Next Article in Journal
Polycyclic Aromatic Hydrocarbon Risk Assessment and Analytical Methods Using QuEchERS Pretreatment for the Evaluation of Herbal Medicine Ingredients in Korea
Previous Article in Journal
Albedo- and Flavedo-Specific Transcriptome Profiling Related to Penicillium digitatum Infection in Citrus Fruit
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Changes of the Microbiota Composition on the Surface of Pig Carcasses during Chilling and Its Associations with Alterations in Chiller’s Temperature and Air Humidity

Key Laboratory of Meat Processing and Quality Control, Ministry of Education, Key Laboratory of Meat Processing, Ministry of Agriculture and Rural Sciences, Jiangsu Collaborative Innovation Center for Quality Control of Meat Production and Processing, College of Food Science and Technology, Nanjing Agricultural University, Nanjing 210095, China
*
Author to whom correspondence should be addressed.
Foods 2021, 10(9), 2195; https://doi.org/10.3390/foods10092195
Submission received: 25 August 2021 / Accepted: 7 September 2021 / Published: 16 September 2021
(This article belongs to the Section Meat)

Abstract

:
In this study, we investigated changes of microbiota composition on the surface of pig carcasses during chilling and their associations with temporal and spatial changes of wind speed, air temperature, and air humidity. The composition of microbiota on a carcass surface varied greatly with sampling sites; in particular, the surfaces of forelegs and neck had higher load of microorganisms and different microbiota composition compared to in the air and other carcass parts. However, such a difference in the microbiota composition decreased as chilling time extended. The positive detection ratios of microbial genes resistant to sulfonamides, quinolones, tetracyclines, and β-lactams were found different greatly with chilling time and sampling sites. The β-lactam and tetracycline resistant genes were observed in higher ratios in airborne microorganisms in the chiller, while the sulfa and tetracycline resistant genes had higher ratios in the microbiota on pig carcasses. Actual measurements and dynamic simulation showed that air temperature and humidity varied greatly among different places in a chiller within the first 8 h of chilling, with higher values close to the door, but the differences became smaller afterwards. The micro-environmental differences and changes in the chiller may cause the different composition of microbiota on pig carcasses.

1. Introduction

Carcass chilling is a critical step for processing of chilled pork. Low temperature can reduce the growth of spoilage microorganisms on pig carcasses [1]. A chiller is the main place for carcass chilling. The main air supply in a chiller is the forced convection heat exchange, forcing the outside air into the box and performing heat exchange with an evaporator, and as a result, the air temperature is reduced to achieve the purpose of refrigeration [2]. The chilling method plays a critical role in the airflow organization in a chiller [3]. Bad air flow organization may lead to insufficient heat exchange between cold and hot air, resulting in uneven distribution of air temperature and humidity [4]. Air temperature is one of the most important factors to inhibit the growth of microorganisms, and uneven temperature may help to increase the growth of microorganisms in a chiller. In addition, the difference in wind speed in a chiller affects the contact area between the cold wind and pig carcasses and the growth of microorganisms. Therefore, the size, temperature, humidity, and wind speed of a chiller affect the carcass chilling efficiency and meat contamination [5,6]. At a high wind speed, the surrounding environment of a carcass has high humidity and low temperature. When a chiller is full of pig carcasses, the wind speed and air temperature decline rapidly, but the air humidity increases, and finally, the wind speed, air temperature, and humidity tend to be stable [7].
Microbial contamination is a main factor for causing meat deterioration [8], which is characteristic of unacceptable discoloration, unpleasant odor, and slime formation [9]. The microbial spoilage of meat is a complex process that is affected by competition between different microbial populations and their biological and abiotic interactions [10] under processing and storage conditions [11]. Therefore, detecting the microbial population and structure in meat plays an important role in maintaining meat quality and extending shelf life.
The inappropriate use of antibiotics to promote animal growth may cause drug resistance in microorganisms. Animals and farming environments are reservoirs of drug-resistant bacteria [12]. Sulfa/trimethoprim, tetracyclines, macrolides, penicillins, and aminoglycosides are the most widely used antibiotics [13,14]. The drug-resistant genes are usually detected in farm animals [15,16,17,18]. Tetracyclines and sulfa resistant genes are the most common resistance genes in animal feces and urine [15,19], and microorganisms acquire antibiotic resistance by carrying related genes [15]. These microorganisms may spread from the environment to humans [20,21]. However, few data are available on the resistant genes of microorganisms existing on the surface of pig carcasses.
The objectives of this study were to investigate the population structure and drug-resistant genes of microorganisms on the surface of pig carcasses and the changes in wind speed, temperature, and humidity in a chiller during chilling of pig carcasses.

2. Materials and Methods

2.1. Chiller Selection

The experiment was performed in a local pig slaughterhouse from June to August 2019. The size of a chiller is 11.4 m × 7.7 m × 4.8 m, which has eight tracks. Each track can hang a maximum of 40 pig carcasses. Two air coolers are installed above the track (approximately 4 m above the ground).

2.2. Simulation of Wind Speed, Temperature and Humidity in the Chiller

The chiller was full of three hundred pig carcasses within 8 h. The wind speed, temperature, and humidity of the chiller were measured at 0, 2, 4, 6, 8, 10, 12, and 14 h. Then the Ansys 16.0 system (ANSYS, Canonsburg, PA, USA) was used to divide into a number of grids to calculate the wind speed, temperature, and humidity, and the simulation graphs were obtained.
The forced closed air circulation in a cooler belongs to the large space turbulent heat exchange, and the following assumptions are made: (1) The air in the chiller conforms to Boussineq’s assumption and is not compressible; (2) The air flow in the chiller is a steady-state turbulent flow [22].
Since the forced convection circulation flow field driven by a fan in the chiller is a high Re number turbulent flow, it is solved by the standard k-ε equation. However, due to the low Re number in the viscous bottom layer close to the wall, the wall function must be corrected [23].
The actual velocity of the air outlet of the fan was measured by a thermal anemometer. The chiller door was the pressure inlet, and the pressure was set to 0. The temperature and humidity of the air outlet of the air cooler were measured by a temperature and humidity meter (Biaozhi GM1362, Jumaoyuan, Shenzhen, China). The fluid density was taken from the air density (ρ = 1.225 kg/m3) [22], and the average flow velocity (15–20 m/s), and the hydrodynamic viscosity were based on the aerodynamic viscosity (μ = 0.000017 kg/m·s) [22]. The orbital thermal conductivity was set at 16.27 w/(m·k), and the thermal conductivity of pig carcasses was set at 2 w/(m·k). Within the first 8 h of chilling, the chiller door was open, and the chiller wall was set to be absolutely insulated, and the air in the chiller was convectively transferred to the outside through the door. During the second phase of chilling from 8 to 14 h, the chiller door was closed, and the chiller wall was absolutely insulated. The air in the chiller exchanged heat only through the door. The outside temperature was 30 °C. The main material of the wall was cement and plastic board, and the convection heat transfer coefficient was set to 0.1.
Boundary treatment of the air outlet of the cooler [22]:
(1)
Turbulent pulsating kinetic energy K n = 0 ;
(2)
Pulsation energy dissipation ε n = 0 ;
K and ε are local unidirectional processing.
The commonly used grids in computational fluid dynamics (CFD) are structured or unstructured grids. Two meshing methods are used for numerical simulation. Chilling at 0 h was a structured grid, but the rest of chilling was an unstructured grid, and the dimensional accuracy was divided by 100 mm.

2.3. Microbiological Sampling in the Air and on the Surface of Pig Carcasses

At 0, 2, 4, 6, 8, 10, 12, and 14 h of chilling, microorganisms in the air were captured by the air plankton sampler (ZR-2050, Qingdao Zhongrui Intelligent Instrument Co., Ltd., Qingdao, China.) and plate count agar (PCA, Nanjing Rongshengda Experimental Instrument Co., Ltd., Nanjing, China). In each plate, 500 L of the air were captured. Due to the low abundance of microorganisms in the air, the air-borne microorganisms were enriched by incubating at 37 °C for 48 h. Then, the samples were suspended with 1 to 2 mL of sterile water and stored at −80 °C for further analyses. At each time point of a chilling day, three air samples at three plates were captured as replicates. Such a sampling procedure was repeated on 5 separate days. Thus, a total of 120 air samples were achieved for microbial sequencing.
At 2, 4, 6, 8, 10, 12, and 14 h of chilling, microorganisms on the surface of pig carcasses were obtained by swabbing the forelegs and the pleural cavity of pig carcasses with disposable sterile swabs (Yangsheng Medical, Yangzhou, Jiangsu, China). At each time point of a chilling day, two swabs were obtained from each of three carcasses. The sampling procedure was repeated on 5 separate days. Thus, a total of 210 swabs were obtained for sequencing. About 100 cm2 area of each part was swabbed. The swabs were stored at −80 °C for further use. The airborne microorganisms and the swabs containing microorganisms were sequenced.

2.4. 16S rRNA Sequencing

The airborne microorganisms and the swabbing microorganisms on the surface of pig carcasses were sent to Shanghai Lingen Biological Technology Co., Ltd. for sequencing analysis. Specific steps were as follows. Three replicate samples from the air and the swabs were merged and microbial DNA was extracted from samples using an EZNA DNA kit (Omega Bio-tek, Norcross, GA, USA) according to manufacturer’s protocols. The V4-V5 region of the bacterial 16S ribosomal RNA gene was amplified by PCR (95 °C for 2 min, followed by 25 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, and a final extension at 72 °C for 5 min) using primers 515F: 5′-barcode-GTGCCAGCMGCCGCGG)-3′ and 806R 5′-GGACTACHVGGGTWTCTAAT-3′, where barcode is an eight-base sequence unique to each sample. PCR reactions were performed in triplicate in a mixture (20 μL) containing 4 μL of 5 × FastPfu buffer, 2 μL of 2.5 mM dNTPs, 0.8 μL of each primer (5 μM), 0.4 μL of FastPfu polymerase, and 10 ng of template DNA. Amplicons were extracted from 2% agarose gels and purified using AxyPrep DNA gel extraction kit (Axygen Biosciences, Union City, CA, USA) according to the manufacturer’s instructions.
Purified PCR products were quantified by Qubit® 3.0 (Invitrogen, Waltham, MA, USA) and every twenty-four amplicons with different barcodes were mixed equally. The pooled DNA product was used to construct an Illumina pair-end library following Illumina’s genomic DNA library preparation procedure. Sequencing libraries were generated using NEB Next® Ultra™ DNA Library Prep Kit for Illumina (NEB, Ipswich, MA, USA) following the manufacturer’s recommendations, and index codes were added. The library quality was assessed on the Qubit@ 2.0 Fluorometer (Thermo Scientific, Waltham, MA, USA) and Agilent Bioanalyzer 2100 system. Then, the amplicon library was paired-end sequenced (2 × 250) on an Illumina MiSeq platform (Shanghai BIOZERON Co., Ltd., Shanghai, China) according to the standard protocols.

2.5. Detection of Drug-Resistant Genes in Microbial Samples

Several resistant genes were selected according to the types of commonly used veterinary drugs. The names and primer sequences are listed in Table 1. All microbial samples were collected from the air, and the carcasses were used for detecting all selected resistant genes. The real-time quantitative PCR (qPCR) was performed with a commercial SYBR Premix Ex Taq II kit (Tli RNase H Plus, Baori Medical, Beijing, China). The total volume was 20 μL, containing 10 μL SYBR Premix Ex Taq II (TliRNase H Plus), 0.8 μL forward primers, 0.8 μL reverse primers, 0.4 μL ROX reference dye II, 6 μL ddH2O and 2 μL template DNA. A real-time fluorescence quantitative PCR instrument (QuantStudio 6, Thermo Fisher Scientific, Waltham, MA, USA) was used for quantification. The template DNA of each microbial sample was diluted to 5−1 gradient and was repeated three times. The PCR protocol was as follows: 30 s at 95 °C, followed by 40 cycles of 5 s at 95 °C, 34 s at 60 °C, and then, a final melting curve stage at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s.

2.6. Data Analysis

Usearch (version 10, http://drive5.com/uparse/ (accessed on 26 November 2019)) was used to perform clustering analysis of operational taxonomic units (OTUs). Alpha diversity and community composition analysis were calculated by Mothur (version 1.30.1, http://www.mothur.org/wiki/Schloss_SOP#Alpha_diversity (accessed on 26 November 2019)) and R software.
The effects of sampling time and site on relative abundances of drug-resistant genes were evaluated by analysis of variance. The means were compared by Duncan’s multiple range test using the SAS program (version 8.1, SAS Institute Inc., Cary, NC, USA). The Graphpad Prism software (version 7.0, https://www.graphpad.com/ (accessed on 30 April 2020)) was applied to prepare images.

3. Results

3.1. Fluid Simulation Modeling for Chilling Process of Pig Carcasses

3.1.1. 3D Modeling of a Chiller

The premise of building a simulation model is to establish an intuitive and accurate 3D model. For the convenience of calculation, pig carcasses with an irregular shape were considered cuboid (including the legs). One half of a carcass was considered a semi-cuboid. The distance between two half carcasses on the same track was 0.1 m. The chiller was empty at 0 h of chilling, but it was full of pig carcasses at 8 h. The 3D models are shown in Figure 1.

3.1.2. Simulating Changes of Temperature, Humidity, and Wind Speed and Grid Division

The wind speed at the outlet of the chiller was maintained at 15–20 m/s during carcass chilling. At 0 h, the structured mesh was suitable for a cold store according to standard geometry. At subsequent time points, pig carcasses were placed in the chiller and unstructured meshing was applied to make the simulation results more accurate. The real values of measured temperature and humidity and predicted meshing results are shown in Table 2. The meshing results are shown in Figure 2.

3.1.3. Simulation Results

In order to visualize the changes in wind speed, temperature, and humidity of the chiller during chilling, the transverse diagrams were captured for the wind speed, temperature, and humidity in the chiller at 0, 2, 4, 6, 8, 10, 12, and 14 h. Each set of pictures contained six transverse views, from high to low positions of the chiller; the track surface; the upper, middle, and lower positions of pig carcasses; and the ground (Table 3).
Although the wind speed distribution was slightly different during chilling, no significant changes were observed, indicating that the arrangement of pig carcasses did not affect the distribution of airflow in the chiller. The wind speed was higher in the places where the fan was located or close to the ground. This was because the high-speed air flow blown by the fan was on the top layer, and the cold air was not spread upwards but downwards. When the overall wind speed in the chiller was high, the air exchange on the chiller door was not obvious. The airflow of the chiller had good symmetry in the horizontal direction. Thus, the layout of the chiller and the arrangement of pig carcasses are reasonable.
The temperature field within the first 8 h of chilling was significantly different from that from 10 to 14 h of chilling. Within the first 8 h, the overall temperature gradually increased, and the temperature close to the door was significantly higher than the inside parts of the chiller. The color of the chiller was red, indicating that heat exchange occurred at the door from the external hot air to the cold air in the chiller. This resulted in a temperature increase close to the door, and eventually the heat was radiated to a quarter of the chiller. In the second stage from 10 to 14 h, the temperature of the chiller declined rapidly, and the temperature field uniformly showed blue, indicating that the temperature was low and evenly distributed. Because the chiller door was closed after the chiller was filled with pig carcasses, the heat exchange with the hot air outside the door was stopped, and the circulating refrigeration in the chiller was no longer interfered with by external heat. However, the color of the wall near the door was still slightly “red shifted”, indicating that the temperature here was higher than other parts of the chiller. This may be because the chiller wall was not completely insulated, and the external heat could still penetrate through the wall.
The humidity change was similar to temperature. In the first stage from 0 to 8 h, the overall humidity gradually increased, and the humidity close to the door of the chiller was significantly higher than the inside parts of the chiller. The red color of the chiller door indicated that the heat exchange between the inside and outside of the chiller increased the air humidity. During this period, the humidity field was more unevenly distributed than the temperature field, indicating that the heat exchange had a higher influence on the humidity in the chiller than the temperature. In the second stage from 10 to 14 h, the humidity in the chiller declined rapidly, and the humidity field inside the chiller was evenly distributed. This was because the chiller door had been closed, and the heat exchange with the hot air outside the door was stopped. Contrary to the distribution of the temperature field, the color of the wall near the chiller door was slightly “blue shifted”, which indicates that the humidity here was slightly lower than the overall humidity in the chiller.

3.2. The Microbiota Composition in the Air and on the Surface of Pig Carcasses Changed Greatly during Chilling

3.2.1. Diversity of the Microbiota

The Shannon–Wiener curves of the microbial samples from the air, the surface of forelegs, and pleural cavity of pig carcasses tended to be flat, indicating that sequencing data can well reflect the microbial information in samples (Figure 3).
Rank-abundance curves reflect species abundance and uniformity. The width of a curve reflects the abundance of the species. The larger the curve spans on the horizontal axis, the higher the abundance of the species. The microbial samples from the surface of the pig carcass were more abundant than those in the air (Figure 4). The smoothness of a curve reflects the evenness of the microbial species in the samples. The smoother the curve, the more uniform the species distribution, and the steeper the curve, the more uneven the species distribution. The uniformity of the microorganism samples from the surface of the pig carcasses was better than those in the air.
A Venn diagram showed that the OTUs in the microbial samples from the air and the surface of forelegs and pleural cavity varied with chilling time (Figure 5). When comparing the number of OTUs between air samples and swabs, we observed much smaller numbers of OTUs in air-borne samples. This is due to the loss of non-cultivable microorganisms. The number of OTUs in the air samples was the smallest at 10 h and the greatest at 0 h (276 vs. 925). The number of OTUs on the surface of the forelegs was the smallest at 14 h and the greatest at 12 h (1549 vs. 2274). The number of OTUs from the surface of the pleural cavity was the smallest at 2 h and the greatest at 14 h (1391 vs. 2598).

3.2.2. The Alterations in Microbiota Composition during Chilling

At the phylum level, Proteobacteria, Bacteroides, Firmicutes, and Actinobacteria were the dominant bacteria in the airborne samples. At 0 h, the relative abundance of Firmicutes was the highest for the first four merged air-borne samples (Figure 6a). However, in the fifth merged sample, the abundance of Actinobacteria was the highest. At 2 h and subsequent time points when pig carcasses and workers went in and out, the dominant phyla changed greatly. The relative abundance of Proteobacteria and Bacteroides increased substantially, and the fifth merged samples showed a big difference from other samples at most time points. Such changes could be associated with practices and hygiene management in the factory. The dominant phyla on the surface of the forelegs were Proteobacteria, Bacteroides, Firmicutes, and Actinomycetes (Figure 6b). Although some variations exist in the relative abundance of these phyla, the phylum composition kept relatively constant during chilling. Proteobacteria, Bacteroides, Firmicutes, and Actinomycetes were predominant on the pleural cavity of pig carcasses and the relative abundance of Proteobacteria was also the highest (Figure 6c). As noted above, the microbial composition showed a great difference between the air-borne samples and swabs because some air-borne microorganisms could not be cultivated.
At the genus level, there were greater than seventy genera in the air and on the surface of pig carcasses; however, the microbial composition was quite different (Figure 7). In the air, Bacillus, Acinetobacter, and Staphylococcus were the dominant genera, and the genera varied greatly with time during chilling (Figure 7a). It is difficult to find a distinct trend. This could be due to the complexity of microenvironment (e.g., temperature and humidity) and movement of workers and pig carcasses. On the surface of the forelegs, Moraxella, Acinetobacter, and Flavobacterium were the main genera (Figure 7b). Moraxella was the predominant genus through the period of chilling. The relative abundance of Flavobacterium increased greatly during chilling. On the pleural cavity, Moraxella, Acinetobacter, and Flavobacterium were the predominant genera (Figure 7c). The abundance of Acinetobacter showed an obvious increase, but the abundance of Moraxella declined as chilling time increased, indicating that Acinetobacter may be resistant to low temperature but not for Moraxella.

3.2.3. The Difference in the Microbiota Composition among Sampling Places

Venn diagrams showed differences in the microbiota composition among microbial samples from the air and the surface of forelegs and pleural cavity (Figure 8a–g). The numbers of overlapping OTUs for the three groups were the greatest at 6 h and the smallest at 2 h (780 vs. 227). The numbers of overlapping OTUs for the pleural cavity or the surface of foreleg and the air were also observed the greatest at 6 h and smallest at 2 h (943 vs. 294 for pleural cavity and 928 vs. 337 for foreleg). The OTUs on the surface of forelegs showed a great similarity to those on the pleural cavity, indicating that the microbiota composition on the surface of pig carcasses tended to be consistent.

3.3. Drug-Resistant Genes in Microbiota Samples from the Air and the Surface of Pleural Cavity and Foreleg

3.3.1. Effect on the Number of Drug-Resistant Genes

It is a challenge to extract lowly abundant microbial genes for detecting antibiotic resistant genes. To minimize the error, all merged samples at each time point were tested in three replicates, and only samples with at least two positive results were considered resistance positive. As shown in Table 4, six resistant genes, that is, sul Ⅰ and sul Ⅱ (resistant to sulfonamides), qepA (resistant to quinolones), blaCTX-M-2 (resistant to β-lactams), and tetA and tetC (resistant to tetracycline) were detectable in all airborne samples across the chilling time points. The blaTEM (resistant to β-lactams), ermA (resistant to erythromycins), tetM (resistant to tetracycline), aac (6′)-Ib-cr and qnrA (resistant to quinolones) were also detectable by 75% to 87.5% of airborne samples. In addition, blaSHV (resistant to β-lactams), ermB (resistant to erythromycins), and ermC (resistant to erythromycins) were detectable in low abundance. Of the 14 selected drug-resistant genes, 11, 11, 10, 12, 10, 12, 11 and 6 genes were detected at 0, 2, 4, 6, 8, 10, 12, and 14 h, reflecting the alterations in the microbiota composition.
On the surface of the pleural cavity, sul Ⅰ, sul Ⅱ, qepA, blaCTX-M-2, tetA, tetC, tetM, and qnrA were detectable in all samples. The blaTEM, ermA, aac (6′)-Ib-cr, and blaSHV were also detectable by percentages of 57.1% to 87.5%. The ermB and ermC were not detected. Eleven, 12, 12, 10, 11, 11, and 10 of target genes were detected at 2, 4, 6, 8, 10, 12, and 14 h, respectively.
On the surface of the forelegs, only five genes, namely, sul Ⅰ, sul Ⅱ, blaCTX-M-2, tetA, and tetC, were detectable in all samples. The ermA, tetM, qnrA, blaTEM, qepA, aac (6′)-Ib-cr, and ermB genes were detectable by a percentage varying from 28.6% to 71.4%. However, blaSHV and ermC were not detectable. As chilling time extended, the detectable drug-resistant genes increased from six at 2 h to 12 at 8 h and then decreased to five at 14 h.

3.3.2. Effect on the Abundance of Drug-Resistant Genes

In the airborne samples, the relative abundance of blaTEM, ermA, tetA, tetC, and tetM was higher than that of sul Ⅱ, aac (6′)-Ib-cr, sul Ⅰ, blaSHV, qepA, blaCTX-M-2, and qnrA (p < 0.05, Table 5). As chilling time increased, the relative abundance of sul Ⅰ and tetM decreased, while the abundance of blaSHV increased. The other genes did not show a single trend.
In the pleural cavity, the relative abundance of all the detected genes did not differ at 2 h (p > 0.05, Table 5), but significant differences were observed in the remaining chilling time points (p < 0.05). The relative abundance of ermA, tetA, and sul Ⅱ was high, while that of blaTEM, qepA, and blaCTX-M-2 was low. Thus, erythromycin, sulfa, and tetracycline had a greater impact on the microbes on the surface of the pleural cavity of pig carcasses.
On the surface of the forelegs, there was no significant difference in relative abundance of the detected drug-resistant genes at 2 h (p > 0.05, Table 5), but significant differences were observed at the subsequent time points (p < 0.05). The relative abundance of sul Ⅰ, sul Ⅱ, and tetA was high, while it was low for blaTEM, ermB, tetC, and qnrA.

4. Discussion

Temperature and humidity have been shown to be important for restricting the growth of microorganisms. In a close chiller, the temperature and humidity fields were actually not uniform. The cold flow from air conditioners was roughly divided into two ways, one directed to the inside of the chiller and the other directed to the outside of the chiller. Such a difference in wind speed, temperature, and relative humidity may result in different evaporative loss of pig carcasses [7]. Usually, high wind speed with high relative humidity will cause low evaporative loss. During chilling, the cold flow from the air conditioner goes down under gravity, and forelegs close to the ground could get more cold air. Thus, the lower plane in a chiller is relatively evenly distributed in wind speed, temperature, and humidity. The middle plane had the lowest wind speed but the highest temperature. During the whole chilling, the humidity distribution was relatively uniform, which may have resulted from the use of circulating refrigeration in the chiller and the relatively single source of moisture.
The wind speed distribution in the chiller was uneven, which may be related to the arrangement of pig carcasses and the external air circulation. The unevenly distributed wind speed and temperature fields in the chiller may cause different cooling rates of pig carcasses at different locations. Due to the difference in position, the cooling rate of different parts of the same pig carcass was not synchronized.
We found that during chilling, when the temperature and humidity gradually increased (within the first 8 h), Acinetobacter dominated the microbes on the surface of the front legs, and when the temperature and humidity decreased between 10 and 14 h, Moraxella dominated the microorganisms. In terms of drug-resistant genes, when the temperature and humidity were high, the detection rate and relative quantitative values of drug-resistant genes were higher than those at 14 h when the temperature and humidity were the lowest. This indicates that changes in temperature and humidity during the chilling process could lead to the differences in the predominant species of microorganisms and the results of drug-resistant genes on the surface of pig carcasses.
Studies have shown that the dominant spoilage bacteria in chilled pork were Pseudomonas, Enterobacteriaceae, Thermomycetes, Lactobacillus, Moraxella, and Acinetobacter [24,25]. The present study confirmed these observations. The microbiota on the surface of pig carcasses may be derived from different sources, in particular, the workers’ hands. Many skin-residing bacteria were detected in the air of the chiller and on the surface of the pig carcasses. This could be attributed to contamination from the workers who handled pig carcasses.
Among the 52 bacterial phyla currently recognized on the earth, five to seven phyla are known to exist in the gastrointestinal tract of mammals. Firmicutes and Bacteroidetes are dominant in the gut, while Actinomycetes are less abundant [26]. In this study, we observed that Bacteroidetes are predominant on the surface of pig carcasses, indicating that pig carcasses may be contaminated by animal feces before slaughter or by destroyed gut by mishandling. In addition to exogenous enteropathogenic Proteus, healthy mammalian intestines also contain some symbiotic flora belonging to Proteus as their natural intestinal flora [27,28]. Among the four main phyla of intestinal flora (Firmicutes, Bacteroidetes, Proteus, and Actinomycetes), Proteus is the most unstable over time [29]. In this study, the pig carcass surface microorganisms contained the above four phyla, and all of them were dominant bacteria. Therefore, it can be explained that the original intestinal microorganisms are one of the main sources of pig carcass surface microorganisms. In addition to the above main sources, Actinomycetes are also widely distributed in soil and water, indicating that the microorganisms on the surface of pig carcass may come from the soil attached to the surface of pig carcass not completely washed and the cooling water for washing before chilling.
The sequencing results showed that at the phylum level, the bacteria on the surface of the pig carcass were more abundant than those in air. This could be because some microbial genes of non-cultivable microorganisms have been lost during plate cultivation. On the other hand, multiple contamination still exists during slaughtering handling, even if decontamination operations are applied.
Animal manure in farms is considered to be the main reservoirs of drug-resistant genes, because a large number of resistant genes are often detected in these environments [15,16,30,31,32,33]. The tetA, tetB, and tetM genes have been frequently detected in livestock farms [34,35]. Chee-Sanford et al. [36] identified eight genes (tetO, tetQ, tetW, tetM, tetB (P), tetS, tetT, and otrA) from two swine lagoons and the subsurface soil. Tetracycline (tetO and tetW) and sulfonamide (sul I and sul II) resistant genes were found to be highly abundant in cattle, pigs, and chicken lagoons [37]. Therefore, the animal gut and the unwashed soil on the surface of pigs may be the origin of the drug-resistant genes from the surface of pig carcasses.
The abundance of drug-resistant genes was usually related to the use of these antibiotics in animal farms [16,38,39]. In the present study, the abundance of blaTEM, ermA, tetA, tetC, and tetM in airborne microorganisms was higher, while ermA, tetA, sul Ⅰ, and sul Ⅱ were more abundant in the surface of pig carcasses. This could be related to the abuse of β-lactam, sulfonamide, and tetracycline in pig farms. They may spread to humans through the meat chain. Therefore, reasonable or limited use of antibiotics, the establishment of corresponding scientific monitoring, and management systems in animal husbandry are important for limiting the adverse effects of antibiotic abuse and ensuring food safety.

5. Conclusions

There was a large difference in wind speed varying with locations, and the wind speed of the whole chiller was unevenly distributed. The wind speed at the air outlet of the air conditioner was the greatest, and it decreased rapidly along the wind path, with the smallest value at the center of the chiller. During chilling within the first 8 h, the temperature and humidity on the side close to the chiller door were higher than the inner side of the chiller. Then, the temperature and humidity distribution became more uniform. During chilling, microbial composition in the air and on the carcass surface were different. Fourteen drug-resistant genes were selected to identify in the air and on the surface of pig carcasses. These findings provide a new insight into the source of meat microorganisms and food safety control.

Author Contributions

Conceptualization, C.L.; formal analysis, X.J., Y.N., D.Z. and J.W.; investigation, X.J., Y.N., D.Z. and J.W.; data curation, X.J., Y.N., D.Z. and J.W.; writing—original draft preparation, X.J. and C.L.; writing—review and editing, C.L.; funding acquisition, C.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Ministry of Agriculture and Rural Affairs and Ministry of Finance (CARS-35), and Ministry of Science and Technology (Ten thousand Talent Project).

Data Availability Statement

The datasets generated for this study are available on request to the corresponding author.

Acknowledgments

Lin Zhang was acknowledged for his help for sampling.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Mccarthy, Z.; Smith, B.; Fazil, A.; Wu, J.; Ryan, S.D.; Munther, D. Individual based modeling and analysis of pathogen levels in poultry chilling process. Math. Biosci. 2017, 294, 172–180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Liu, K.J.; Liu, G.H.; Tang, H.Y. Research and comparison of air supply for fan and fiber fabric. Refrig. Air Cond. 2019, 19, 19–23. [Google Scholar]
  3. Rui, W.Q. Flow Field and Numerical Simulation of the Mini-Panel Assembled Cold Storage. Master’s Thesis, North China Electric Power University, Beijing, China, 2012. [Google Scholar]
  4. Hu, Z.X.; Huang, S.; Gao, X. Influence of different air outlet on the cold storage temperature distribution. J. Guizhou Univ. 2016, 33, 39–41. [Google Scholar]
  5. Stephen, S.J.; James, C. Advances in the cold chain to improve food safety, food quality and the food supply chain. In Delivering Performance in Food Supply Chains; Mena, C., Stevens, G., Eds.; Woodhead Publishing: Sawston, UK, 2010; pp. 366–386. [Google Scholar]
  6. Stahl, V.; Ndoye, F.T.; El Jabri, M.; Le Page, J.F.; Hezard, B.; Lintz, A.; Geeraerd, A.; Alvarez, G.; Thuault, D. Safety and quality assessment of ready-to-eat pork products in the cold chain. J. Food Eng. 2015, 148, 43–52. [Google Scholar] [CrossRef]
  7. Che, H.; Li, C.; Zhu, L.; Zhou, G. Effects of chilling condition and time on evaporative loss of pork carcasses during chilling. Food Sci. 2016, 37, 242–246. [Google Scholar]
  8. McMullen, L.M.; Stiles, M.E. Potential for use of bacteriocin-producing lactic acid bacteria in the preservation of meats. J. Food Prot. 1996, 59, 64–71. [Google Scholar] [CrossRef]
  9. Benson, A.K.; David, J.R.D.; Gilbreth, S.E.; Smith, G.; Nietfeldt, J.; Legge, R.; Kim, J.; Sinha, R.; Duncan, C.E.; Ma, J.; et al. Microbial successions are associated with changes in chemical profiles of a model refrigerated fresh pork sausage during an 80-day shelf life study. Appl. Environ. Microbiol. 2014, 80, 5178–5194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Doulgeraki, A.I.; Ercolini, D.; Villani, F.; Nychas, G.J. Spoilage microbiota associated to the storage of raw meat in different conditions. Int. J. Food Microbiol. 2012, 157, 130–141. [Google Scholar] [CrossRef] [PubMed]
  11. Chaillou, S.; Chaulot-Talmon, A.; Caekebeke, H.; Cardinal, M.; Christieans, S.; Denis, C.; Desmonts, M.H.; Dousset, X.; Feurer, C.; Hamon, E.; et al. Origin and ecological selection of core and food-specific bacterial communities associated with meat and seafood spoilage. ISME J. 2015, 9, 1105–1118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Li, L.; Olsen, R.H.; Ye, L.; Yan, H.; Nie, Q.; Meng, H.; Shi, L. Antimicrobial resistance and resistance genes in aerobic bacteria isolated from pork at slaughter. J. Food Prot. 2016, 79, 589–597. [Google Scholar] [CrossRef]
  13. Haller, M.Y.; Müller, S.R.; Mcardell, C.S.; Alder, A.C.; Suter, M.J.F. Quantification of veterinary antibiotics (sulfonamides and trimethoprim) in animal manure by liquid chromatography–mass spectrometry. J. Chromatogr A 2002, 952, 111–120. [Google Scholar] [CrossRef]
  14. Economou, V.; Gousia, P. Agriculture and food animals as a source of antimicrobial-resistant bacteria. Infect. Drug Resist. 2015, 8, 49–61. [Google Scholar] [CrossRef] [Green Version]
  15. Cheng, W.; Chen, H.; Su, C.; Yan, S. Abundance and persistence of antibiotic resistance genes in livestock farms: A comprehensive investigation in eastern China. Environ. Int. 2013, 61, 1–7. [Google Scholar] [CrossRef]
  16. Zhu, Y.G.; Johnson, T.A.; Su, J.Q.; Qiao, M.; Guo, G.X.; Stedtfeld, R.D.; Hashsham, S.A.; Tiedje, J.M. Diverse and abundant antibiotic resistance genes in Chinese swine farms. Proc. Natl. Acad. Sci. USA 2013, 110, 3435–3440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Tao, C.W.; Hsu, B.M.; Ji, W.T.; Hsu, T.K.; Kao, P.M.; Hsu, C.P.; Shen, S.M.; Shen, T.Y.; Wan, T.J.; Huang, Y.L. Evaluation of five antibiotic resistance genes in wastewater treatment systems of swine farms by real-time PCR. Sci. Total Environ. 2014, 496, 116–121. [Google Scholar] [CrossRef] [PubMed]
  18. Ho, P.L.; Wong, R.C.; Lo, S.W.; Chow, K.H.; Wong, S.S.; Que, T.L. Genetic identity of aminoglycoside-resistance genes in Escherichia coli isolates from human and animal sources. J. Med. Microbiol. 2010, 59, 702–707. [Google Scholar] [CrossRef] [PubMed]
  19. Qiao, M.; Chen, W.; Su, J.; Zhang, B.; Zhang, C. Fate of tetracyclines in swine manure of three selected swine farms in China. J. Environ. Sci. 2012, 24, 1047–1052. [Google Scholar] [CrossRef]
  20. Martinez, J.L. Antibiotics and antibiotic resistance genes in natural environments. Science 2008, 321, 365–367. [Google Scholar] [CrossRef]
  21. Wright, G.D. The antibiotic resistome: The nexus of chemical and genetic diversity. Nat. Rev. Microbiol. 2007, 5, 175–186. [Google Scholar] [CrossRef] [PubMed]
  22. Tang, Y. Application of Computational Fluid Dynamics to Air Flow Optimization for the Cold Store. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2013. [Google Scholar]
  23. Xie, J.; Qu, X.H.; Xu, S.Q. Numerical simulation and verification of airflow in cold-store. Trans. Chin. Soc. Agric. Eng. 2005, 21, 11–16. [Google Scholar]
  24. Li, M.Y.; Zhou, G.H.; Xu, X.L.; Li, C.B.; Zhu, W.Y. Changes of bacterial diversity and main flora in chilled pork during storage using PCR-DGGE. Food Microbiol. 2006, 23, 607–611. [Google Scholar] [CrossRef]
  25. Gill, C.O. Extending the storage life of raw chilled meats. Meat Sci. 1996, 43, 99–109. [Google Scholar] [CrossRef]
  26. Backhed, F.; Ley, R.E.; Sonnenburg, J.L.; Peterson, D.A.; Gordon, J.L. Host-bacterial mutualism in the human intestine. Science 2005, 307, 1915–1920. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Caporaso, J.G.; Lauber, C.L.; Costello, E.K.; Berg-Lyons, D.; Gonzalez, A.; Stombaugh, J.; Knights, D.; Gajer, P.; Ravel, J.; Fierer, N.; et al. Moving pictures of the human microbiome. Genome Biol. 2011, 12, R50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Costello, E.K.; Lauber, C.L.; Hamady, M.; Fierer, N.; Gordon, J.I.; Knight, R. Bacterial community variation in human body habitats across space and time. Science 2009, 326, 1694–1697. [Google Scholar] [CrossRef] [Green Version]
  29. Faith, J.J.; Guruge, J.L.; Charbonneau, M.; Subramanian, S.; Seedorf, H.; Goodman, A.L.; Clemente, J.C.; Knight, R.; Heath, A.C.; Leibel, R.L.; et al. The long-term stability of the human gut microbiota. Science 2013, 341, 1237439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Li, B.; Yang, Y.; Ma, L.; Ju, F.; Guo, F.; Tiedje, J.M.; Zhang, T. Metagenomic and network analysis reveal wide distribution and co-occurrence of environmental antibiotic resistance genes. ISME J. 2015, 9, 2490–2502. [Google Scholar] [CrossRef] [Green Version]
  31. He, L.Y.; Ying, G.G.; Liu, Y.S.; Su, H.C.; Chen, J.; Liu, S.S.; Zhao, J.L. Discharge of swine wastes risks water quality and food safety: Antibiotics and antibiotic resistance genes, from swine sources to the receiving environments. Environ. Int. 2016, 92, 210–219. [Google Scholar] [CrossRef] [PubMed]
  32. Fang, H.; Han, L.; Zhang, H.; Long, Z.; Cai, L.; Yu, Y. Dissemination of antibiotic resistance genes and human pathogenic bacteria from a pig feedlot to the surrounding stream and agricultural soils. J. Hazard. Mater. 2018, 357, 53–62. [Google Scholar] [CrossRef]
  33. Qian, X.; Gu, J.; Sun, W.; Wang, X.J.; Su, J.Q.; Stedfeld, R. Diversity, abundance, and persistence of antibiotic resistance genes in various types of animal manure following industrial composting. J. Hazard. Mater. 2017, 344, 716–722. [Google Scholar] [CrossRef]
  34. Kyselková, M.; Jirout, J.; Vrchotová, N.; Schmitt, H.; Elhottova, D. Spread of tetracycline resistance genes at a conventional dairy farm. Front. Microbiol. 2015, 6, 536. [Google Scholar] [CrossRef] [Green Version]
  35. Ma, L.; Xia, Y.; Li, B.; Yang, Y.; Li, L.G.; Tiedje, J.M.; Zhang, T. Metagenomic assembly reveals hosts of antibiotic resistance genes and the shared resistome in pig, chicken, and human feces. Environ. Sci. Technol. 2015, 50, 420–427. [Google Scholar] [CrossRef]
  36. Chee-Sanford, J.C.; Aminov, R.I.; Krapac, I.; Garrigues-Jeanjean, N.; Mackie, R.I. Occurrence and diversity of tetracycline resistance genes in lagoons and groundwater underlying two swine production facilities. Appl. Environ. Microbiol. 2001, 67, 1494–1502. [Google Scholar] [CrossRef] [Green Version]
  37. McKinney, C.W.; Loftin, K.A.; Meyer, M.T.; Davis, J.G.; Pruden, A. Tet and sul antibiotic resistance genes in livestock lagoons of various operation type, configuration, and antibiotic occurrence. Environ. Sci. Technol. 2010, 44, 6102–6109. [Google Scholar] [CrossRef] [PubMed]
  38. Knapp, C.W.; Dolfing, J.; Ehlert, P.A.; Graham, D.W. Evidence of increasing antibiotic resistance gene abundances in archived soils since 1940. Environ. Sci. Technol. 2009, 44, 580–587. [Google Scholar] [CrossRef] [PubMed]
  39. Gillings, M.R.; Stokes, H. Are humans increasing bacterial evolvability? Trends Ecol. Evol. 2012, 27, 346–352. [Google Scholar] [CrossRef] [PubMed]
Figure 1. 3D model of chiller and pig carcass after cooling for 0 h (a) and 8 h (b).
Figure 1. 3D model of chiller and pig carcass after cooling for 0 h (a) and 8 h (b).
Foods 10 02195 g001
Figure 2. Grid division structure diagram of chiller after cooling for 0 h (a) and 8 h (b).
Figure 2. Grid division structure diagram of chiller after cooling for 0 h (a) and 8 h (b).
Foods 10 02195 g002
Figure 3. Shannon–Wiener curves of air (a), foreleg (b), and thorax (c) microbial samples throughout the cooling process.
Figure 3. Shannon–Wiener curves of air (a), foreleg (b), and thorax (c) microbial samples throughout the cooling process.
Foods 10 02195 g003aFoods 10 02195 g003b
Figure 4. Rank-abundance curves of air (a), foreleg (b), and thorax (c) microorganisms throughout the cooling process.
Figure 4. Rank-abundance curves of air (a), foreleg (b), and thorax (c) microorganisms throughout the cooling process.
Foods 10 02195 g004aFoods 10 02195 g004b
Figure 5. Venn diagrams of air (a), foreleg (b), and thorax (c) microorganisms throughout the cooling process.
Figure 5. Venn diagrams of air (a), foreleg (b), and thorax (c) microorganisms throughout the cooling process.
Foods 10 02195 g005
Figure 6. Community structure components of air (a), foreleg (b), and thorax (c) microorganisms at the phylum level.
Figure 6. Community structure components of air (a), foreleg (b), and thorax (c) microorganisms at the phylum level.
Foods 10 02195 g006aFoods 10 02195 g006b
Figure 7. Community structure components of air (a), foreleg (b), and thorax (c) microorganisms at the genus level.
Figure 7. Community structure components of air (a), foreleg (b), and thorax (c) microorganisms at the genus level.
Foods 10 02195 g007aFoods 10 02195 g007b
Figure 8. Venn diagrams of microorganisms at three locations (“A” in the figure represented air microorganisms, “FL” represented forelegs microorganisms, and “TC” represented thoracic microorganisms) during the same cooling time ((ag) were cooling for 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, and 14 h, respectively).
Figure 8. Venn diagrams of microorganisms at three locations (“A” in the figure represented air microorganisms, “FL” represented forelegs microorganisms, and “TC” represented thoracic microorganisms) during the same cooling time ((ag) were cooling for 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, and 14 h, respectively).
Foods 10 02195 g008aFoods 10 02195 g008b
Table 1. The primer sequences of selected drug-resistant genes.
Table 1. The primer sequences of selected drug-resistant genes.
GeneForwardReverse
16S rRNAGCTCGTGTCGTGAGATGTTTGTAGCCCAGGTCATAAGG
sul ⅠCACCGGAAACATCGCTGCAAAGTTCCGCCGCAAGGCT
sul ⅡCTCCGATGGAGGCCGGTATGGGAATGCCATCTGCCTTGA
blaSHVAGCCGCTTGAGCAAATTAAACATCCCGCAGATAAATCACCAC
blaTEMCATTTCCGTGTCGCCCTTATTCCGTTCATCCATAGTTGCCTGAC
ermAAAGCGGTAAAACCCCTCGAGTCAAAGCCTGTCGGATTGG
ermBGAAAAGGTACTCAACCAAATACATTTGTTAAATTCATGGCAATGA
ermCTCAAAACATAATATAGATAAAGCTAATATTGTTTAAATCGTCAAT
qepAAACTGCTTGAGCCCGTAGATGTCTACGCCATGGACCTCAC
blaCTX-M-2CGTTAACGGCACGATGACCGATATCGTTGGTGGTRCCAT
aac(6′)-Ib-crTTGCGATGCTCTATGAGTGGCTACTCGAATGCCTGGCGTGTTT
tetAGCTACATCCTGCTTGCCTTCCATAGATCGCCGTGAAGAGG
tetCCTTGAGAGCCTTCAACCCAGATGGTCGTCATCTACCTGCC
tetMGTGGACAAAGGTACAACGAGCGGTAAAGTTCGTCACACAC
qnrAAGAGGATTTCTCACGCCAGGTGCCAGGCACAGATCTTGAC
Table 2. Measured values of temperature and humidity at the outlet and door and grid division of the chiller.
Table 2. Measured values of temperature and humidity at the outlet and door and grid division of the chiller.
Chilling Time/hOutlet Temperature/°COutlet Humidity/%Door Temperature/°CDoor Humidity/%Number of Grids/PieceGrid Type
0 h8971098786,360Structured
2 h109412991,848,737Unstructured
4 h119712991,934,154Unstructured
6 h1298131002,424,042Unstructured
8 h1298131002,638,668Unstructured
10 h108610862,638,668Unstructured
12 h6836832,638,668Unstructured
14 h3743742,638,668Unstructured
Table 3. Fluid simulation of wind speed, temperature, and humidity in a chiller.
Table 3. Fluid simulation of wind speed, temperature, and humidity in a chiller.
Time/hWind Speed (Air flow)TemperatureHumidity
0 h Foods 10 02195 i001 Foods 10 02195 i002 Foods 10 02195 i003
2 h Foods 10 02195 i004 Foods 10 02195 i005 Foods 10 02195 i006
4 h Foods 10 02195 i007 Foods 10 02195 i008 Foods 10 02195 i009
6 h Foods 10 02195 i010 Foods 10 02195 i011 Foods 10 02195 i012
8 h Foods 10 02195 i013 Foods 10 02195 i014 Foods 10 02195 i015
10 h Foods 10 02195 i016 Foods 10 02195 i017 Foods 10 02195 i018
12 h Foods 10 02195 i019 Foods 10 02195 i020 Foods 10 02195 i021
14 h Foods 10 02195 i022 Foods 10 02195 i023 Foods 10 02195 i024
In the wind speed diagrams, different colors represent different wind speeds. The more biased the red color is, the higher the wind speed, and the more biased the blue, the lower the wind speed. Different colors represent different temperatures, and the more biased the red color iss, the higher the temperature, and the more biased the blue, the lower the temperature. The more biased the red, the higher the humidity, and the more biased the blue, the lower the humidity.
Table 4. Incidence of drug-resistant genes in microbiota samples from the air and the surface of pleural cavity and foreleg.
Table 4. Incidence of drug-resistant genes in microbiota samples from the air and the surface of pleural cavity and foreleg.
LocationsTime/hsul Ⅰsul ⅡblaSHVblaTEMermAermBermCqepAblaCTX-M-2aac(6′)-Ib-crtetAtetCtetMqnrA
Airborne0 h+/+/++/+/+-/+/-+/+/+-/+/+-/-/--/-/-+/+/+-/+/++/-/++/+/++/+/--/+/++/-/+
2 h+/+/++/+/++/+/-+/+/++/+/+-/-/--/-/-+/+/++/+/++/+/-+/+/++/+/--/-/++/+/+
4 h+/+/++/+/--/-/-+/+/++/+/+-/-/--/-/-+/+/++/+/+-/-/-+/+/++/+/++/-/++/+/+
6 h+/+/++/+/+-/+/++/+/++/+/+-/-/--/-/-+/+/++/+/++/+/++/+/++/+/+-/+/++/+/+
8 h+/+/++/+/+-/+/-+/+/+-/-/+-/+/--/-/-+/+/++/+/++/+/++/+/++/+/+-/+/++/+/+
10 h+/+/++/+/+-/+/++/+/++/+/+-/-/+-/-/-+/+/++/+/+-/+/++/+/++/+/++/+/++/+/+
12 h+/+/++/+/+-/-/--/+/++/+/+-/-/+-/-/-+/+/++/+/++/+/++/+/+-/+/+-/+/++/+/+
14 h+/+/++/+/+-/+/--/+/--/-/--/+/--/-/-+/+/++/+/+-/+/-+/+/++/+/--/+/-+/-/-
Pleural cavity2 h+/+/++/+/++/+/++/-/-+/+/+-/-/+-/-/-+/+/--/+/++/+/++/+/++/+/++/+/++/+/-
4 h+/+/++/+/++/+/-+/+/++/+/+-/+/--/-/-+/+/++/+/++/+/-+/+/++/+/+-/+/++/+/+
6 h+/+/++/+/++/+/-+/+/++/-/+-/-/--/-/-+/+/++/+/++/+/++/+/++/+/-+/+/-+/+/+
8 h+/+/++/+/++/-/-+/+/++/+/+-/-/--/-/-+/+/++/+/+-/+/-+/+/++/+/++/+/++/+/+
10 h+/+/++/+/+-/+/++/+/+-/-/++/-/--/-/-+/+/++/+/++/+/-+/+/++/+/++/-/++/+/+
12 h+/+/++/+/+-/+/--/+/++/+/+-/+/--/-/-+/+/++/+/++/+/-+/+/++/+/++/+/++/+/+
14 h+/+/++/+/++/-/-+/+/++/+/+-/-/--/-/-+/-/++/+/+-/-/++/+/++/+/++/+/++/-/+
Foreleg2 h+/+/++/+/+-/-/--/-/+-/-/+-/-/+-/-/--/-/-+/-/++/+/++/+/+-/+/+-/-/-+/-/-
4 h+/+/++/+/+-/+/--/+/++/+/+-/-/--/-/-+/+/++/+/+-/-/-+/+/++/-/++/-/++/+/+
6 h+/+/++/+/+-/-/-+/+/++/+/+-/-/--/-/-+/+/++/+/+-/+/++/+/++/+/++/+/+-/+/+
8 h+/+/++/+/+-/-/-+/+/++/-/++/+/+-/-/-+/+/++/-/++/-/++/+/++/+/++/+/++/+/+
10 h+/+/++/+/+-/-/+-/+/++/+/--/+/--/-/-+/-/++/+/+-/-/-+/+/++/+/++/+/++/+/+
12 h+/+/++/+/++/-/--/+/-+/+/+-/+/+-/-/--/+/-+/+/++/+/-+/+/++/+/++/-/++/+/-
14 h+/+/++/+/+-/+/--/-/-+/-/--/-/+-/-/-+/-/-+/+/+-/-/-+/+/++/+/++/-/--/-/+
Note: “+”, detected; “-” not detected.
Table 5. Relative abundance of drug-resistant genes in microbiota samples from the air and the surface of pleural cavity and foreleg.
Table 5. Relative abundance of drug-resistant genes in microbiota samples from the air and the surface of pleural cavity and foreleg.
LocationsTime/hsul Ⅰsul ⅡblaSHVblaTEMermAqepAblaCTX-M-2aac(6′)-Ib-crtetAtetCtetMqnrA
airborne0 h1.000 Aa1.000 Aa1.000 Ba1.000 Ca1.000 Aa1.000 Aa1.000 Aa1.000 Ba1.000 Aa1.000 Aa1.000 Aa
2 h0.001 Eg0.002 Ff0.001 Cg0.029 Ec0.394 Ea0.000 Ch0.001 Eg0.002 Df0.021 Fd0.047 Db0.008 Ee
4 h0.360 Ce0.025 Cj1.261 Ac3.228 Ab0.110 Bh0.076 Bi4.736 Aa0.375 Bd0.211 Bf0.189 Bg
6 h0.017 Dg0.002 Fj0.004 Bi0.119 Dc0.465 Da0.000 Ck0.013 Dh0.027 Be0.033 Ed0.171 Cb0.022 Cf0.022 Df
8 h0.000 Fd0.105 Ba0.005 Gb0.000 Cd0.000 Fd0.000 Fd0.000 Hd0.000 Hd0.000 Ed0.004 Fc
10 h0.391 Bc0.011 Dj0.006 Ak0.948 Cb2.415 Ba0.000 Cl0.020 Cg0.025 Cf0.181 Cd0.013 Eh0.012 Di0.085 Ce
12 h0.001 Eg0.010 Ec0.028 Fa0.025 Fb0.000 Ch0.001 Eg0.001 Eg0.008 Gd0.005 Fe0.000 Eh0.002 Gf
14 h0.000 Fd0.025 Cb0.000 Cd0.001 Ec0.034 Da0.001 Gc
Pleural cavity2 h1.000 Ba1.000 Fa1.000 Aa1.000 Da1.000 Ba1.000 Aa1.000 Ba1.000 Fa1.000 Ba1.000 Ba1.000 Ca
4 h0.636 Ci3.283 Ad0.879 Bh0.328 Al19.569 Aa0.600 Cj0.511 Bk2.333 Ae15.653 Ab12.966 Ac1.293 Ag1.761 Bf
6 h0.087 Fa0.000 Gc0.000 Dc0.000 Fc0.000 Fc0.000 Gc0.001 Gb0.000 Ec0.001 Gb0.000 Gc0.000 Gc0.001 Gb
8 h0.030 Gh1.716 Db0.022 Ei0.148 Ed0.057 Df0.050 Fg8.528 Ba0.016 Fj0.125 De0.190 Ec
10 h1.162 Ad1.874 Bc0.131 Ch0.260 Bf1.102 Ae0.164 Dg0.120 Di2.939 Ca0.049 Ek0.075 Fj2.304 Ab
12 h0.323 De1.522 Ec0.209 Cf1.847 Cb0.046 Ek0.108 Eh0.158 Cg1.882 Ea0.060 Dj0.092 Ei0.944 Dd
14 h0.211 Ee1.821 Cc0.068 Di5.890 Ba0.011 Fj0.207 Cf2.396 Db0.156 Ch0.313 Cd0.159 Fg
Foreleg2 h1.000 Fa1.000 Ga1.000 Aa1.000 Aa1.000 Ea1.000 Aa
4 h1.341 Cc5.474 Fa0.051 Ag0.216 Ae0.453 Cd2.674 Bb0.008 Bh0.085 Af
6 h1.131 Db12.416 Ba0.009 Ch0.160 Cd0.087 Ee0.018 Cf0.922 Fc0.000 Di0.011 Cg
8 h0.559 Gc7.694 Da0.001 Df0.003 Ed0.001 Gf0.001 Df0.675 Gb0.000 Dg0.002 Ee
10 h1.016 Ec14.536 Aa0.014 Bf0.178 Bd0.051 Fe1.856 Cb0.000 Dh0.006 Dg
12 h3.631 Ab9.891 Ca0.126 Df0.616 Bd0.146 Be1.240 Dc0.001 Ch0.024 Bg
14 h1.954 Bc6.620 Ea0.115 Dd3.131 Ab0.000 De
Note: Different uppercase letters in the same column indicate significant differences among time points (p < 0.05), and different lowercase letters in the same row indicate significant differences among genes (p < 0.05).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Jia, X.; Nian, Y.; Zhao, D.; Wu, J.; Li, C. Changes of the Microbiota Composition on the Surface of Pig Carcasses during Chilling and Its Associations with Alterations in Chiller’s Temperature and Air Humidity. Foods 2021, 10, 2195. https://doi.org/10.3390/foods10092195

AMA Style

Jia X, Nian Y, Zhao D, Wu J, Li C. Changes of the Microbiota Composition on the Surface of Pig Carcasses during Chilling and Its Associations with Alterations in Chiller’s Temperature and Air Humidity. Foods. 2021; 10(9):2195. https://doi.org/10.3390/foods10092195

Chicago/Turabian Style

Jia, Xiaonan, Yingqun Nian, Di Zhao, Juqing Wu, and Chunbao Li. 2021. "Changes of the Microbiota Composition on the Surface of Pig Carcasses during Chilling and Its Associations with Alterations in Chiller’s Temperature and Air Humidity" Foods 10, no. 9: 2195. https://doi.org/10.3390/foods10092195

APA Style

Jia, X., Nian, Y., Zhao, D., Wu, J., & Li, C. (2021). Changes of the Microbiota Composition on the Surface of Pig Carcasses during Chilling and Its Associations with Alterations in Chiller’s Temperature and Air Humidity. Foods, 10(9), 2195. https://doi.org/10.3390/foods10092195

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop