Next Article in Journal
Impact of Combined Heat and Drought Stress on the Potential Growth Responses of the Desert Grass Artemisia sieberi alba: Relation to Biochemical and Molecular Adaptation
Next Article in Special Issue
Assessment of the Genetic Diversity of Rice Germplasms Characterized by Black-Purple and Red Pericarp Color Using Simple Sequence Repeat Markers
Previous Article in Journal
Lipid Thermal Fingerprints of Long-term Stored Seeds of Brassicaceae
Previous Article in Special Issue
Deciphering the Genetic Architecture of Plant Height in Soybean Using Two RIL Populations Sharing a Common M8206 Parent
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization and Mapping of a Novel Premature Leaf Senescence Mutant in Common Tobacco (Nicotiana tabacum L.)

1
Tobacco Research Institute, Chinese Academy of Agricultural Sciences, Qingdao 266101, China
2
Plant Genetic, Gembloux Agro-Bio Tech, University of Liege, Gembloux B-5030, Belgium
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2019, 8(10), 415; https://doi.org/10.3390/plants8100415
Submission received: 24 September 2019 / Revised: 12 October 2019 / Accepted: 12 October 2019 / Published: 15 October 2019
(This article belongs to the Special Issue Genomics for Plant Breeding)

Abstract

:
As the last stage of plant development, leaf senescence has a great impact on plant’s life cycle. Genetic manipulation of leaf senescence has been used as an efficient approach in improving the yield and quality of crop plants. Here we describe an ethyl methane sulfonate (EMS) mutagenesis induced premature leaf senescence mutant yellow leaf 1 (yl1) in common tobacco (Nicotiana tabacum L.). The yl1 plants displayed early leaf yellowing. Physiological parameters and marker genes expression indicated that the yl1 phenotype was caused by premature leaf senescence. Genetic analyses indicated that the yl1 phenotype was controlled by a single recessive gene that was subsequently mapped to a specific interval of tobacco linkage group 11 using simple sequence repeat (SSR) markers. Exogenous plant hormone treatments of leaves showed that the yl1 mutant was more sensitive to ethylene and jasmonic acid than the wild type. No similar tobacco premature leaf senescence mutants have been reported. This study laid a foundation for finding the gene controlling the mutation phenotype and revealing the molecular regulation mechanism of tobacco leaf senescence in the next stage.

1. Introduction

Tobacco (Nicotiana tabacum L.) is an important agricultural crop widely grown in the world. It plays an important role in plant genetics and transgenic research as a model plant [1,2]. Also, it can be used as a bioreactor for vaccine production [3,4,5]. In addition, due to the huge biomass of tobacco, it has become a potential bioenergy plant [6,7,8]. In tobacco production, mature/ripe leaves are harvested, so leaf senescence is critical for both the yield and quality of tobacco products. Therefore, studying tobacco leaf senescence has important theoretical significance and a practical application value. Although plant leaf senescence regulation has been extensively studied in model systems such as Arabidopsis and rice, limited information is available about tobacco leaf senescence regulation at present. Several studies focused on transcriptome and metabolome of tobacco leaf senescence [9,10,11,12]. These studies have provided global and potential gene dynamic expression changes and signaling pathways for leaf senescence regulation in tobacco, but few genes involved in regulation of tobacco leaf senescence have been identified.
Senescence is the terminal phase of plant development that typically displays as a decline at the cell, tissue, organ, and whole plant levels [13]. Leaf senescence is the main part of plant senescence, and is strictly controlled at the molecular level during plant development [14]. In a controlled environment with sufficient nutrition and favorable growth conditions, leaf senescence depends on the leaf age and development stage of the plant [15,16]. Leaf senescence is affected by both endogenous and exogenous factors, which regulate the expression of genes involved in the execution process of senescence, and eventually lead to the death of the whole plant [17]. Furthermore, leaf senescence is regulated by a complex regulatory network composed of transcription factors, hormones, environmental factors, sugar metabolism, epigenetic regulation, and miRNA mediated regulation [17,18,19,20,21]. Leaf senescence is not a completely passive and adverse biological process. During leaf senescence, macromolecules such as proteins, lipids, and nucleic acids are broken down. The nutrients released from the catabolism of these macromolecules, as well as other nutrients, are recycled to new buds, young leaves, developing fruits, and seeds, which influence the yield of crops [15]. Premature leaf senescence generally causes significant yield loss while delayed leaf senescence leads to increased grain production in many crop species [22,23].
Chlorophyll breakdown is one of the most important catabolic processes during leaf senescence in higher plants [24]. The yellowing of leaves caused by chlorophyll loss is the major phenotype of plant senescence. Total chlorophyll content is the most commonly used parameter for characterizing senescence progression. Drastic changes in gene expression are associated with leaf senescence. Arabidopsis leaf senescence transcriptome data revealed that many transcription factor families are overrepresented in the transcriptome of leaf senescence [18,25]. In addition to transcription factors, many genes associated with metabolism and signal transduction were identified to be associated with leaf senescence. Based on their different expression patterns, genes with differential expression were classified as senescence down-regulated genes (SDGs), such as ribulose bisphosphate carboxylase small subunit (RBCS) encoding a member of the rubisco small subunit, a key enzyme in photosynthesis, and senescence up-regulated genes, which are also called senescence-associated genes (SAGs) [26]. While many of the SAGs could be induced by senescence as well as other senescence-inducing factors, such as environmental stresses, SAG12 was found to be strictly induced by natural senescence [27], and thus, often used as a leaf senescence marker gene. Plant hormones are important endogenous factors involved in the regulation of leaf senescence. Some of the senescence regulating plant hormones are also involved in the plant’s response to environmental stresses and stress-induced senescence [19,28,29]. Thus, leaf senescence often involves complex cross talks between signaling pathways associated with multiple hormones and stress signals.
Molecular markers are powerful tools for genetic research and plant breeding that have been widely used in many types of biological research. Genetic linkage mapping based on molecular markers can clarify the structure and organization of the genome. In tobacco, a large number of simple sequence repeat (SSR) markers have been developed based on the released data of tobacco genome sequences and expressed sequence tags. Bindler et al. [30,31] used two different tobacco varieties, Hicks Broadleaf and Red Russian, in constructing a mapping population, and they published more than 5000 SSR markers and obtained a high-density tobacco genetic map containing 24 linkage groups (LGs) with 2363 SSR markers loci. Tong et al. [32] developed a total of 4886 SSR markers (including 1365 genomic SSRs and 3521 EST-SSRs), which were functional in a set of eight tobacco varieties of four different types and were essentially non-overlapping with the set published by Bindler et al. [30,31]. These SSR markers have been wildly used for the identification of quantitative trait loci (QTLs) associated with tobacco disease resistance [33,34,35,36] and tobacco traits [37], and they have also been used for genetic diversity analysis of tobacco varieties [38,39].
In this study, we identified a tobacco mutant yl1, which exhibited a premature leaf senescence phenotype. We characterized the premature leaf senescence phenotype of yl1, determined the physiological parameters related to leaf senescence and the expression of senescence marker genes, analyzed its phenotypic inheritance, and mapped the causal gene.

