Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers
Abstract
1. Introduction
2. Results
2.1. Genetic Diversity of A. glutinosa Populations
2.2. Genetic Differentiation of A. glutinosa Populations
2.3. Genetic Structure of the A. glutinosa Population
3. Discussion
3.1. Population Genetic Structure and Geographical Variation in A. glutinosa
3.2. Genetic Improvement of A. glutinosa
4. Materials and Methods
4.1. Plant Material
4.2. DNA Extraction and Amplification
4.3. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Furlow, J.J. The systematics of the American species of Alnus (Betulaceae). Rhodora 1979, 81, 1–121. [Google Scholar]
- Chen, Z.D. Phylogeny and phytogeography of the Betulaceae (cont.). Acta Phytotax. Sin. 1994, 32, 101–153. [Google Scholar]
- Pliura, A. Possibilities for adaptation of Alnus glutinosa L. to changing environment. Biologija 2004, 50, 6–12. [Google Scholar]
- Perez, J.; Basaguren, A.; López-Rojo, N.; Tonin, A.M.; Correa-Araneda, F.; Boyero, L. The role of key plant species on litter decomposition in streams: Alder as experimental model. The ecology of plant litter decomposition in stream ecosystems. In The Ecology of Plant Litter Decomposition in Stream Ecosystems; Swan, C.M., Boyero, L., Canhoto, C., Eds.; Springer: Cham, Switzerland, 2021; pp. 143–161. [Google Scholar]
- Koblanova, S.A. The problem of landscaping recreational areas (on the example of Kostanay). Bull. Sci. KSTU Named Z. Aldamzhar 2020, 1, 10–12. (In Russian) [Google Scholar]
- Mingeot, D.; Baleux, R.; Watillon, B. Characterization of microsatellite markers for black alder (Alnus glutinosa [L.] Gaertn). Conserv. Genet. Resour. 2010, 2, 269–271. [Google Scholar] [CrossRef]
- Bibalani, G.H.; Bazhrang, Z.; Mohsenifar, H.; Joodi, L. The side roots pulling effect of alder (Alnus glutinosa) on river bank soil strong in North Iran. Int. J. Bot. 2008, 4, 290–296. [Google Scholar] [CrossRef]
- Cubry, P.; Gallagher, E.; O’Connor, E.; Kelleher, C.T. Phylogeography and population genetics of black alder (Alnus glutinosa (L.) Gaertn.) in Ireland: Putting it in a European context. Tree Genet. Genomes 2015, 11, 99. [Google Scholar] [CrossRef]
- Claessens, H.; Oosterbaan, A.; Savill, P.; Rondeux, J. A review of the characteristics of black alder (Alnus glutinosa (L.) Gaertn.) and their implications for silvicultural practices. Forestry 2010, 83, 163–175. [Google Scholar] [CrossRef]
- Resolution of the Government of the Republic of Kazakhstan Dated October 31, 2006 On Approval of the Lists of Rare and Endangered Species of Animals and Plants. Available online: https://adilet.zan.kz/rus/archive/docs/P060001034_/31.10.2006 (accessed on 15 August 2024).
- Makulbekova, G.B. Changes in alder forests of the Bayanaul mountain range. News Acad. Sci. Kazakh SSR 1996, 5, 21–24. (In Russian) [Google Scholar]
- Milkov, F.N. On the black alder forests of the middle Ilek. Geoscience 1950, 3, 124–127. (In Russian) [Google Scholar]
- Ivanov, V.V. Black alder in the Ural River valley. Priroda 1953, 2, 111–112. (In Russian) [Google Scholar]
- Sarsekova, D.N.; Boranbay, J.T.; Aishuk, E.J. Assessment of botanical and geographical growth and reproduction of some woody plants. Forestry 2022, 86, 250–253. (In Russian) [Google Scholar]
- Mingeot, D.; Husson, C.; Mertens, P.; Watillon, B.; Bertin, P.; Druart, P. Genetic diversity and genetic structure of black alder (Alnus glutinosa [L.] Gaertn) in the Belgium-Luxembourg-France cross-border area. Tree Genet. Genomes 2016, 12, 1–12. [Google Scholar] [CrossRef]
- Jurkšienė, G.; Tamošaitis, S.; Kavaliauskas, D.; Buchovska, J.; Danusevičius, D.; Baliuckas, V. Identification of Alnus glutinosa L. and A. incana (L.) Moench. Hybrids in Natural Forests Using Nuclear DNA Microsatellite and Morphometric Markers. Forests 2021, 12, 1504. [Google Scholar] [CrossRef]
- Koblanova, S.A. Intrapopulation variability of black alder of Northern Turgai. Res. Results 2008, 2, 22–124. (In Russian) [Google Scholar]
- Koblanova, S.A. Protection and rational use of alder forests of Northern Turgai. Sci. J. Bull. Sci. Kazakh Agrotech. Univ. Named S.Seifullin 2008, 145–148. (In Russian) [Google Scholar]
- Kadenova, A.B.; Kamkin, V.A.; Erzhanov, N.T.; Kamkina, E.V. Flora and vegetation of the Bayanaul State National Nature Park; Monograph: Pavlodar, Kazakhstan, 2008. (In Russian) [Google Scholar]
- Zhou, A.; Zong, D.; Gan, P.; Zhang, Y.; Li, D.; He, C. Genetic diversity and population structure of populus yunnanensis revealed by SSR markers. Pak. J. Bot. 2020, 52, 2147–2155. [Google Scholar] [CrossRef]
- Poncet, V.; Rondeau, M.; Tranchant, C.; Cayrel, A.; Hamon, S.; De Kochko, A.; Hamon, P. SSR mining in coffee tree EST databases: Potential use of EST–SSRs as markers for the Coffea genus. Mol. Genet. Genom. 2006, 276, 436–449. [Google Scholar] [CrossRef]
- Ferreira-Ramos, R.; Laborda, P.R.; de Oliveira Santos, M.; Mayor, M.S.; Mestriner, M.A.; de Souza, A.P.; Alzate-Marin, A.L. Genetic analysis of forest species Eugenia uniflora L. through of newly developed SSR markers. Conserv. Genet. 2008, 9, 1281–1285. [Google Scholar] [CrossRef]
- Lepais, O.; Bacles, C.F.E. De novo discovery and multiplexed amplification of microsatellite markers for black alder (Alnus glutinosa) and related species using SSR-enriched shotgun pyrosequencing. J. Hered. 2011, 102, 627–632. [Google Scholar] [CrossRef]
- Martín, M.A.; Moreno, R.; Die, J.V.; Cabrera, A.; Castro, P.; Pérez, M.D.; Solla, A. Distribution, diversity and genetic structure of alders (Alnus lusitanica and A. glutinosa) in Spain. For. Ecol. Manag. 2024, 562, 121922. [Google Scholar] [CrossRef]
- Drašnarová, A.; Krak, K.; Vít, P.; Doudová, J.; Douda, J.; Hadincová, V.; Mandák, B. Cross-amplification and multiplexing of SSR markers for Alnus glutinosa and A. incana. Tree Genet. Genomes 2014, 10, 865–873. [Google Scholar] [CrossRef]
- Guo, H.Y.; Wang, Z.L.; Huang, Z.; Chen, Z.; Yang, H.B.; Kang, X.Y. Genetic diversity and population structure of Alnus cremastogyne as revealed by microsatellite markers. Forests 2019, 10, 278. [Google Scholar] [CrossRef]
- Poljak, I.; Idžojtić, M.; Šapić, I.; Korijan, P.; Vukelić, J. Diversity and Structure of Croatian Continental and Alpine-Dinaric Populations of Grey Alder (Alnus incana/L./Moench Subsp. Incana); Isolation by Distance and Environment Explains Phenotypic Divergence. Šumarski List. 2018, 142, 19–31. [Google Scholar]
- Gomes Marques, I.; Vieites-Blanco, C.; Barrento, M.J.; Semedo, J.N.; Rodrigues, A.P.; Scotti-Campos, P.; Rodríguez-González, P.M. Phenotypic variation and genetic diversity in European Alnus species. For. An. Int. J. For. Res. 2024, 142, cpae039. [Google Scholar] [CrossRef]
- Jones, J.M.; Gibson, J.P. Population genetic diversity and structure within and among disjunct populations of Alnus maritima (seaside alder) using microsatellites. Conserv. Genet. 2011, 12, 1003–1013. [Google Scholar] [CrossRef]
- McVean, D.N. Alnus glutinosa (L.) Gaertn. J. Ecol. 1953, 41, 447–466. [Google Scholar] [CrossRef]
- Brasier, C.M.; Kirk, S.A.; Delcan, J.; Cooke, D.L.; Jung, T.; In’t Veld, M. Phytophthora alni sp nova и ее варианты: Oбoзначение группы нoвых гетерoплoидных гибридных патoгенoв. Mycol. Res. 2004, 108, 1172–1184. [Google Scholar] [CrossRef]
- José, M.C.S.; Valladares, S.; Janeiro, L.V.; Corredoira, E. Cryopreservation of in vitro-grown shoot tips of Alnus glutinosa (L.) Gaertn. Acta Physiol. Plant. 2014, 36, 109–116. [Google Scholar] [CrossRef]
- San José, M.D.C.; Janeiro, L.V.; Martínez, M.T.; Valladares, S.; Cernadas, M.J.; Montenegro, R.; Corredoira, E. Biotechnological Approaches for the Improvement and Conservation of Alnus glutinosa (L.) Gaertner. Plant Tissue Cult. Propag. Conserv. Crop Improv. 2016, 467–486. [Google Scholar]
- Buiteveld, J.; Copini, P.; Hendriks, C.M.A. Conservation and Sustainable Use of Forest Genetic Resources for Food and Agriculture: Country Report of the Netherlands for the Second State of the World’s Forest Genetic Resources for Food and Agriculture; No. 54; Wageningen University & Research, Centre for Genetic Resources (CGN): Wageningen, The Netherlands, 2021. [Google Scholar]
- Doyle, J.J. A rapid total DNA preparation procedure for fresh plant tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Peakall, R.; Smouse, P. GENALEX 6: Genetic analysis in excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]






| Locus | Allele Size | Population | ||||
|---|---|---|---|---|---|---|
| KS1 | PVL3 | PVL4 | PVL5 | PVL6 | ||
| Ag01 | 135 | 2 | - | - | - | - |
| Ag05 | 159 | 1 | - | - | - | - |
| Ag13 | 259 | 5 | - | - | - | - |
| 283 | - | 1 | - | - | - | |
| Ag14 | 293 | 10 | - | - | - | - |
| 295 | 1 | - | - | - | - | |
| 315 | 2 | - | - | - | - | |
| 325 | - | - | 2 | - | - | |
| Ag20 | 311 | - | - | - | 1 | - |
| 313 | 2 | - | - | - | - | |
| Ag30 | 102 | - | - | - | 1 | - |
| Ag35 | 183 | - | - | - | - | 1 |
| 209 | 3 | - | - | - | - | |
| Population | N | Na | Ne | Ho | He | uHe | I |
|---|---|---|---|---|---|---|---|
