCCAC |
| IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
| iNOS | CGAAACGCTTCACTTCCAA | TGAGCCTATATTGCTGTGGCT |
| COX-2 | TTTGGTCTGGTGCCTGGTC | CTGCTGGTTTGGAATAGTTGCTC |
| MUC-2 | GCAGTCCTCAGTGGCACCTC | CACCGTGGGGCTACTGGAGAG |
| MUC-3 | CGTGGTCAACTGCGAGAATGG | CGGCTCTATCTCTACGCTCTC |
| β-actin | CGGTTCCGATGCCCTGAGGCTCTT | CGTCACACTTCATGATGGAATTGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, H.-J.; Kim, H.-R.; Jeong, S.-J.; Yang, H.-J.; Ryu, M.S.; Jeong, D.-Y.; Kim, S.-Y.; Jung, C.-H. Protective Effects of Fermented Soybeans (Cheonggukjang) on Dextran Sodium Sulfate (DSS)-Induced Colitis in a Mouse Model. Foods 2022, 11, 776. https://doi.org/10.3390/foods11060776
Lim H-J, Kim H-R, Jeong S-J, Yang H-J, Ryu MS, Jeong D-Y, Kim S-Y, Jung C-H. Protective Effects of Fermented Soybeans (Cheonggukjang) on Dextran Sodium Sulfate (DSS)-Induced Colitis in a Mouse Model. Foods. 2022; 11(6):776. https://doi.org/10.3390/foods11060776
Chicago/Turabian StyleLim, Hyeon-Ji, Ha-Rim Kim, Su-Ji Jeong, Hee-Jong Yang, Myeong Seon Ryu, Do-Youn Jeong, Seon-Young Kim, and Chan-Hun Jung. 2022. "Protective Effects of Fermented Soybeans (Cheonggukjang) on Dextran Sodium Sulfate (DSS)-Induced Colitis in a Mouse Model" Foods 11, no. 6: 776. https://doi.org/10.3390/foods11060776
APA StyleLim, H.-J., Kim, H.-R., Jeong, S.-J., Yang, H.-J., Ryu, M. S., Jeong, D.-Y., Kim, S.-Y., & Jung, C.-H. (2022). Protective Effects of Fermented Soybeans (Cheonggukjang) on Dextran Sodium Sulfate (DSS)-Induced Colitis in a Mouse Model. Foods, 11(6), 776. https://doi.org/10.3390/foods11060776