2. Results

2.1. The yl1 Plants Exhibit Premature Leaf Senescence

Compared with HonghuaDajinyuan (HD), yl1 plants showed a premature leaf senescence phenotype from about 50 days after transplanting (DAT), and throughout the subsequent developmental stage (Figure 1). No significant difference of leaf color was observed between HD and yl1 35 DAT or at earlier development stages (Figure 1A). The yellowing of the bottom leaves appeared in the yl1 plants around 50 DAT, and the leaf color was lighter than HD (Figure 1B). At the flowering stage, about 75 DAT, significant difference in leaf color of the bottom and middle leaves were observed between the yl1 and HD plants (Figure 1C,E) and this difference in leaf yellowing was more profound at 95 DAT when the upper leaves of the yl1 plants became completely yellow, whereas the majority of leaves in the HD plants still retained their green color (Figure 1). These results suggest that the yl1 plants seemed to display a phenotype of premature leaf senescence.

2.2. Alterations of Leaf Senescence Related Parameters

In order to further characterize the phenotype of yl1, we determined the chlorophyll content, Fv/Fm ratio, soluble protein content, and the expression of senescence marker genes in yl1 in comparison with HD (Figure 2). Consistent with the premature leaf yellowing phenotype, Chlorophyll a (Chl a), Chlorophyll b (Chl b), and the total chlorophyll (Chls) of the middle leaves in yl1 were lower than in counterpart leaves of the HD plants at the same developmental stages. The contents of Chl a, Chl b, and Chls decreased rapidly in yl1 50 DAT, whereas the HD plants did not start losing chlorophyll until 75 DAT (Figure 2A–C). In tobacco, senescence of leaves progresses from the bottom to the top of a plant. At 75 DAT, although no significant difference in chlorophyll contents was observed in upper leaves, chlorophyll contents in the middle and lower leaves were significantly lower in yl1 than in the HD plants (Figure 2D–F). At 75 DAT, the Fv/Fm ration and soluble protein in upper, middle, and lower leaves of yl1 were significantly lower than in the HD plants (Figure 2G,H). Furthermore, the expression of the marker genes SAG12 and RBCS of the individual samples was determined. As shown in Figure 2I and J, in yl1, expression of the senescence marker gene SAG12 was first detected at 50 DAT and the photosynthetic gene RBCS became undetectable at 75 DAT. For HD plants, SAG12 expression was first detected at 75 DAT and RBCS expression became undetectable at 95 DAT. Significantly lower SAG12 and higher RBCS expression were detected at different leaf positions of 75 DAT plants (Figure 2K,L). The premature leaf senescence phenotype of yl1 was well reflected in the expression patterns of SAG12 and RBCS.

2.3. The Premature Leaf Senescence of yl1 is Controlled by a Single Recessive Gene

To analyze the inheritance of the premature leaf senescence phenotype of yl1, two wild type tobacco varieties, HD and Gexin 3 (G3), were crossed with yl1. All the F1 plants showed a normal green phenotype similar to the wild type. A total of 43 out of 154 (HD × yl1) and 40 out of 155 (G3 × yl1) F2 plants, respectively, displayed the premature leaf senescence phenotype, showing a segregation ratio of 3:1 (χ2 < χ20.05 = 3.841; Table 1). These results suggest that the premature leaf senescence phenotype of yl1 was controlled by a single recessive gene. To further verify this observation, BC1F1 populations were generated by crossing the F1 plants of HD × yl1 and G3 × yl1 with yl1 separately. The phenotypic segregations of the BC1F1 populations correlated to the expected ratio of 1:1 with similar numbers of wild type and mutant type plants (χ2 < χ20.05 = 3.841; Table 1).

2.4. Preliminary Mapping of YL1

The BC1F1 population developed between parent G3, and yl1 was used to map YL1. A total of 265 simple sequence repeat (SSR) markers showing polymorphism between G3 and yl1 were identified from 1376 pairs of SSR markers by Bindler et al. [30,31] and Tong et al. [32], from which 96 markers were evenly distributed on 24 linkage groups (LGs) of tobacco and were selected to screen 19 recessive individuals from the BC1F1 population of G3 and yl1. The results showed that the marker PT53066 located on LG11 was associated with the yl1 phenotype (Figure 3A). In order to obtain more linked markers, we used more polymorphic SSR markers on the flanks of PT53066 to screen the 19 mutant plants and identified three more linked markers: PT60305, PT60998, and PT60975 (Figure 3B). In order to obtain the exact location of the YL1 gene on LG11, we enlarged the BC1F1 population to get 46 premature leaf senescence individuals and screened them with the above four linked SSR markers. The isolation of each SSR marker and YL1 was converted into genetic distance by the QTL Ici Mapping software (V4.0). The results showed that YL1 was located between the markers PT53066 and PT60305, with the genetic distance of 1.08 and 3.51 cM, respectively (Figure 3B).

2.5. Plant Hormone Treatments

In order to find out whether YL1 is involved in hormone signaling pathways that regulate leaf senescence, leaf discs from the middle leaves of 50 DAT plants were used in plant hormone treatments (Figure 4). Without plant hormone treatment, the yellowing of the yl1 leaves was faster than that of HD (Figure 4 Control). As senescence-promoting hormones, treatments of both 1 - aminocyclopropane - 1 - carboxylic acid (ACC) and methyl jasmonate (MeJA) accelerated yellowing of leaf discs with a significantly more profound effect on the yl1 leaves, suggesting that yl1 was more sensitive to ACC and MeJA than the HD plants (Figure 4).