| KS1 | 21 | 5.000 | 3.246 | 0.583 | 0.634 | 0.649 | 1.248 |
| KS2 | 6 | 3.667 | 2.629 | 0.681 | 0.542 | 0.591 | 0.998 |
| PVL3 | 10 | 3.667 | 2.834 | 0.533 | 0.586 | 0.617 | 1.068 |
| PVL4 | 11 | 3.750 | 2.823 | 0.561 | 0.554 | 0.580 | 1.038 |
| PVL5 | 9 | 3.667 | 2.469 | 0.491 | 0.504 | 0.534 | 0.948 |
| PVL6 | 9 | 3.583 | 2.708 | 0.583 | 0.557 | 0.589 | 1.019 |
| PVL7 | 12 | 3.917 | 2.775 | 0.556 | 0.558 | 0.583 | 1.051 |
| Mean | 11.143 | 3.893 | 2.783 | 0.570 | 0.562 | 0.592 | 1.053 |
| Population | Location | Latitude (N) | Longitude (E) | Elevation (m) | Sample Size |
|---|---|---|---|---|---|
| KS1 | Northern Turgay | 52°32′39″ | 64°46′46″ | 130–160 | 14 |
| KS2 | 52°32′22″ | 64°45′44″ | 120–160 | 13 | |
| PVL3 | Bayanaul mountain forest massif | 50°48′354″ | 75°42′893″ | 483–498 | 10 |
| PVL4 | 50°49′595″ | 75°39′729″ | 477–504 | 11 | |
| PVL5 | 50°50′745″ | 75°32′345″ | 381–388 | 9 | |
| PVL6 | 50°51′698″ | 75°34′315″ | 401–406 | 9 | |
| PVL7 | 50°48′640″ | 75°45′450″ | 459–467 | 12 |
| Loci | Primer Sequences | Dye |
|---|---|---|
| Ag01 | F: CAGTCTATCTGCTACAAGCGTGGT | FAM |
| R: GACGTTTTCAACGACCAAAAACAC | ||
| Ag05 | F: AAGCAAAATCCCAAGGTATCCAGT | FAM |
| R: GGGGTTCCAACCAATTTATTCTTC | ||
| Ag09 | F: GATGGTAATGTGACGTGAGCAAAA | ROX |
| R: CCTATTCTCATCGTTTAAAGCCCC | ||
| Ag10 | F: AACTTGTCTTATTGTGCACTTGCG | FAM |
| R: ACATTTACGGCTAAACAGCATTCC | ||
| Ag13 | F: CAAGCGAAATAGATTCGTGGTCTT | R6S |
| R: CTTCCATTTGGAGCCTTAAAACAC | ||
| Ag14 | F: CAACCAACAAGGAGACAGAAACAA | FAM |
| R: TAAAATCTAACACCCCAAACGAGG | ||
| Ag20 | F: GGTTCCAAGTGGTAAGGGGAGTTA | TAMRA |
| R: GAGTGTGAGAATGTGGTTCACGAG | ||
| Ag23 | F: GGTTGGGCGAAAGTTTTATTTACAC | R6G |
| R:CCAGAAACGAACTAAGGCTAAGAAGA | ||
| Ag25 | F: GGATAAGAAGATAAAGGTGCATGGC | ROX |
| R: CTGTATATCCCCACCACACCTGA | ||
| Ag27 | F: CATTTGGTGTATGTGTTGCCAGTT | ROX |
| R: AATCAACAACTGCCAGGTAGAGGA | ||
| Ag30 | F: GGAACTCTGGAAACAGAAACAACG | FAM |
| R: AGCAAGGTAAAACTTCAGTAGCCG | ||
| Ag35 | F: CACGTTCAGCTTCATTGTGACTTC | ROX |
| R: TAATAGGGTTTGGGCCAACTTACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nurtaza, A.; Dyussembekova, D.; Shevtsov, A.; Islamova, S.; Samatova, I.; Koblanova, S.; Borodulina, O.; Kakimzhanova, A. Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers. Plants 2024, 13, 3032. https://doi.org/10.3390/plants13213032
Nurtaza A, Dyussembekova D, Shevtsov A, Islamova S, Samatova I, Koblanova S, Borodulina O, Kakimzhanova A. Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers. Plants. 2024; 13(21):3032. https://doi.org/10.3390/plants13213032
Chicago/Turabian StyleNurtaza, Aidana, Damira Dyussembekova, Alexandr Shevtsov, Symbat Islamova, Indira Samatova, Saule Koblanova, Olga Borodulina, and Almagul Kakimzhanova. 2024. "Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers" Plants 13, no. 21: 3032. https://doi.org/10.3390/plants13213032
APA StyleNurtaza, A., Dyussembekova, D., Shevtsov, A., Islamova, S., Samatova, I., Koblanova, S., Borodulina, O., & Kakimzhanova, A. (2024). Assessing Genetic Variability and Population Structure of Alnus glutinosa (Black Alder) in Kazakhstan Using SSR Markers. Plants, 13(21), 3032. https://doi.org/10.3390/plants13213032

