Role of IL-6/STAT3 Axis in Resistance to Cisplatin in Gastric Cancers
Abstract
1. Introduction
2. Materials and Methods
2.1. Bioinformatics Analysis
2.2. Chemicals
2.3. Cell Cultures
2.4. Apoptosis Assay
2.5. Western Blot Analysis
2.6. RNA Extraction and cDNA Synthesis
2.7. Real Time
2.8. IL-6 Detection by ELISA Assay
2.9. Statistical Analysis
3. Results
3.1. STAT3 Upregulation in Patients Affected by Gastric Cancer Treated with Cisplatin/Oxaliplatin
3.2. STAT3 Expression Is Upregulated in Human Gastric Cancer Cell Lines Derived from Metastatic Sites Exposed to Cisplatin
3.3. Combined Treatment with Cisplatin and STAT3 Inhibitor Enhances GC Cell Response to Cisplatin
3.4. The Exposure to Cisplatin Induces a Modulation of the JAK/STAT Pathway in GC Cells
3.5. IL-6 Secretion Mediates STAT3 Upregulation in Response to Cisplatin
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Van Cutsem, E.; Sagaert, X.; Topal, B.; Haustermans, K.; Prenen, H. Gastric cancer. Lancet 2016, 388, 2654–2664. [Google Scholar] [CrossRef] [PubMed]
- Cunningham, D.; Starling, N.; Rao, S.; Iveson, T.; Nicolson, M.; Coxon, F.; Middleton, G.; Daniel, F.; Oates, J.; Norman, A.R. Upper Gastrointestinal Clinical Studies Group of the National Cancer Research Institute of the United Kingdom Capecitabine and oxaliplatin for advanced esophagogastric cancer. N. Engl. J. Med. 2008, 358, 36–46. [Google Scholar] [CrossRef] [PubMed]
- Chhetri, P.; Giri, A.; Shakya, S.; Shakya, S.; Sapkota, B.; Pramod, K.C. Current Development of Anti-Cancer Drug S-1. J. Clin. Diagn. Res. 2016, 10, XE01–XE05. [Google Scholar] [CrossRef]
- Roviello, G.; Catalano, M.; Iannone, L.F.; Marano, L.; Brugia, M.; Rossi, G.; Aprile, G.; Antonuzzo, L. Current status and future perspectives in HER2 positive advanced gastric cancer. Clin. Transl. Oncol. 2022, 24, 981–996. [Google Scholar] [CrossRef]
- Charalampakis, N.; Economopoulou, P.; Kotsantis, I.; Tolia, M.; Schizas, D.; Liakakos, T.; Elimova, E.; Ajani, J.A.; Psyrri, A. Medical management of gastric cancer: A 2017 update. Cancer Med. 2018, 7, 123–133. [Google Scholar] [CrossRef] [PubMed]
- Foronda, M. Front-line immunotherapy combinations for gastric cancer. Nat. Cancer 2021, 2, 1286. [Google Scholar] [CrossRef] [PubMed]
- Costa, G.; Younes, H.; Kourie, H.R.; Kattan, J. The rapidly evolving landscape of advanced gastric cancer therapy. Future Oncol. 2022, 18, 1413–1416. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, S.; Figueiredo, C. Recent insights into the use of immune checkpoint inhibitors in gastric cancer. Porto. Biomed. J. 2022, 7, 162. [Google Scholar] [CrossRef] [PubMed]
- Notarangelo, T.; Sisinni, L.; Condelli, V.; Landriscina, M. Dual EGFR and BRAF blockade overcomes resistance to vemurafenib in BRAF mutated thyroid carcinoma cells. Cancer Cell Int. 2017, 17, 86. [Google Scholar] [CrossRef] [PubMed]
- Laurino, S.; Mazzone, P.; Ruggieri, V.; Zoppoli, P.; Calice, G.; Lapenta, A.; Ciuffi, M.; Ignomirelli, O.; Vita, G.; Sgambato, A.; et al. Cationic Channel TRPV2 Overexpression Promotes Resistance to Cisplatin-Induced Apoptosis in Gastric Cancer Cells. Front. Pharmacol. 2021, 12, 746628. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Yang, Z.; Nie, Y.; Shi, Y.; Fan, D. Multidrug resistance in cancer chemotherapeutics: Mechanisms and lab approaches. Cancer Lett. 2014, 347, 159–166. [Google Scholar] [CrossRef] [PubMed]
- Gottesman, M.M. Mechanisms of cancer drug resistance. Annu. Rev. Med. 2002, 53, 615–627. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, Z.; Ajani, J.A.; Song, S. Drug resistance and Cancer stem cells. Cell Commun. Signal. 2021, 19, 19. [Google Scholar] [CrossRef] [PubMed]
- Ajani, J.A.; D’Amico, T.A.; Bentrem, D.J.; Chao, J.; Cooke, D.; Corvera, C.; Das, P.; Enzinger, P.C.; Enzler, T.; Fanta, P.; et al. Gastric cancer, version 2.2022, NCCN clinical practice guidelines in oncology. J. Natl. Compr. Canc. Netw. 2022, 20, 167–192. [Google Scholar] [CrossRef] [PubMed]
- GASTRIC (Global Advanced/Adjuvant Stomach Tumor Research International Collaboration) Group; Oba, K.; Paoletti, X.; Bang, Y.-J.; Bleiberg, H.; Burzykowski, T.; Fuse, N.; Michiels, S.; Morita, S.; Ohashi, Y.; et al. Role of chemotherapy for advanced/recurrent gastric cancer: An individual-patient-data meta-analysis. Eur. J. Cancer 2013, 49, 1565–1577. [Google Scholar]
- Wang, M.; Yu, F.; Zhang, Y.; Zhang, L.; Chang, W.; Wang, K. The emerging roles of circular rnas in the chemoresistance of gastrointestinal cancer. Front. Cell Dev. Biol. 2022, 10, 821609. [Google Scholar] [CrossRef]
- Kim, H.-B.; Lee, H.-J.; Kim, G.-B.; Lim, H.-J.; Park, J.H.; Park, S.-G. Clinical Significance of Jagged-1 Activated by APEX1 as a Chemoresistance Factor in Advanced Gastric Cancer. Anticancer Res. 2020, 40, 1897–1904. [Google Scholar] [CrossRef]
- Fang, Z.; Gong, C.; Ye, Z.; Wang, W.; Zhu, M.; Hu, Y.; Liu, Z.; Zhou, W.; Li, H. TOPBP1 regulates resistance of gastric cancer to oxaliplatin by promoting transcription of PARP1. DNA Repair 2022, 111, 103278. [Google Scholar] [CrossRef]
- Sosonkina, N.; Starenki, D.; Park, J.-I. The role of STAT3 in thyroid cancer. Cancers 2014, 6, 526–544. [Google Scholar] [CrossRef]
- Bromberg, J.F.; Wrzeszczynska, M.H.; Devgan, G.; Zhao, Y.; Pestell, R.G.; Albanese, C.; Darnell, J.E. Stat3 as an oncogene. Cell 1999, 98, 295–303. [Google Scholar] [CrossRef] [PubMed]
- Bowman, T.; Garcia, R.; Turkson, J.; Jove, R. STATs in oncogenesis. Oncogene 2000, 19, 2474–2488. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; Cao, J.; Wu, J.; Sullivan, K.; Shen, J.; Ryu, B.; Xu, Z.; Wei, W.; Cui, R. Stat3-targeted therapies overcome the acquired resistance to vemurafenib in melanomas. J. Investig. Dermatol. 2013, 133, 2041–2049. [Google Scholar] [CrossRef] [PubMed]
- Darnell, J.E. Validating Stat3 in cancer therapy. Nat. Med. 2005, 11, 595–596. [Google Scholar] [CrossRef]
- Chapman, P.B.; Hauschild, A.; Robert, C.; Haanen, J.B.; Ascierto, P.; Larkin, J.; Dummer, R.; Garbe, C.; Testori, A.; Maio, M.; et al. BRIM-3 Study Group Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N. Engl. J. Med. 2011, 364, 2507–2516. [Google Scholar] [CrossRef]
- Yun, M.R.; Choi, H.M.; Kang, H.N.; Lee, Y.; Joo, H.S.; Kim, D.H.; Kim, H.R.; Hong, M.H.; Yoon, S.O.; Cho, B.C. ERK-dependent IL-6 autocrine signaling mediates adaptive resistance to pan-PI3K inhibitor BKM120 in head and neck squamous cell carcinoma. Oncogene 2018, 37, 377–388. [Google Scholar] [CrossRef]
- Gobert, A.P.; Wilson, K.T. Induction and Regulation of the Innate Immune response in Helicobacter pylori Infection. Cell Mol. Gastroenterol. Hepatol. 2022, 13, 1347–1363. [Google Scholar] [CrossRef]
- Notarangelo, T.; Sisinni, L.; Trino, S.; Calice, G.; Simeon, V.; Landriscina, M. IL6/STAT3 axis mediates resistance to BRAF inhibitors in thyroid carcinoma cells. Cancer Lett. 2018, 433, 147–155. [Google Scholar] [CrossRef]
- Heinrich, P.C.; Behrmann, I.; Haan, S.; Hermanns, H.M.; Müller-Newen, G.; Schaper, F. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem. J. 2003, 374, 1–20. [Google Scholar] [CrossRef]
- Yang, H.; Yamazaki, T.; Pietrocola, F.; Zhou, H.; Zitvogel, L.; Ma, Y.; Kroemer, G. STAT3 inhibition enhances the therapeutic efficacy of immunogenic chemotherapy by stimulating type 1 interferon production by cancer cells. Cancer Res. 2015, 75, 3812–3822. [Google Scholar] [CrossRef]
- Rotz, S.J.; Leino, D.; Szabo, S.; Mangino, J.L.; Turpin, B.K.; Pressey, J.G. Severe cytokine release syndrome in a patient receiving PD-1-directed therapy. Pediatr. Blood Cancer 2017, 64, e26642. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.H.; Kuo, M.L.; Chen, C.A.; Chou, C.H.; Cheng, W.F.; Chang, M.C.; Su, J.L.; Hsieh, C.Y. The anti-apoptotic role of interleukin-6 in human cervical cancer is mediated by up-regulation of Mcl-1 through a PI 3-K/Akt pathway. Oncogene 2001, 20, 5799–5809. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Lv, X.; Kong, Q.; Tan, Y. IL-6/IFN-γ double knockdown CAR-T cells reduce the release of multiple cytokines from PBMCs in vitro. Hum. Vaccin. Immunother. 2022, 18, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Tay, S.H.; Toh, M.M.X.; Thian, Y.L.; Vellayappan, B.A.; Fairhurst, A.M.; Chan, Y.H.; Aminkeng, F.; Bharwani, L.D.; Huang, Y.; Mak, A.; et al. Cytokine Release Syndrome in Cancer Patients Receiving Immune Checkpoint Inhibitors: A Case Series of 25 Patients and Review of the Literature. Front. Immunol. 2022, 13, 807050. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Meng, W.-J.; Wang, Z.-Q. Cancer stem cells and the tumor microenvironment in gastric cancer. Front. Oncol. 2021, 11, 803974. [Google Scholar] [CrossRef] [PubMed]
- Ashizawa, T.; Okada, R.; Suzuki, Y.; Takagi, M.; Yamazaki, T.; Sumi, T.; Aoki, T.; Ohnuma, S.; Aoki, T. Clinical significance of interleukin-6 (IL-6) in the spread of gastric cancer: Role of IL-6 as a prognostic factor. Gastric Cancer 2005, 8, 124–131. [Google Scholar] [CrossRef] [PubMed]
- Minichsdorfer, C.; Wasinger, C.; Sieczkowski, E.; Atil, B.; Hohenegger, M. Tocilizumab unmasks a stage-dependent interleukin-6 component in statin-induced apoptosis of metastatic melanoma cells. Melanoma Res. 2015, 25, 284–294. [Google Scholar] [CrossRef]
- Rahman, M.A.; Salajegheh, A.; Smith, R.A.; Lam, A.K. BRAF inhibitor therapy for melanoma, thyroid and colorectal cancers: Development of resistance and future prospects. Curr. Cancer Drug Targets 2014, 14, 128–143. [Google Scholar] [CrossRef]
- Dixon, B.R.E.A.; Lee, T.J.; Contreras Healey, D.C.; Li, J.; Goettel, J.A.; Piazuelo, M.B.; Algood, H.M.S. IL-17 Receptor Signaling through IL-17A or IL-17F Is Sufficient to Maintain Innate Response and Control of Helicobacter pylori Immunopathogenesis. Immunohorizons 2022, 6, 116–129. [Google Scholar] [CrossRef]
- Yong, W.P.; Rha, S.Y.; Tan, I.B.-H.; Choo, S.-P.; Syn, N.L.; Koh, V.; Tan, S.-H.; Asuncion, B.R.; Sundar, R.; So, J.B.-Y.; et al. Singapore Gastric Cancer Consortium (SGCC) Real-Time Tumor Gene Expression Profiling to Direct Gastric Cancer Chemotherapy: Proof-of-Concept “3G” Trial. Clin. Cancer Res. 2018, 24, 5272–5281. [Google Scholar] [CrossRef]
- Sale, J.E.; Stoddard, B.L. Editor’s Note to ‘Autoregulatory circuit of human rpL3 expression requires hnRNP H1, NPM and KHSRP’. Nucleic Acids Res. 2022, 50, 11999. [Google Scholar]
- Kassambara, A. “ggplot2” Based Publication Ready Plots, R Package Ggpubr Version 0.4.0. 2020.
- Tagliaferri, D.; Mazzone, P.; Noviello, T.M.R.; Addeo, M.; Angrisano, T.; Del Vecchio, L.; Visconte, F.; Ruggieri, V.; Russi, S.; Caivano, A.; et al. Retinoic Acid Induces Embryonic Stem Cells (ESCs) Transition to 2 Cell-Like State Through a Coordinated Expression of Dux and Duxbl1. Front. Cell Dev. Biol. 2019, 7, 385. [Google Scholar] [CrossRef] [PubMed]
- Gao, S.; Li, S.; Duan, X.; Gu, Z.; Ma, Z.; Yuan, X.; Feng, X.; Wang, H. Inhibition of glycogen synthase kinase 3 beta (GSK3β) suppresses the progression of esophageal squamous cell carcinoma by modifying STAT3 activity. Mol. Carcinog. 2017, 56, 2301–2316. [Google Scholar] [CrossRef] [PubMed]
- Ragozzino, E.; Brancaccio, M.; Di Costanzo, A.; Scalabrì, F.; Andolfi, G.; Wanderlingh, L.G.; Patriarca, E.J.; Minchiotti, G.; Altamura, S.; Summa, V.; et al. 6-Bromoindirubin-3’-oxime intercepts GSK3 signaling to promote and enhance skeletal muscle differentiation affecting miR-206 expression in mice. Sci. Rep. 2019, 9, 18091. [Google Scholar] [CrossRef] [PubMed]
- Pero, R.; Brancaccio, M.; Mennitti, C.; Gentile, L.; Franco, A.; Laneri, S.; De Biasi, M.G.; Pagliuca, C.; Colicchio, R.; Salvatore, P.; et al. HNP-1 and HBD-1 as Biomarkers for the Immune Systems of Elite Basketball Athletes. Antibiotics 2020, 9, 306. [Google Scholar] [CrossRef] [PubMed]
- Ma, R.-J.; Zheng, Q.-M.; Zhang, N.; Sun, Z.-G. Clinicopathological Significance of STAT3 and p-STAT3 among 91 Patients with Adenocarcinoma of the Esophagogastric Junction. Dis. Markers 2022, 2022, 9311684. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Bi, X.; Huang, Z.; Zhao, J.; Han, Y.; Li, Z.-Y.; Zhang, Y.; Li, Y.; Chen, X.; Hu, X.; et al. Prognostic Role of Phospho-STAT3 in Patients with Cancers of the Digestive System: A Systematic Review and Meta-Analysis. PLoS ONE 2015, 10, e0127356. [Google Scholar] [CrossRef]
- Ji, K.; Zhang, L.; Zhang, M.; Chu, Q.; Li, X.; Wang, W. Prognostic Value and Clinicopathological Significance of p-stat3 among Gastric Carcinoma Patients: A Systematic Review and Meta-Analysis. Medicine 2016, 95, e2641. [Google Scholar] [CrossRef]
- Hartman, Z.C.; Poage, G.M.; den Hollander, P.; Tsimelzon, A.; Hill, J.; Panupinthu, N.; Zhang, Y.; Mazumdar, A.; Hilsenbeck, S.G.; Mills, G.B.; et al. Growth of triple-negative breast cancer cells relies upon coordinate autocrine expression of the proinflammatory cytokines IL-6 and IL-8. Cancer Res. 2013, 73, 3470–3480. [Google Scholar] [CrossRef]
- Chung, A.W.; Kozielski, A.J.; Qian, W.; Zhou, J.; Anselme, A.C.; Chan, A.A.; Pan, P.-Y.; Lee, D.J.; Chang, J.C. Tocilizumab overcomes chemotherapy resistance in mesenchymal stem-like breast cancer by negating autocrine IL-1A induction of IL-6. NPJ Breast Cancer 2022, 8, 30. [Google Scholar] [CrossRef]
Gene | Primer for 5′-3′ | Primer Rev 5′-3′ |
---|---|---|
IL-6 | CTAGATGCAATAACCACCCC | CAACAACAATCTGAGGTGC |
STAT3 | GTGAGGCAGAACAGCTAGAG | GTCGTCTCCCCCTTAATTC |
CEBPβ | CTCTGCTTCTCCCTCTGC | CCCGTAGGAACATCTTTAAGC |
β-Actin | GACAGGATGCAGAAGGAGAT | TTGCTGATCCACATCTGCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Laurino, S.; Brancaccio, M.; Angrisano, T.; Calice, G.; Russi, S.; Mazzone, P.; Di Paola, G.; Aieta, M.; Grieco, V.; Bianchino, G.; et al. Role of IL-6/STAT3 Axis in Resistance to Cisplatin in Gastric Cancers. Biomedicines 2023, 11, 694. https://doi.org/10.3390/biomedicines11030694
Laurino S, Brancaccio M, Angrisano T, Calice G, Russi S, Mazzone P, Di Paola G, Aieta M, Grieco V, Bianchino G, et al. Role of IL-6/STAT3 Axis in Resistance to Cisplatin in Gastric Cancers. Biomedicines. 2023; 11(3):694. https://doi.org/10.3390/biomedicines11030694
Chicago/Turabian StyleLaurino, Simona, Mariarita Brancaccio, Tiziana Angrisano, Giovanni Calice, Sabino Russi, Pellegrino Mazzone, Giuseppina Di Paola, Michele Aieta, Vitina Grieco, Gabriella Bianchino, and et al. 2023. "Role of IL-6/STAT3 Axis in Resistance to Cisplatin in Gastric Cancers" Biomedicines 11, no. 3: 694. https://doi.org/10.3390/biomedicines11030694
APA StyleLaurino, S., Brancaccio, M., Angrisano, T., Calice, G., Russi, S., Mazzone, P., Di Paola, G., Aieta, M., Grieco, V., Bianchino, G., Falco, G., & Notarangelo, T. (2023). Role of IL-6/STAT3 Axis in Resistance to Cisplatin in Gastric Cancers. Biomedicines, 11(3), 694. https://doi.org/10.3390/biomedicines11030694