3. Discussion

The yl1 mutant has been continuously planted in Zhucheng City, Shandong Province, China, for four years. A reliable and stable early yellowing phenotype has been consistently observed in yl1 plants over the years. The external performance of leaf senescence is that the leaf color turns yellow or even dead, while the internal performances include the chloroplast structure changing significantly or even completely disintegrating, and the decrease of the photosynthesis and protein [15]. One of the early physiological manifestations of leaf senescence is the collapse of the membrane structure due to membrane lipid de-esterification [40]. With the occurrence of senescence, the outer layer of the chloroplast disappears, and the chlorophyll degrades. Chlorophyll a (Chl a) and Chlorophyll b (Chl b) are the two prevailing forms of chlorophyll, which are involved in different light harvesting. Chl a is associated with the energy processing centers of the photosystems, while Chl b is considered to be an accessory pigment that transfers light energy to Chl a [41]. The chlorophyll breakdown process is initiated by conversion from Chl b to Chl a by a Chl b reductase [24]. The content of Chl a, Chl b, and total chlorophyll (Chls) in yl1 was lower than that in HD during the whole development process, and the difference was more significant at the middle and late stages of development. Moreover, chlorophyll degradation was initiated earlier in yl1 than in HD at an early development stage of than 50 DAT (Figure 2A–C). Therefore, we believe the low chlorophyll content at late stage is due to early chlorophyll degradation, a typical premature senescence phenotype. The phenotype of the yl1 mutant was further confirmed by the difference in Fv/Fm ratio, soluble protein content, and expression levels of the senescence-associated marker genes (Figure 2G–L).
Mapping functional genes using EMS mutants combined with map-based cloning has been applied in many crops; however, in tobacco, it has lagged behind when compared with those of other plants such as rice. The common tobacco (Nicotiana tabacum L.) is an allotetraploid (2n = 48) species produced by the hybridization and chromosome doubling of N. sylvestris (2n = 24) and N. tomentosiformis (2n = 24) [42], with 4.5 Gb genome and more than 70% repetitive sequences [43]. The difficulty of mapping tobacco genes by map-based cloning is partially due to the large genome of tobacco with lots of repetitive sequences. Wu et al. (2014) used SSR markers by Bindler et al. [30,31] and Tong et al. [32] to perform a preliminary mapping of a light color mutant ws1 controlled by two recessive nuclear genes. The ws1a locus was mapped between PT54006 and PT51778 with a genetic distance of 8.04 and 3.96 cM, respectively, and the ws1b locus was mapped between PT53716 and TM11187, each with a genetic distance of 8.56 cM from ws1b [44]. Michel et al. [45] located NtTPN1, a gene required for potato virus Y-induced veinal necrosis in tobacco, between PT60530 and PT61143 with a distance of 0.5 and 2.9 cM, respectively. A tobacco black shank resistance gene Ph was located at the top of LG20, but there were no more PT SSR markers available for subsequent localization [46]. The gene responsible for the premature senescence phenotype of yl1 was mapped between the markers PT53066 and PT60305, and the genetic distance was 1.08 and 3.51 cM, respectively. Similarly, we were not able to further narrow down the interval using the PT/TM SSR markers. Obviously, we need more molecular markers to enrich the linkage genetic map of tobacco.
Recently, a total of 1,224,048 non-redundant Nicotiana SSR markers were discovered and characterized in silico in seven Nicotiana genomic sequences, of which 99.98% are novel [47]. In addition to SSR markers, single nucleotide polymorphisms (SNPs) are also commonly used molecular markers [48]. With the rapid advance in next generation sequencing (NGS) technologies, it has become possible to complete genome sequencing of large crop species. Especially for tobacco, which is a crop with huge genome and low genetic diversity, it is necessary to develop SNPs from the genomic region due to their wide distribution in the genome. In the past five years, four sets of tobacco SNPs have been developed in tobacco through different varieties, sequencing populations, and sequencing methods; they have been integrated into the 24 LGs developed by Bindler et al., and new genetic linkage maps have been drawn [49,50,51,52]. These will be good tools for the fine mapping of YL1 in future.
In view of the important role of plant hormones in leaf senescence, we attempted to explore the relationship between the causal gene and hormone pathways by the hormone treatment of detached leaves, and to provide potential methods for screening candidate genes in the future. Ethylene is one of the most important plant hormones that induce leaf senescence. Some ethylene receptors, such as EIN2, a core member of ethylene signaling pathway, play a role in other hormone signaling and act as a node in the interaction between plant hormone signals [19]. Jasmonic acid induces the expression of key enzymes involved in chlorophyll degradation, so it has long been thought to accelerate leaf senescence [53]. In addition, jasmonic acid regulates leaf senescence by interacting with other hormonal signaling pathways such as salicylic acid, auxin, and ethylene [54,55,56]. When HD and yl1 were treated with ACC and MeJA, both of them had accelerated leaf senescence. It is clearly that yl1 is more sensitive to ACC and MeJA. However, we did not find that yl1 showed more interesting responses to ethylene and jasmonic acid.
In summary, we have identified a novel tobacco EMS mutagenesis induced premature leaf senescence mutant controlled by a recessive single gene and have preliminarily mapped the causal gene to an interval between PT53066 and PT60305 on the tobacco LG11, with the genetic distance of 1.08 and 3.51 cM, respectively. This provides good genetic material. Further cloning and characterization of the causal gene will lead to a better understanding of the molecular mechanisms underlining leaf senescence in tobacco and provide useful information in the genetic manipulation of tobacco leaf senescence.

4. Materials and Methods

4.1. Plant Materials and Genetic Populations

The yl1 mutant was identified from the chemical mutagen EMS induced library derived from the common tobacco variety HonghuaDajinyuan (HD) [57]. The yl1 mutant was identified from one the M2 lines, and further verified in the M3 and M4 generation. HD and another wild type tobacco variety G3 (Gexin 3) were crossed with yl1, respectively, to produce genetic populations. The F1 (HD × yl1; G3 × yl1) plants were self-pollinated to generate F2 segregating populations. BC1F1 segregating populations ((HD × yl1) × yl1; (G3 × yl1) × yl1) were generated by crossing F1 with yl1. All the plants were grown in a field in Zhucheng City, Shandong Province. Leaf senescence phenotypes were evaluated by visual observation. Segregation patterns were evaluated for the “goodness of fit” to the expected ratios using the chi-squared test.

4.2. Sampling for Measurement of Leaf Senescence Related Physiological Parameters and RNA Extraction

Plants of HD and yl1 were grown in the field in Zhucheng City, Shandong Province, during the 2018 growing season. Middle position leaves of each plant were collected at different developmental stages. The collection of the leaf samples was done at four developmental stages during the growing season: 35, 50, 75, and 95 days after transplanting (DAT). For each sample, one leaf from the middle position was collected from three plants randomly. Each leaf was divided into two parts along the main vein. One half was wrapped in aluminum foil, immediately immersed into liquid nitrogen, and stored at -80 °C until it was used for extracting the RNA and soluble protein, while the other half was put in sample bag and stored in the ice box for chlorophyll content measurements.

4.3. Measurement of Leaf Senescence Related Physiological Parameters

Chlorophyll was extracted and quantified as described previously [58]. Briefly, 0.5 g of the leaf sample was immersed in 30 mL ethanol overnight in darkness until the leaves became completely pale. The absorbance at 649 nm and 665 nm of the extraction solution was quantified using a UV-Vis spectrophotometer (TECAN, Infinite M200, Salzburg, Austria).
Fluorescence of living leaves was measured using a portable modulated chlorophyll fluorometer according to the manufacturer’s instructions (Opti-Sciences, OS1p, Hudson, USA).
Extraction of the soluble protein in each sample was according to the manufacturer’s instruction (CWBIO, CW0885M, Beijing, China). Briefly, about 0.2 g of the frozen leaves material was homogenized in 1 mL extraction reagent containing a protease inhibitor cocktail. The amount of soluble proteins in each sample was measured using the BCA protein assay kit (CWBIO, CW0014S, Beijing, China) according to the manufacturer’s instruction.

4.4. RNA Extraction and qRT-PCR

The total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, USA). First-strand cDNA was synthesized from 1 μg of total RNA using the PrimeScriptTM RT reagent Kit with gDNA Eraser (TAKARA, RR047, Dalian, China) according to the manufacturer’s instruction. qRT-PCR was carried out on a Thermal Cycler Block 7500 (ABI, Waltham, USA) according to the manufacture of TB GreenTM Premix Ex TaqTM II (Tli RNaseH Plus) (TAKARA, RR820, Dalian, China). The means of three biological and technical replicates were analyzed. The Actin was used as a reference gene for internal control, while SAG12 and RBCS were used as senescence markers. The primer sequences of the genes for qRT-PCR are shown in Table 2.

4.5. DNA Extraction and SSR Analysis

Genomic DNA was extracted using the Plant Genomic DNA Kit (TIANGEN, DP305, Beijing, China). The DNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, USA) and adjusted to 50 ng/µL. Tobacco simple sequence repeat (SSR) markers were used to map YL1 based on the high-density genetic map of tobacco [30]. PCR was performed in a Veriti 96-Well Thermal Cycler (ABI, Waltham, USA) following the previously described method [44]. Briefly, each reaction contained 7.5 μL of 2 x Taq PCR MasterMix (TIANGEN, KT211, Beijing, China), 50 ng template DNA, and 1 μL of 5 μM forward and reverse primers in a volume of 15 μL. The PCR program was as follows: pre-denaturation at 95 °C for 3 min, followed by 30 cycles of 15 s at 95 °C, 30 s at 50–60 °C (the annealing temperature of different primer pairs), and 30 s at 72 °C, and then a final extension at 72 °C for 5 min. After that, 6 μL PCR products were separated on 6% nondenaturing polyacrylamide gel and visualized with silver staining as previously described [60].

4.6. Linkage Map and Genetic Distance

The BC1F1 population ((G3 × yl1) × yl1) was used to obtain the markers linked to YL1. The polymorphic SSR markers between G3 and yl1 were partially selected and used to screen a small number of recessive individuals of the BC1F1 population with the premature leaf senescence phenotype, as well as their parents. After confirming the linkage between one marker and YL1, all adjacent polymorphic SSR markers were run across the whole recessive individuals of the population. The linkage map based on the segregations between YL1 and the markers was constructed by QTL Ici Mapping software V4.0 [61], and the threshold value of the logarithm of odd (LOD) was set at 3.0. Genetic distances were calculated and presented in Kosambi centiMorgans (cM).

4.7. Plant Hormone Treatments

Leaf discs from middle leaves of plants grown in greenhouse 50 DAT were used for plant hormone treatments. Detached leaves were cut into small discs (~1.5 cm in diameter) and floated on an incubation buffer (1/2 MS, 3 mM MES, and pH 5.8) with and without hormones in Petri dishes with filter paper. The samples were incubated at 28 °C under 24 h light in a growth chamber. The plant hormone was diluted to working concentrations using the incubation buffer. The working concentrations of the plant hormones are 100 µM for 1 - aminocyclopropane - 1 - carboxylic acid (ACC) and 50 µM for methyl jasmonate (MeJA) [62].

Author Contributions

Conceptualization, Y.G. and X.W.; investigation, X.G., X.W., G.L., Z.Z., J.C. and Z.L.; supervision, Y.G. and Y.S.; project administration, G.L.; funding acquisition, X.G. and Y.G.; writing—original draft preparation, X.G.; writing—review and editing, X.W. and Y.G. All authors commonly contributed to this work.

Funding

This research was funded by the Science Foundation for Young Scholars of Tobacco Research Institute of Chinese Academy of Agricultural Sciences, grant number 2017B07; and the Agricultural Science and Technology Innovation Program, grant number ASTIP-TRIC02.

Acknowledgments

The authors wish to thank Dr. Leonard Shumbe of Gembloux Agro-Bio Tech, University of Liege for critically reading this manuscript and help in English editing.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Masclaux, C.; Valadier, M.H.; Brugière, N.; Morot-Gaudry, J.F.; Hirel, B. Characterization of the sink/source transition in tobacco (Nicotiana tabacum L.) shoots in relation to nitrogen management and leaf senescence. Planta 2000, 211, 510–518. [Google Scholar] [CrossRef]
  2. Edwards, K.D.; Bombarely, A.; Story, G.W.; Allen, F.; Mueller, L.A.; Coates, S.A.; Jones, L. TobEA: An atlas of tobacco gene expression from seed to senescence. BMC Genom. 2010, 11, 142. [Google Scholar] [CrossRef]
  3. Arntzen, C.J. Using tobacco to treat cancer. Science 2008, 321, 1052–1053. [Google Scholar] [CrossRef]
  4. Monreal-Escalante, E.; Ramos-Vega, A.A.; Salazar-Gonzalez, J.A.; Banuelos-Hernandez, B.; Angulo, C.; Rosales-Mendoza, S. Expression of the VP40 antigen from the Zaire ebolavirus in tobacco plants. Planta 2017, 246, 123–132. [Google Scholar] [CrossRef]
  5. Budzianowski, J. Tobacco against Ebola virus disease. Przegl. Lek. 2015, 72, 567–571. [Google Scholar]
  6. Vanhercke, T.; El Tahchy, A.; Liu, Q.; Zhou, X.R.; Shrestha, P.; Divi, U.K.; Ral, J.P.; Mansour, M.P.; Nichols, P.D.; James, C.N.; et al. Metabolic engineering of biomass for high energy density: Oilseed-like triacylglycerol yields from plant leaves. Plant Biotechnol. J. 2014, 12, 231–239. [Google Scholar] [CrossRef]
  7. Fuchs, J.; Neuberger, T.; Rolletschek, H.; Schiebold, S.; Nguyen, T.H.; Borisjuk, N.; Borner, A.; Melkus, G.; Jakob, P.; Borisjuk, L. A noninvasive platform for imaging and quantifying oil storage in submillimeter tobacco seed. Plant Physiol. 2013, 161, 583–593. [Google Scholar] [CrossRef]
  8. Andrianov, V.; Borisjuk, N.; Pogrebnyak, N.; Brinker, A.; Dixon, J.; Spitsin, S.; Flynn, J.; Matyszczuk, P.; Andryszak, K.; Laurelli, M.; et al. Tobacco as a production platform for biofuel: Overexpression of Arabidopsis DGAT and LEC2 genes increases accumulation and shifts the composition of lipids in green biomass. Plant Biotechnol. J. 2010, 8, 277–287. [Google Scholar] [CrossRef]
  9. Li, W.; Zhang, H.L.; Li, X.X.; Zhang, F.X.; Liu, C.; Du, Y.M.; Gao, X.M.; Zhang, Z.L.; Zhang, X.B.; Hou, Z.H.; et al. Intergrative metabolomic and transcriptomic analyses unveil nutrient remobilization events in leaf senescence of tobacco. Sci. Rep. 2017, 7, 12126. [Google Scholar] [CrossRef] [Green Version]
  10. Zhao, J.Y.; Li, L.L.; Zhao, Y.N.; Zhao, C.X.; Chen, X.; Liu, P.P.; Zhou, H.N.; Zhang, J.J.; Hu, C.X.; Chen, A.G.; et al. Metabolic changes in primary, secondary, and lipid metabolism in tobacco leaf in response to topping. Anal. Bioanal. Chem. 2018, 410, 839–851. [Google Scholar] [CrossRef]
  11. Zhao, Z.; Li, Y.F.; Zhao, S.C.; Zhang, J.W.; Zhang, H.; Fu, B.; He, F.; Zhao, M.Q.; Liu, P.F. Transcriptome Analysis of Gene Expression Patterns Potentially Associated with Premature Senescence in Nicotiana tabacum L. Molecules 2018, 23, 2856. [Google Scholar] [CrossRef] [PubMed]
  12. Li, L.L.; Zhao, J.Y.; Zhao, Y.N.; Lu, X.; Zhou, Z.H.; Zhao, C.X.; Xu, G.W. Comprehensive investigation of tobacco leaves during natural early senescence via multi-platform metabolomics analyses. Sci. Rep. 2016, 6, 37976. [Google Scholar] [CrossRef] [PubMed]
  13. Lim, P.O.; Kim, H.J.; Gil Nam, H. Leaf Senescence. Annu. Rev. Plant Biol. 2007, 58, 115–136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Schippers, J.H. Transcriptional networks in leaf senescence. Curr. Opin. Plant Biol. 2015, 27, 77–83. [Google Scholar] [CrossRef] [PubMed]
  15. Gan, S.S.; Amasino, R.M. Making Sense of Senescence (Molecular Genetic Regulation and Manipulation of Leaf Senescence). Plant Physiol. 1997, 113, 313–319. [Google Scholar] [CrossRef] [Green Version]
  16. Quirino, B.F.; Noh, Y.S.; Himelblau, E.; Amasino, R.M. Molecular aspects of leaf senescence. Trends Plant Sci. 2000, 5, 278–282. [Google Scholar] [CrossRef]
  17. Ali, A.; Gao, X.M.; Guo, Y.F. Initiation, Progression, and Genetic Manipulation of Leaf Senescence. Methods Mol. Biol. 2018, 1744, 9–31. [Google Scholar]
  18. Guo, Y.; Cai, Z.; Gan, S. Transcriptome of Arabidopsis leaf senescence. Plant Cell Environ. 2004, 27, 521–549. [Google Scholar] [CrossRef]
  19. Jibran, R.; Hunter, D.A.; Dijkwel, P.P. Hormonal regulation of leaf senescence through integration of developmental and stress signals. Plant Mol. Boil. 2013, 82, 547–561. [Google Scholar] [CrossRef]
  20. Yolcu, S.; Li, X.; Li, S.; Kim, Y.J. Beyond the genetic code in leaf senescence. J. Exp. Bot. 2018, 69, 801–810. [Google Scholar] [CrossRef]
  21. Wingler, A.; Masclaux-Daubresse, C.; Fischer, A.M. Sugars, senescence, and ageing in plants and heterotrophic organisms. J. Exp. Bot. 2009, 60, 1063–1066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Guo, Y.F.; Gan, S.S. Translational researches on leaf senescence for enhancing plant productivity and quality. J. Exp. Bot. 2014, 65, 3901–3913. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Gregersen, P.L.; Culetic, A.; Boschian, L.; Krupinska, K. Plant senescence and crop productivity. Plant Mol. Biol. 2013, 82, 603–622. [Google Scholar] [CrossRef] [PubMed]
  24. Hortensteiner, S.; Krautler, B. Chlorophyll breakdown in higher plants. Biochim. Biophys. Acta 2011, 1807, 977–988. [Google Scholar] [CrossRef] [Green Version]
  25. Breeze, E.; Harrison, E.; McHattie, S.; Hughes, L.; Hickman, R.; Hill, C.; Kiddle, S.; Kim, Y.S.; Penfold, C.A.; Jenkins, D.; et al. High-Resolution Temporal Profiling of Transcripts during Arabidopsis Leaf Senescence Reveals a Distinct Chronology of Processes and Regulation. Plant. Cell 2011, 23, 873–894. [Google Scholar] [CrossRef]
  26. Thomas, H.; Stoddart, J.L. Leaf senescence. Annu. Rev. Plant Physiol. 1980, 31, 83–111. [Google Scholar] [CrossRef]
  27. Noh, Y.S.; Amasino, R.M. Identification of a promoter region responsible for the senescence-specific expression of SAG12. Plant Mol. Biol. 1999, 41, 181–194. [Google Scholar] [CrossRef]
  28. Jan, S.; Abbas, N.; Ashraf, M.; Ahmad, P. Roles of potential plant hormones and transcription factors in controlling leaf senescence and drought tolerance. Protoplasma 2019, 256, 313–329. [Google Scholar] [CrossRef]
  29. Khan, M.; Rozhon, W.; Poppenberger, B. The role of hormones in the aging of plants—A mini-review. Gerontology 2014, 60, 49–55. [Google Scholar] [CrossRef]
  30. Bindler, G.; Plieske, J.; Bakaher, N.; Gunduz, I.; Ivanov, N.; van der Hoeven, R.; Ganal, M.; Donini, P. A high density genetic map of tobacco (Nicotiana tabacum L.) obtained from large scale microsatellite marker development. Theor. Appl. Genet. 2011, 123, 219–230. [Google Scholar] [CrossRef]
  31. Bindler, G.; van der Hoeven, R.; Gunduz, I.; Plieske, J.; Ganal, M.; Rossi, L.; Gadani, F.; Donini, P. A microsatellite marker based linkage map of tobacco. Theor. Appl. Genet. 2007, 114, 341–349. [Google Scholar] [CrossRef] [PubMed]
  32. Tong, Z.J.; Yang, Z.M.; Chen, X.J.; Jiao, F.C.; Li, X.Y.; Wu, X.F.; Gao, Y.L.; Xiao, B.G.; Wu, W.W. Large-scale development of microsatellite markers in nicotiana tabacum and construction of a genetic map of flue-cured tobacco. Plant Breed. 2012, 131, 674–680. [Google Scholar] [CrossRef]
  33. Lan, T.; Zheng, S.F.; Yang, L.; Wu, S.X.; Wang, B.; Zhang, S.J.; Tong, Z.J.; Chen, Y.Z.; Chen, S.H.; Duan, Y.L.; et al. Mapping of quantitative trait loci conferring resistance to bacterial wilt in tobacco (Nicotiana tabacum L.). Plant Breed. 2014, 133, 672–677. [Google Scholar] [CrossRef]
  34. Sun, M.M.; Cheng, L.R.; Jiang, C.H.; Zhu, C.G.; Ren, M.; Zhang, Y.S.; Zhang, Y.; Liu, D.; Zhao, Q.; Geng, R.M.; et al. Identification of a major QTL affecting resistance to brown spot in tobacco (Nicotiana tabacum L.) via linkage and association mapping methods. Euphytica 2018, 214, 195–208. [Google Scholar] [CrossRef]
  35. Tong, Z.J.; Jiao, T.L.; Wang, F.Q.; Li, M.Y.; Leng, X.D.; Gao, Y.L.; Li, Y.P.; Xiao, B.G.; Wu, W.R. Mapping of quantitative trait loci conferring resistance to brown spot in flue-cured tobacco (Nicotiana tabacum L.). Plant Breed. 2012, 131, 335–339. [Google Scholar] [CrossRef]
  36. Vontimitta, V.; Lewis, R.S. Mapping of quantitative trait loci affecting resistance to Phytophthora nicotianae in tobacco (Nicotiana tabacum L.) line Beinhart-1000. Mol. Breed. 2012, 29, 89–98. [Google Scholar] [CrossRef]
  37. Cheng, L.R.; Yang, A.G.; Jiang, C.H.; Ren, M.; Zhang, Y.; Feng, Q.F.; Wang, S.M.; Guan, Y.S.; Luo, C. Quantitative trait loci mapping for plant height in tobacco using linkage and association mapping methods. Crop. Sci. 2015, 55, 641–647. [Google Scholar] [CrossRef]
  38. Kalivas, A.; Ganopoulos, I.; Bosmali, I.; Tsaliki, E.; Osathanunkul, M.; Xanthopoulou, A.; Moysiadis, T.; Avramidou, E.; Grigoriadis, I.; Zambounis, A.; et al. Genetic diversity and structure of tobacco in greece on the basis of morphological and microsatellite markers. Crop. Sci. 2016, 56, 2652–2662. [Google Scholar] [CrossRef]
  39. Tong, Z.J.; Xiao, B.G.; Chen, X.J.; Fang, D.H.; Zhang, Y.H.; Huang, C.J.; Li, Y.P. Construction of a genetic linkage map of cigar tobacco (Nicotiana tabacum L.) based on SSR markers and comparative studies. Czech. J. Genet. Plant Breed. 2018, 54, 115–122. [Google Scholar]
  40. Thompson, J.E.; Froese, C.D.; Madey, E.; Smith, M.D.; Hong, Y. Lipid metabolism during plant senescence. Prog. Lipid Res. 1998, 37, 119–141. [Google Scholar] [CrossRef]
  41. Tanaka, A.; Tanaka, R. Chlorophyll metabolism. Curr. Opin. Plant Biol. 2006, 9, 248–255. [Google Scholar] [CrossRef] [PubMed]
  42. Leitch, I.J.; Hanson, L.; Lim, K.Y.; Kovarik, A.; Chase, M.W.; Clarkson, J.J.; Leitch, A.R. The ups and downs of genome size evolution in polyploid species of Nicotiana (Solanaceae). Ann. Bot. 2008, 101, 805–814. [Google Scholar] [CrossRef] [PubMed]
  43. Renny-Byfield, S.; Chester, M.; Kovarik, A.; Le Comber, S.C.; Grandbastien, M.A.; Deloger, M.; Nichols, R.A.; Macas, J.; Novak, P.; Chase, M.W.; et al. Next generation sequencing reveals genome downsizing in allotetraploid Nicotiana tabacum, predominantly through the elimination of paternally derived repetitive DNAs. Mol. Biol. Evol. 2011, 28, 2843–2854. [Google Scholar] [CrossRef] [PubMed]
  44. Wu, Q.Z.; Wu, X.R.; Zhang, X.F.; Jiang, C.H.; Xiao, B.G.; Zhang, Y.Y.; Wang, Y.Y.; Liu, G.S. Mapping of two white stem genes in tetraploid common tobacco (Nicotiana tabacum L.). Mol. Breed. 2014, 34, 1065–1074. [Google Scholar] [CrossRef]
  45. Michel, V.; Julio, E.; Candresse, T.; Cotucheau, J.; Decorps, C.; Volpatti, R.; Moury, B.; Glais, L.; Dorlhac de Borne, F.; Decroocq, V.; et al. NtTPN1: A RPP8-like R gene required for Potato virus Y-induced veinal necrosis in tobacco. Plant J. 2018, 95, 700–714. [Google Scholar] [CrossRef]
  46. Bao, Y.G.; Ding, N.; Qin, Q.L.; Wu, X.; Martinez, N.; Miller, R.; Zaitlin, D.; Li, D.D.; Yang, S.M. Genetic mapping of the Ph gene conferring disease resistance to black shank in tobacco. Mol. Breed. 2019, 39, 122–131. [Google Scholar] [CrossRef]
  47. Wang, X.W.; Yang, S.; Chen, Y.D.; Zhang, S.M.; Zhao, Q.S.; Li, M.; Gao, Y.L.; Yang, L.; Bennetzen, J.L. Comparative genome-wide characterization leading to simple sequence repeat marker development for Nicotiana. BMC Genom. 2018, 19, 500. [Google Scholar] [CrossRef]
  48. Davey, J.W.; Hohenlohe, P.A.; Etter, P.D.; Boone, J.Q.; Catchen, J.M.; Blaxter, M.L. Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Nat. Rev. Genet. 2011, 12, 499–510. [Google Scholar] [CrossRef]
  49. Xiao, B.G.; Tan, Y.T.; Long, N.; Chen, X.J.; Tong, Z.J.; Dong, Y.; Li, Y.P. SNP-based genetic linkage map of tobacco (Nicotiana tabacum L.) using next-generation RAD sequencing. J. Biol. Res. Thessalon. 2015, 22, 11. [Google Scholar] [CrossRef]
  50. Gong, D.P.; Huang, L.; Xu, X.H.; Wang, C.Y.; Ren, M.; Wang, C.K.; Chen, M.L. Construction of a high-density SNP genetic map in flue-cured tobacco based on SLAF-seq. Mol. Breed. 2016, 36, 100. [Google Scholar] [CrossRef]
  51. Thimmegowda, G.C.; Ramadoss, S.K.; Kaikala, V.; Rathinavelu, R. Whole genome resequencing of tobacco (Nicotiana tabacum L.) genotypes and high-throughput SNP discovery. Mol. Breed. 2018, 38, 121. [Google Scholar] [CrossRef]
  52. Cheng, L.R.; Chen, X.C.; Jiang, C.H.; Ma, B.; Ren, M.; Cheng, Y.Z.; Liu, D.; Geng, R.M.; Yang, A.G. High-density SNP genetic linkage map construction and quantitative trait locus mapping for resistance to cucumber mosaic virus in tobacco (Nicotiana tabacum L.). Crop. J. 2019, 7, 539–547. [Google Scholar] [CrossRef]
  53. Reinbothe, C.; Springer, A.; Samol, I.; Reinbothe, S. Plant oxylipins: Role of jasmonic acid during programmed cell death, defence and leaf senescence. FEBS J. 2009, 276, 4666–4681. [Google Scholar] [CrossRef] [PubMed]
  54. Hu, Y.R.; Jiang, Y.J.; Han, X.; Wang, H.P.; Pan, J.J.; Yu, D.Q. Jasmonate regulates leaf senescence and tolerance to cold stress: Crosstalk with other phytohormones. J. Exp. Bot. 2017, 68, 1361–1369. [Google Scholar] [CrossRef]
  55. Jiang, Y.J.; Liang, G.; Yang, S.Z.; Yu, D.Q. Arabidopsis wrky57 functions as a node of convergence for jasmonic acid- and auxin-mediated signaling in jasmonic acid-induced leaf senescence. Plant Cell 2014, 26, 230–245. [Google Scholar] [CrossRef]
  56. Xie, Y.; Huhn, K.; Brandt, R.; Potschin, M.; Bieker, S.; Straub, D.; Doll, J.; Drechsler, T.; Zentgraf, U.; Wenkel, S. REVOLUTA and WRKY53 connect early and late leaf development in Arabidopsis. Development 2014, 141, 4772–4783. [Google Scholar] [CrossRef]
  57. Wang, D.W.; Wang, S.M.; Chao, J.T.; Wu, X.R.; Sun, Y.H.; Li, F.X.; Lv, J.; Gao, X.M.; Liu, G.S.; Wang, Y.Y. Morphological phenotyping and genetic analyses of a new chemical-mutagenized population of tobacco (Nicotiana tabacum L.). Planta 2017, 246, 149–163. [Google Scholar] [CrossRef]
  58. He, Y.H.; Gan, S.S. A Gene Encoding an acyl hydrolase is involved in leaf senescence in Arabidopsis. Plant Cell 2002, 14, 805–815. [Google Scholar] [CrossRef]
  59. Edwards, K.D.; Fernandez-Pozo, N.; Drake-Stowe, K.; Humphry, M.; Evans, A.D.; Bombarely, A.; Allen, F.; Hurst, R.; White, B.; Kernodle, S.P.; et al. A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMC Genom. 2017, 18, 448. [Google Scholar] [CrossRef]
  60. Bassam, B.J.; Caetano-Anolles, G.; Gresshoff, P.M. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal. Biochem. 1991, 196, 80–83. [Google Scholar] [CrossRef]
  61. Li, H.H.; Ribaut, J.M.; Li, Z.L.; Wang, J.K. Inclusive composite interval mapping (ICIM) for digenic epistasis of quantitative traits in biparental populations. Theor. Appl. Genet. 2008, 116, 243–260. [Google Scholar] [CrossRef] [PubMed]
  62. Zhang, Z.L.; Guo, Y.F. Hormone treatments in studying leaf senescence. Methods Mol. Biol. 2018, 1744, 125–132. [Google Scholar] [PubMed]
Figure 1. Phenotypic comparison between HonghuaDajinyuan (HD) and yl1. The phenotype of HD and yl1 plants grown in the field. (A) 35 days after transplanting (DAT), bar 20 cm; (B) 50 DAT, bar 20 cm; (C) 75 DAT, bar 30 cm; and (D) 95 DAT, bar 35 cm. (E) The middle leaves of HD and yl1 75 DAT, bar 10 cm.
Figure 1. Phenotypic comparison between HonghuaDajinyuan (HD) and yl1. The phenotype of HD and yl1 plants grown in the field. (A) 35 days after transplanting (DAT), bar 20 cm; (B) 50 DAT, bar 20 cm; (C) 75 DAT, bar 30 cm; and (D) 95 DAT, bar 35 cm. (E) The middle leaves of HD and yl1 75 DAT, bar 10 cm.
Plants 08 00415 g001
Figure 2. Leaf senescence related parameters of HD and yl1. Black and grey columns indicate HD and yl1, respectively. (A) Chlorophyll a (Chl a), (B) Chlorophyll b (Chl b), and (C) total Chlorophyll (Chls) in middle leaves of the same leaf position of HD and yl1 at 35, 50, 75, and 95 DAT. (D) Chl a, (E) Chl b, (F) Chls, (G) Fv/Fm ratio, and (H) soluble protein in upper, middle, and lower leaves of the same leaf position of HD and yl1 75 DAT, respectively. Relative expression of (I) SAG12 and (J) RBCS in middle leaves of the same leaf position of HD and yl1 at 35, 50, 75, and 95 DAT. Relative expression of (K) SAG12 and (L) RBCS in upper, middle, and lower leaves of the same leaf position of HD and yl1 at 75 DAT. Values are mean ± SD of three individual replicates. * and ** represent significant difference determined by the Student’s t test at p ≤ 0.05 and p ≤ 0.01, respectively.
Figure 2. Leaf senescence related parameters of HD and yl1. Black and grey columns indicate HD and yl1, respectively. (A) Chlorophyll a (Chl a), (B) Chlorophyll b (Chl b), and (C) total Chlorophyll (Chls) in middle leaves of the same leaf position of HD and yl1 at 35, 50, 75, and 95 DAT. (D) Chl a, (E) Chl b, (F) Chls, (G) Fv/Fm ratio, and (H) soluble protein in upper, middle, and lower leaves of the same leaf position of HD and yl1 75 DAT, respectively. Relative expression of (I) SAG12 and (J) RBCS in middle leaves of the same leaf position of HD and yl1 at 35, 50, 75, and 95 DAT. Relative expression of (K) SAG12 and (L) RBCS in upper, middle, and lower leaves of the same leaf position of HD and yl1 at 75 DAT. Values are mean ± SD of three individual replicates. * and ** represent significant difference determined by the Student’s t test at p ≤ 0.05 and p ≤ 0.01, respectively.
Plants 08 00415 g002
Figure 3. Preliminary mapping of YL1. (A) Linkage relationships between tobacco simple sequence repeat (SSR) markers PT53066 and YL1 in 19 recessive individuals from BC1F1 (G3 × yl1) × yl1 population. M indicates the DNA marker pBR322/Mspl; P1 indicates G3; P2 indicates yl1; and * indicates the recombinant individuals. (B) Genetic map of YL1 and four SSR markers on tobacco linkage group 11 (LG11). The black bar indicates the smallest interval of YL1 and markers; cM indicates centimorgan.
Figure 3. Preliminary mapping of YL1. (A) Linkage relationships between tobacco simple sequence repeat (SSR) markers PT53066 and YL1 in 19 recessive individuals from BC1F1 (G3 × yl1) × yl1 population. M indicates the DNA marker pBR322/Mspl; P1 indicates G3; P2 indicates yl1; and * indicates the recombinant individuals. (B) Genetic map of YL1 and four SSR markers on tobacco linkage group 11 (LG11). The black bar indicates the smallest interval of YL1 and markers; cM indicates centimorgan.
Plants 08 00415 g003
Figure 4. Plant hormone treatments of HD and yl1 leaf discs. Controls were treated with the incubation buffer without hormone. ACC: 1 - aminocyclopropane - 1 - carboxylic acid; MeJA: methyl jasmonate.
Figure 4. Plant hormone treatments of HD and yl1 leaf discs. Controls were treated with the incubation buffer without hormone. ACC: 1 - aminocyclopropane - 1 - carboxylic acid; MeJA: methyl jasmonate.
Plants 08 00415 g004
Table 1. Genetic analysis of yl1.
Table 1. Genetic analysis of yl1.
Population TypeCrossTotalWild TypeMutant TypeSegregation Rationχ2 1
F2HD × yl1154111432.5810.701
F2G3 × yl1155115402.8750.054
BC1F1(HD × yl1) × yl115583721.1530.781
BC1F1(G3 × yl1) × yl116377860.8950.497
HD: HonghuaDajinyuan, tobacco variety; G3: Gexin 3, tobacco variety; 1 Value for significant at 0.05 and df = 1 is 3.841.
Table 2. The primer sequences of genes for qRT-PCR.
Table 2. The primer sequences of genes for qRT-PCR.
Gene NameAccession Number 1Forward Primer Sequence 1Reverse Primer Sequence 1
ActinNitab4.5_0009320g0010.1CAAGGAAATCACGGCTTTGGAAGGGATGCGAGGATGGA
SAG12Nitab4.5_0001608g0070.1ATTTTCAGCGGTGGCAGCTGTAAGAAGTCGTAGGCTCG
RBCSNitab4.5_0006249g0010.1CCTGCTAAGGATACAATTAGCTCAAATTTCTTGTTGTCA
1 The accession number and gene sequences were obtained from the N. tabacum CDS database (https://solgenomics.net) [59].

Share and Cite

MDPI and ACS Style

Gao, X.; Wu, X.; Liu, G.; Zhang, Z.; Chao, J.; Li, Z.; Guo, Y.; Sun, Y. Characterization and Mapping of a Novel Premature Leaf Senescence Mutant in Common Tobacco (Nicotiana tabacum L.). Plants 2019, 8, 415. https://doi.org/10.3390/plants8100415

AMA Style

Gao X, Wu X, Liu G, Zhang Z, Chao J, Li Z, Guo Y, Sun Y. Characterization and Mapping of a Novel Premature Leaf Senescence Mutant in Common Tobacco (Nicotiana tabacum L.). Plants. 2019; 8(10):415. https://doi.org/10.3390/plants8100415

Chicago/Turabian Style

Gao, Xiaoming, Xinru Wu, Guanshan Liu, Zenglin Zhang, Jiangtao Chao, Zhiyuan Li, Yongfeng Guo, and Yuhe Sun. 2019. "Characterization and Mapping of a Novel Premature Leaf Senescence Mutant in Common Tobacco (Nicotiana tabacum L.)" Plants 8, no. 10: 415. https://doi.org/10.3390/plants8100415

APA Style

Gao, X., Wu, X., Liu, G., Zhang, Z., Chao, J., Li, Z., Guo, Y., & Sun, Y. (2019). Characterization and Mapping of a Novel Premature Leaf Senescence Mutant in Common Tobacco (Nicotiana tabacum L.). Plants, 8(10), 415. https://doi.org/10.3390/plants8100415

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop