Native Trichoderma Induced the Defense-Related Enzymes and Genes in Rice against Xanthomonas oryzae pv. oryzae (Xoo)
Abstract
1. Introduction
2. Results
2.1. Antagonistic Activity of Some Fungal Isolates against X. oryzae pv. oryzae
2.2. Molecular Identification of Fungal Isolates BDISOF67R, BDISOF91R, BDISOF08R, and BDISOF09R
2.3. Effect of Some Selected Antagonistic Trichoderma Isolates on the Reduction of Lesion Length in Susceptible Check Cultivar (IR24) Caused by X. oryzae pv. oryzae
2.4. Differential Expression of Some Defense-Related Enzymes in Rice Induced by Selected Trichoderma Isolates in Response to X. oryzae pv. oryzae
2.4.1. Effect of Selected Trichoderma Isolates on Phenylalanine Ammonia-Lyase (PAL) Activity in Response to X. oryzae pv. oryzae
2.4.2. Influence of Selected Trichoderma Isolates in Induction of Catalase (CAT) Activity in Response to X. oryzae pv. oryzae
2.4.3. Effect of Selected Trichoderma Isolates in Induction of Polyphenoloxidase (PPO) Activity in Response to X. oryzae pv. oryzae
2.4.4. Influence of Selected Trichoderma Isolates in Induction of Peroxidase (POD) Activity in Response to X. oryzae pv. oryzae
2.5. Differential Expression of Some SA and JA Pathway Related Genes in Plants Treated with Trichoderma
2.5.1. Expression Levels of Some Selected Defense Related Genes Involved in Salicylic (SA) and Jasmonic (JA) Acid Pathways by RT-PCR
2.5.2. Expression Levels of Some Selected Defense-Related Genes Involved in Salicylic (SA) and Jasmonic (JA) Acid Pathways by Real-Time PCR (q-PCR)
3. Discussion
4. Materials and Methods
4.1. Identification of Trichoderma Species Antagonistic to X. oryzae pv. oryzae
4.2. Formulation of Trichoderma Species, Seed Priming, and Foliar Spray of Formulated Trichoderma Species
4.3. Inoculation of Rice Plants with X. oryzae pv. oryzae
4.4. Expression Analysis of Some Defense-Related Enzymes in Rice in Response to X. oryzae pv. oryzae
4.4.1. Phenylalanine Ammonia-Lyase (PAL)
4.4.2. Catalase (CAT)
4.4.3. Polyphenol Oxidase (PPO)
4.4.4. Peroxidase (POD)
4.5. Assessment of Differential Expression in Plants Treated with Trichoderma
4.6. RNA Extraction and cDNA Synthesis
4.7. Primer and Reverse Transcription (RT)-PCR
4.8. Real-Time qPCR Assay
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Vaughan, D.A.; Morishima, H.; Kadowaki, K. Diversity in the Oryza genus. Curr. Opin. Plant Biol. 2003, 6, 139–146. [Google Scholar] [CrossRef] [PubMed]
- Szareski, V.J.; Carvalho, I.R.; da Rosa, T.C.; Dellagostin, S.M.; de Pelegrin, A.J.; Barbosa, M.H.; dos Santos, O.P.; Muraro, D.S.; de Souza, V.Q.; Pedó, T. Oryza Wild Species: An alternative for rice breeding under abiotic stress conditions. Am. J. Plant Sci. 2018, 9, 1093. [Google Scholar] [CrossRef]
- BBS (Bangladesh Bureau of Statistics). 2020: Yearbook of Agricultural Statistics; 40th Series; Bureau of Statistics and Informatics Division (SID), Ministry of Planning, Government of the People ‘s Republic of Bangladesh: Dhaka, Bangladesh, 2020. [Google Scholar]
- Ansari, T.H.; Ahmed, M.; Akter, S.; Mian, M.S.; Latif, M.A.; Tomita, M. Estimation of rice yield loss using a simple linear regression model for bacterial blight disease. Bangladesh Rice J. 2019, 23, 73–79. [Google Scholar] [CrossRef]
- Haq, M.; Mia, M.A.T.; Rabbi, M.F.; Ali, M.A. Incidence and severity of rice diseases and insect pests in relation to climate change. In Climate Change and Food Security in South Asia; Lal, R., Sivakumar, M.V.K., Faiz, M.A., Rahman, A.H.M.M., Islam, K.R., Eds.; Springer: Dordrecht, The Netherlands, 2010; pp. 445–457. [Google Scholar]
- Niño-Liu, D.O.; Ronald, P.C.; Bogdanove, A.J. Xanthomonas oryzae pathovars: Model pathogens of a model crop. Mol. Plant Pathol. 2006, 7, 303–324. [Google Scholar] [CrossRef]
- Mew, T.W.; Alvarez, A.M.; Leach, J.E.; Swings, J. Focus on bacterial blight of rice. Plant Dis. 1993, 77, 5–12. [Google Scholar] [CrossRef]
- Chukwu, S.C.; Rafii, M.Y.; Ramlee, S.I.; Ismail, S.I.; Hasan, M.M.; Oladosu, Y.A.; Magaji, U.G.; Akos, I.; Olalekan, K.K. Bacterial leaf blight resistance in rice: A review of conventional breeding to molecular approach. Mol. Biol. Rep. 2019, 46, 1519–1532. [Google Scholar] [CrossRef]
- Yasmin, S.; Hafeez, F.Y.; Mirza, M.S.; Rasul, M.; Arshad, H.M.; Zubair, M.; Iqbal, M. Biocontrol of bacterial leaf blight of rice and profiling of secondary metabolites produced by rhizospheric Pseudomonas aeruginosa BRp3. Front Microbiol. 2017, 8, 1895. [Google Scholar] [CrossRef]
- Kumari, K.A.; Kumar, K.N.R.; Rao, C.N. Adverse effect of chemical fertilizers and pesticides on human health and environment. J. Chem. Pharmaceut. Sci. 2014, 31, 50–151. [Google Scholar]
- Kannan, C.; Mishra, D.; Rekha, G.; Maruthi, P.; Shaik, H.; Sundaram, R.M. Diversity analysis of antagonistic microbes against bacterial leaf and fungal sheath blight diseases of rice. Egypt. J. Biol. Pest Control. 2021, 31, 1–16. [Google Scholar] [CrossRef]
- Shobha, B.; Lakshmeesha, T.R.; Ansari, M.A.; Almatroudi, A.; Alzohairy, M.A.; Basavaraju, S.; Alurappa, R.; Niranjana, S.R.; Chowdappa, S. Mycosynthesis of ZnO nanoparticles using Trichoderma spp. isolated from rhizosphere soils and its synergistic antibacterial effect against Xanthomonas oryzae pv. oryzae. J. Fungi 2020, 6, 181. [Google Scholar] [CrossRef]
- Gangwar, G.P.; Sinha, A.P. Evaluation of Trichoderma spp. and fluorescent pseudomonads for the management of bacterial leaf blight of rice. Indian Phytopath. 2012, 65, 89–91. [Google Scholar]
- Mishra, D.; Rajeswari, B.; Rao, P.R.; Maheswari, T.U.; Kannan, C. Friendly microbes help rice to grow and suppress its pathogens: Trichoderma and Bacillus Vs Xanthomonas in rice. Environ. Conserv. J. 2021, 22, 197–209. [Google Scholar] [CrossRef]
- Jain, A.; Chatterjee, A.; Das, S. Synergistic consortium of beneficial microorganisms in rice rhizosphere promotes host defense to blight-causing Xanthomonas oryzae pv. oryzae. Planta 2020, 252, 1–25. [Google Scholar] [CrossRef] [PubMed]
- Abo-Elyousr, K.A.; Khalil Bagy, H.M.; Hashem, M.; Alamri, S.A.; Mostafa, Y.S. Biological control of the tomato wilt caused by Clavibacter michiganensis subsp. michiganensis using formulated plant growth-promoting bacteria. Egypt. J. Biol. Pest Control. 2019, 29, 1–8. [Google Scholar] [CrossRef]
- Wilson, M.; Lindow, S.E. Release of recombinant microorganisms. Annu. Rev. Microbial. 1993, 47, 913–944. [Google Scholar] [CrossRef] [PubMed]
- Jambhulkar, P.P.; Sharma, P.; Manokaran, R.; Lakshman, D.K.; Rokadia, P.; Jambhulkar, N. Assessing synergism of combined applications of Trichoderma harzianum and Pseudomonas fluorescens to control blast and bacterial leaf blight of rice. Eur. J. Plant Pathol. 2018, 152, 747–757. [Google Scholar] [CrossRef]
- Gangwar, G.P. Field efficacy of formulation of fungal bioagents against bacterial leaf blight of rice caused by Xanthomonas oryzae pv. oryzae (Uyeda and Ishiyama) Dowson. J. Appl. Nat. Sci. 2013, 5, 423–426. [Google Scholar] [CrossRef]
- Wu, G.; Zhang, Y.; Wang, B.; Li, K.; Lou, Y.; Zhao, Y.; Liu, F. Proteomic and Transcriptomic Analyses Provide Novel Insights into the Crucial Roles of Host-Induced Carbohydrate Metabolism Enzymes in Xanthomonas oryzae pv. oryzae Virulence and Rice-Xoo Interaction. Rice 2021, 14, 1–22. [Google Scholar] [CrossRef]
- Ryan, E.P.; Heuberger, A.L.; Weir, T.L.; Barnett, B.; Broeckling, C.D.; Prenni, J.E. Rice bran fermented with Saccharomyces boulardii generates novel metabolite profiles with bioactivity. J. Agric. Food Chem. 2011, 59, 1862–1870. [Google Scholar] [CrossRef]
- Singh, R.R.; Chinnasri, B.; De Smet, L.; Haeck, A.; Demeestere, K.; Van Cutsem, P.; Van Aubel, G.; Gheysen, G.; Kyndt, T. Systemic defense activation by COS-OGA in rice against root-knot nematodes depends on stimulation of the phenylpropanoid pathway. Plant Physiol. Biochem. 2019, 142, 202–210. [Google Scholar] [CrossRef]
- Kloepper, J.W.; Tuzun, S.; Liu, L.; Wei, G. Plant growth-promoting rhizobacteria as inducers of systemic disease resistance. Pest Manag. Biol. Based Technologies. Am. Chem. Soc. Books Wash. DC 1993, 156–165. [Google Scholar]
- Pieterse, C.M.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.; Bakker, P.A. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef] [PubMed]
- Sticher, L.; Mauch-Mani, B.; Métraux, A.J. Systemic acquired resistance. Annu. Rev. Phytopathol. 1997, 35, 235–270. [Google Scholar] [CrossRef]
- Kessler, A.; Halitschke, R.; Baldwin, I.T. Silencing the jasmonate cascade: Induced plant defenses and insect populations. Science 2004, 305, 665–668. [Google Scholar] [CrossRef] [PubMed]
- Van Loon, L.C. Plant responses to plant growth-promoting rhizobacteria. In New Perspectives and Approaches in Plant Growth-Promoting Rhizobacteria Research; Springer: Berlin/Heidelberg, Germany, 2007; pp. 243–254. [Google Scholar]
- Maksimov, I.V.; Valeev, A.S.; Cherepanova, E.A.; Burkhanova, G.F. Effect of chitooligosaccharides with different degrees of acetylation on the activity of wheat pathogen-inducible anionic peroxidase. Appl. Biochem. Microbiol. 2014, 50, 82–87. [Google Scholar] [CrossRef]
- van Loon, L.C.; Rep, M.; Pieterse, C.M. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef]
- Hammond-Kosack, K.E.; Jones, J.D.G. Resistance gene-dependent plant defense responses. Plant Cell Rep. 1996, 8, 1773. [Google Scholar]
- Choodamani, M.S.; Hariprasad, P.; Sateesh, M.K.; Umesha, S. Involvement of catalase in bacterial blight disease development of rice caused by Xanthomonas oryzae pv. oryzae. Int. J. Pest Manag. 2009, 55, 121–127. [Google Scholar] [CrossRef]
- Sofo, A.; Scopa, A.; Nuzzaci, M.; Vitti, A. Ascorbate peroxidase and catalase activities and their genetic regulation in plants subjected to drought and salinity stresses. Int. J. Mol. Sci. 2015, 16, 13561–13578. [Google Scholar] [CrossRef]
- Sharma, S.D.; Kumar, P.; Raj, H.; Bhardwaj, S.K. Isolation of arbuscular mycorrhizal fungi and Azotobacter chroococcum from local litchi orchards and evaluation of their activity in the air-layers system. Sci. Hortic. 2009, 123, 117–123. [Google Scholar] [CrossRef]
- Kim, D.S.; Hwang, B.K. An important role of the pepper phenylalanine ammonia-lyase gene (PAL1) in salicylic acid-dependent signalling of the defence response to microbial pathogens. J. Exp. Bot. 2014, 65, 2295–2306. [Google Scholar] [CrossRef] [PubMed]
- Hemm, M.R.; Rider, S.D.; Ogas, J.; Murry, D.J.; Chapple, C. Light induces phenylpropanoid metabolism in Arabidopsis roots. Plant J. 2004, 38, 765–778. [Google Scholar] [CrossRef]
- Tahsili, J.; Sharifi, M.; Safaie, N.; Esmaeilzadeh-Bahabadi, S.; Behmanesh, M. Induction of lignans and phenolic compounds in cell culture of Linum album by culture filtrate of Fusarium graminearum. J. Plant Interact. 2014, 9, 412–417. [Google Scholar] [CrossRef]
- Adss, I.A.; Amer, G.; Bayoumy, S.R.; Eid, R. Effect of abscisic acid, salicylic acid, potassium silicate, and Trichoderma harzianum as biocontrol agent to induce the tomato resistance against early blight disease caused by Alternaria solani. Alex. Sci. Exch. J. 2021, 42, 773–787. [Google Scholar] [CrossRef]
- Samal, P.; Mohapatra, P.K.; Naik, S.K.; Mukherjee, A.K. Improved photosystem II and defense enzymes activity in rice (Oryza sativa) by biopriming against Xanthomonas oryzae pv. oryzae. Funct. Plant Biol. 2020, 48, 298–311. [Google Scholar]
- Zhang, F.; Wang, Y.; Liu, C.; Chen, F.; Ge, H.; Tian, F.; Yang, T.; Ma, K.; Zhang, Y. Trichoderma harzianum mitigates salt stress in cucumber via multiple responses. Ecotoxicol. Environ. Saf. 2019, 170, 436–445. [Google Scholar] [CrossRef]
- Rais, A.; Jabeen, Z.; Shair, F.; Hafeez, F.Y.; Hassan, M.N. Bacillus spp., a bio-control agent enhances the activity of antioxidant defense enzymes in rice against Pyricularia oryzae. PLoS ONE 2017, 12, e0187412. [Google Scholar] [CrossRef]
- Kim, S.I.; Song, J.T.; Jeong, J.Y.; Seo, H.S. Niclosamide inhibits leaf blight caused by Xanthomonas oryzae in rice. Sci. Rep. 2016, 6, 1–13. [Google Scholar] [CrossRef]
- Conrath, U.; Beckers, G.J.; Flors, V.; García-Agustín, P.; Jakab, G.; Mauch, F.; Newman, M.A.; Pieterse, C.M.; Poinssot, B.; Pozo, M.J.; et al. Priming: Getting ready for battle. Mol. Plant-Microbe Interact. 2006, 19, 1062–1071. [Google Scholar] [CrossRef]
- Im, J.H.; Choi, C.; Park, S.R.; Hwang, D.J. The OsWRKY6 transcriptional cascade functions in basal defense and Xa1-mediated defense of rice against Xanthomonas oryzae pv. oryzae. Planta 2022, 255, 1–10. [Google Scholar] [CrossRef]
- Moon, H.; Jeong, A.R.; Kwon, O.K.; Park, C.J. Oryza-Specific Orphan Protein Triggers Enhanced Resistance to Xanthomonas oryzae pv. oryzae in Rice. Front. Plant Sci. 2022, 13, 859375. [Google Scholar] [CrossRef]
- Yang, J.; Duan, G.; Li, C.; Liu, L.; Han, G.; Zhang, Y.; Wang, C. The crosstalks between jasmonic acid and other plant hormone signaling highlight the involvement of jasmonic acid as a core component in plant response to biotic and abiotic stresses. Front. Plant Sci. 2019, 10, 1349. [Google Scholar] [CrossRef] [PubMed]
- Saxena, A.; Mishra, S.; Ray, S.; Raghuwanshi, R.; Singh, H.B. Differential reprogramming of defense network in Capsicum annum L. plants against colletotrichum truncatum infection by phyllospheric and rhizospheric trichoderma strains. J. Plant Growth Regul. 2020, 39, 751–763. [Google Scholar] [CrossRef]
- Ding, L.N.; Yang, G.X.; Yang, R.Y.; Cao, J.; Zhou, Y. Investigating interactions of salicylic acid and jasmonic acid signaling pathways in monocots wheat. Physiol. Mol. Plant Pathol. 2016, 93, 67–74. [Google Scholar] [CrossRef]
- Peng, X.; Wang, H.; Jang, J.C.; Xiao, T.; He, H.; Jiang, D.; Tang, X. OsWRKY80-OsWRKY4 module as a positive regulatory circuit in rice resistance against Rhizoctonia solani. Rice 2016, 9, 1–14. [Google Scholar] [CrossRef]
- Contreras-Cornejo, H.A.; Macías-Rodríguez, L.; Beltrán-Peña, E.; Herrera-Estrella, A.; López-Bucio, J. Trichoderma-induced plant immunity likely involves both hormonal-and camalexin-dependent mechanisms in Arabidopsis thaliana and confers resistance against necrotrophic fungi Botrytis cinerea. Plant Signal. Behave. 2011, 6, 1554–1563. [Google Scholar] [CrossRef]
- Mitsuhara, I.; Iwai, T.; Seo, S.; Yanagawa, Y.; Kawahigasi, H.; Hirose, S.; Ohkawa, Y.; Ohashi, Y. Characteristic expression of twelve rice PR1 family genes in response to pathogen infection, wounding, and defense-related signal compounds (121/180). Mol. Genet. Genom. 2008, 279, 415–427. [Google Scholar] [CrossRef]
- Hwang, S.H.; Lee, I.A.; Yie, S.W.; Hwang, D.J. Identification of an OsPR10a promoter region responsive to salicylic acid. Planta 2008, 227, 1141–1150. [Google Scholar] [CrossRef] [PubMed]
- Fukushima, S.; Mori, M.; Sugano, S.; Takatsuji, H. Transcription factor WRKY62 plays a role in pathogen defense and hypoxia-responsive gene expression in rice. Plant Cell Physiol. 2016, 57, 2541–2551. [Google Scholar] [CrossRef] [PubMed]
- Qiu, D.; Xiao, J.; Xie, W.; Cheng, H.; Li, X.; Wang, S. Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice. BMC Plant Biol. 2009, 9, 1–12. [Google Scholar] [CrossRef]
- Ross, C.A.; Liu, Y.; Shen, Q.J. The WRKY gene family in rice (Oryza sativa). J. Integr. Plant Biol. 2007, 49, 827–842. [Google Scholar] [CrossRef]
- Wu, K.L.; Guo, Z.J.; Wang, H.H.; Li, J. The WRKY family of transcription factors in rice and Arabidopsis and their origins. DNA Res. 2005, 12, 9–26. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, L. The WRKY transcription factor superfamily: Its origin in eukaryotes and expansion in plants. BMC Evol. Biol. 2005, 5, 1–12. [Google Scholar] [CrossRef]
- Divya, M.; Rajeswari, B.; Raghuveer Rao, P.; Maheswari, U.T.; Kannan, C. Biological control of bacterial blight of rice using native isolates of Trichoderma and Bacillus in rice cultivar Telangana Sona (RNR 15048). 2021. [Google Scholar]
- Jain, A.; Singh, A.; Singh, S.; Sarma, B.K.; Singh, H.B. Biocontrol agents-mediated suppression of oxalic acid induced cell death during Sclerotinia sclerotiorum–pea interaction. J. Basic Microbiol. 2015, 55, 601–606. Available online: http://epubs.icar.org.in/ejournal/index.php/IJPP/article/view/119311 (accessed on 22 December 2021). [CrossRef]
- Yang, S.M.; Shim, G.Y.; Kim, B.G.; Ahn, J.H. Biological synthesis of coumarins in Escherichia coli. Microb. Cell Factories 2015, 14, 1–12. [Google Scholar] [CrossRef]
- Shoresh, M.; Harman, G.E.; Mastouri, F. Induced systemic resistance and plant responses to fungal biocontrol agents. Annu Rev. Phytopathol. 2010, 48, 21–43. [Google Scholar] [CrossRef] [PubMed]
- Manav, M.; Thind, B.S. Management of bacterial blight of rice with bioagents. Plant Dis. Res.-Ludhiana 2002, 17, 21–28. [Google Scholar]
- Khan, A.A.; Rajbir, S. Influence of zinc on Trichoderma harzianum and sheath blight of rice under glasshouse conditions. Int. J. Plant Protect. 2015, 8, 303–306. [Google Scholar] [CrossRef]
- Kariuki, C.K.; Mutitu, E.W.; Muiru, W.M. Effect of Bacillus and Trichoderma species in the management of the bacterial wilt of tomato (Lycopersicum esculentum) in the field. Egypt. J. Biol. Pest Control. 2020, 30, 1–8. [Google Scholar] [CrossRef]
- Angraini, E.; Angraeni, D.N.; Umami, S.S.; Sumiati, E.; Taufiqurokhman, T. Antagonism of Lentinus Cladopus Lc4 Extract, Trichoderma sp. Jpa Extract on Bacillus sp., Xanthomonas sp. and E. coli. Int. J. Phys. Conf. Ser. 2019, 1155, 012057. [Google Scholar]
- Reino, J.L.; Guerrero, R.F.; Hernández-Galán, R.; Collado, I.G. Secondary metabolites from species of the biocontrol agent Trichoderma. Phytochem. Rev. 2008, 7, 89–123. [Google Scholar] [CrossRef]
- Verma, M.; Brar, S.K.; Tyagi, R.D.; Surampalli, R.N.; Valero, J. Antagonistic fungi, Trichoderma spp.: Panoply of biological control. Biochem. Eng. J. 2007, 37, 1–20. [Google Scholar] [CrossRef]
- Rubio, M.B.; Quijada, N.M.; Pérez, E.; Domínguez, S.; Monte, E.; Hermosa, R. Identifying beneficial qualities of Trichoderma parareesei for plants. Appl. Environ. Microbiol. 2014, 80, 1864–1873. [Google Scholar] [CrossRef] [PubMed]
- Shoresh, M.; Yedidia, I.; Chet, I. Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T203. Phytopathology 2005, 95, 76–84. [Google Scholar] [CrossRef] [PubMed]
- Chaman, M.E.; Copaja, S.V.; Argandoña, V.H. Relationships between salicylic acid content, phenylalanine ammonia-lyase (PAL) activity, and resistance of barley to aphid infestation. J. Agric. Food Chem. 2003, 51, 2227–2231. [Google Scholar] [CrossRef] [PubMed]
- Prathuangwong, S.; Buensanteai, N. Bacillus amyloliquefaciens induced systemic resistance against bacterial pustule pathogen with increased phenols, phenylalanine ammonia lyase, peroxidases and 1, 3-β-glucanases in soybean plants. Acta Phytopathol. Entomol. Hung. 2007, 42, 321–330. [Google Scholar] [CrossRef]
- Li, S.B.; Fang, M.; Zhou, R.C.; Huang, J. Characterization and evaluation of the endophyte Bacillus B014 as a potential biocontrol agent for the control of Xanthomonas axonopodis pv. dieffenbachiae–Induced blight of Anthurium. Biol. Control. 2012, 63, 9–16. [Google Scholar] [CrossRef]
- Li, Y.; Gu, Y.; Li, J.; Xu, M.; Wei, Q.; Wang, Y. Biocontrol agent Bacillus amyloliquefaciens LJ02 induces systemic resistance against cucurbits powdery mildew. Front. Microbiol. 2015, 6, 883. [Google Scholar] [CrossRef]
- Mei, L.I.; Hua, L.I.; Su, X.L.; Ying, T.I.; Huang, W.K.; Jie, M.E.; Jiang, X.L. The effects of Trichoderma on preventing cucumber fusarium wilt and regulating cucumber physiology. J. Integr. Agric. 2019, 18, 607–617. [Google Scholar]
- Peng, X.; Hu, Y.; Tang, X.; Zhou, P.; Deng, X.; Wang, H.; Guo, Z. Constitutive expression of rice WRKY30 gene increases the endogenous jasmonic acid accumulation, PR gene expression and resistance to fungal pathogens in rice. Planta 2012, 236, 1485–1498. [Google Scholar] [CrossRef]
- Mur, L.A.; Kenton, P.; Atzorn, R.; Miersch, O.; Wasternack, C. The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol. 2006, 140, 249–262. [Google Scholar] [CrossRef]
- De Vleesschauwer, D.; Xu, J.; Höfte, M. Making sense of hormone-mediated defense networking: From rice to Arabidopsis. Front. Plant Sci. 2014, 5, 611. [Google Scholar] [CrossRef] [PubMed]
- Vidhyasekaran, P. Bioengineering and Molecular Manipulation of Jasmonate Signaling System to Activate Plant Immune System for Crop Disease Management. In Plant Innate Immunity Signals and Signaling Systems; Springer: Dordrecht, The Netherlands, 2020; pp. 223–248. [Google Scholar]
- Uji, Y.; Taniguchi, S.; Tamaoki, D.; Shishido, H.; Akimitsu, K.; Gomi, K. Overexpression of OsMYC2 results in the up-regulation of early JA-rresponsive genes and bacterial blight resistance in rice. Plant Cell Physiol. 2016, 57, 1814–1827. [Google Scholar] [CrossRef] [PubMed]
- Satoh, K.; Kondoh, H.; De Leon, T.B.; Macalalad, R.J.; Cabunagan, R.C.; Cabauatan, P.Q.; Mauleon, R.; Kikuchi, S.; Choi, I.R. Gene expression responses to Rice tungro spherical virus in susceptible and resistant near-isogenic rice plants. Virus Res. 2013, 171, 111–120. [Google Scholar] [CrossRef] [PubMed]
- Brotman, Y.; Landau, U.; Cuadros-Inostroza, A.; Takayuki, T.; Fernie, A.R.; Chet, I.; Viterbo, A.; Willmitzer, L. Trichoderma-plant root colonization: Escaping early plant defense responses and activation of the antioxidant machinery for saline stress tolerance. PLoS Pathog. 2013, 9, e1003221. [Google Scholar] [CrossRef]
- Qiu, Y.; Yu, D. Over-expression of the stress-induced OsWRKY45 enhances disease resistance and drought tolerance in Arabidopsis. Environ. Exp. Bot. 2009, 65, 35–47. [Google Scholar] [CrossRef]
- Tian, X.L.; Cao, L.X.; Tan, H.M.; Zeng, Q.G.; Jia, Y.Y.; Han, W.Q.; Zhou, S.N. Study on the communities of endophytic fungi and endophytic actinomycetes from rice and their antipathogenic activities in vitro. World J. Microbiol. Biotechnol. 2004, 20, 303–309. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.J.W.T.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. A Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Kauffman, H.E. An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep. 1973, 57, 537–541. [Google Scholar]
- Dickerson, D.P.; Pascholati, S.F.; Hagerman, A.E.; Butler, L.G.; Nicholson, R.L. Phenylalanine ammonia-lyase and hydroxycinnamate: CoA ligase in maize mesocotyls inoculated with Helminthosporium maydis or Helminthosporium carbonum. Physiol. Plant Pathol. 1984, 25, 111–123. [Google Scholar] [CrossRef]
- Aebi, H. Catalase in vitro. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1984; Volume 105, pp. 121–126. [Google Scholar]
- Zhu, G.L.; Zhong, H.W.; Zhang, A.Q. Plant Physiological Experimentation; Peking Univ. Press: Beijing, China, 1990; pp. 37–39. [Google Scholar]
- Hammerschmidt, R.; Nuckles, E.M.; Kuć, J. Association of enhanced peroxidase activity with induced systemic resistance of cucumber to Colletotrichum lagenarium. Physiol. Plant Pathol. 1982, 20, 73–82. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Isolate ID | Accession No. | Closest Relatives | Accession No. | Alignment | Homology |
---|---|---|---|---|---|
BDFISO67R | OP456159 | T. paraviridescens strain 36114DRJ | MF782827.1 | 602/605 | 99 |
T. erinaceum strain CIB T72 | EU280106.1 | 602/605 | 99 | ||
BDFISO91R | T. erinaceum strain QT22079 | KY225644.1 | 605/610 | 99 | |
OP456160 | T. erinaceum strain QT22077 | KY225643.1 | 605/612 | 99 | |
T. erinaceum strain CIB T72 | EU280106.1 | 602/605 | 99 | ||
BDISOF08R | OP456157 | T. asperellum bio-material USM | KU878976.1 | 298/318 | 94 |
BDISOF09R | OP456158 | T. asperellum isolate 20B | MZ044276.1 | 359/409 | 88 |
Treatments | Lesion Length (mm) | Reduction of Lesion Length (%) |
---|---|---|
Untreated control | 23.67a | 0.00 |
Seed priming | 6.33d | 75.00 |
T. paraviridescens | 5.50de | 75.00 |
T. erinaceum | 10.83c | 60.42 |
T. asperellum | 3.83e | 87.50 |
T. asperellum | 15.50b | 31.25 |
Level of significance | * | - |
CV (%) | 10.31 | - |
Treatment | PAL Activities (µmol s−1 g−1 *) | Times Increase over Control | ||||||
---|---|---|---|---|---|---|---|---|
Hours after Inoculation (HAI) | ||||||||
24 | 48 | 72 | 144 | 24 | 48 | 72 | 144 | |
Untreated control | 247 ± 26 | 239 ± 2 | 159 ± 3 | 269.5 ± 5 | ||||
Seed priming | 257 ± 8 | 286 ± 5 | 353 ± 25 | 313.5 ± 5 | 1.04 | 1.2 | 2.22 | 1.16 |
T. paraviridescens | 600 ± 309 | 609 ± 368 | 527 ± 281 | 599 ± 362 | 2.42 | 2.55 | 3.3 | 2.22 |
T. erinaceum | 587 ± 225 | 555 ± 199 | 647 ± 352 | 605 ± 269 | 2.37 | 2.32 | 4.05 | 2.25 |
T. asperellum | 706 ± 345 | 622 ± 384 | 530 ± 288 | 546 ± 375 | 2.85 | 2.6 | 3.32 | 2.03 |
T. asperellum | 556 ± 249 | 611 ± 300 | 682 ± 289 | 608 ± 314 | 2.25 | 2.56 | 4.27 | 2.26 |
Level of significance | NS | NS | NS | NS | ||||
CV (%) | 173 | 173 | 173 | 173 |
Treatment | CAT Activities (µmol H2O2 min−1 g−1) | Times Increase over Control | ||||||
---|---|---|---|---|---|---|---|---|
Hours after Inoculation (HAI) | ||||||||
24 | 48 | 72 | 144 | 24 | 48 | 72 | 144 | |
Untreated control | 50 ± 5b | 150 ± 5bc | 121 ± 5a | 104 ± 5a | ||||
Seed priming | 135 ± 5ab | 247 ± 5a | 128 ± 5a | 53 ± 62b | 2.7 | 1.65 | 1.06 | 0.51 |
T. paraviridescens | 273 ± 595a | 174 ± 2bc | 162 ± 46a | 218 ± 49b | 5.46 | 1.16 | 1.34 | 2.1 |
T. erinaceum | 264 ± 88ab | 223 ± 45b | 118 ± 4a | 158 ± 16b | 5.28 | 1.49 | 0.98 | 1.52 |
T. asperellum | 164 ± 29ab | 170 ± 3b | 59 ± 23a | 201 ± 26b | 3.28 | 1.13 | 0.49 | 1.94 |
T. asperellum | 271 ± 90ab | 113 ± 8c | 78 ± 14a | 367 ± 19b | 5.42 | 0.75 | 0.64 | 3.53 |
CV (%) | 48.75 | 12.35 | 18.22 | 29.71 | ||||
Level of Significance | * | * | NS | * |
Treatment | PPO Activities (Units g−1 min−1 FW) | Times Increase over Control | ||||||
---|---|---|---|---|---|---|---|---|
Hours after Inoculation (HAI) | ||||||||
24 | 48 | 72 | 144 | 24 | 48 | 72 | 144 | |
Untreated control | 247 ± 26b | 239 ± 2 | 159 ± 3c | 269 ± 5ab | ||||
Seed priming | 257 ± 8b | 286 ± 5 | 353 ± 25a | 313 ± 5a | 1.03 | 1.2 | 2.21 | 1.16 |
T. paraviridescens | 454 ± 92a | 257 ± 15 | 247 ± 1b | 254 ± 17ab | 1.77 | 1.07 | 1.55 | 0.94 |
T. erinaceum | 434 ± 71ab | 311 ± 45 | 271 ± 24ab | 296 ± 40ab | 0.95 | 1.3 | 1.7 | 1.10 |
T. asperellum | 428 ± 67ab | 276 ± 38 | 250 ± 7b | 222 ± 50b | 0.98 | 1.15 | 1.58 | 0.82 |
T. asperellum | 403 ± 96ab | 284 ± 27 | 324 ± 69ab | 274 ± 20ab | 0.94 | 1.19 | 2.03 | 1.01 |
LSD | 61.04 | 24.41 | 28.24 | 25.49 | ||||
CV (%) | 173.25 | 173.13 | 173.48 | 173.32 | ||||
Level of Significance | * | NS | * | * |
Treatment | POD Activities (Units min−1 g−1 FW) | Times Increase over Control | ||||||
---|---|---|---|---|---|---|---|---|
Hours after Inoculation (HAI) | ||||||||
24 | 48 | 72 | 144 | 24 | 48 | 72 | 144 | |
Untreated control | 760 ± 60b | 721 ± 55 | 1009 ± 29ab | 1191 ± 55 | ||||
Seed priming | 759 ± 55b | 851 ± 45 | 1186 ± 100ab | 1224 ± 0 | 0.99 | 1.18 | 1.17 | 1.03 |
T. paraviridescens | 850 ± 99b | 1118 ± 28 | 1503 ± 232ab | 1751 ± 1004 | 1.12 | 1.55 | 1.49 | 1.47 |
T. erinaceum | 831 ± 138b | 880 ± 281 | 1375 ± 486ab | 1866 ± 794 | 1.09 | 1.22 | 1.36 | 1.57 |
T. asperellum | 847 ± 237b | 736 ± 138 | 697 ± 425b | 1809 ± 151 | 1.11 | 1.02 | 0.69 | 1.52 |
T. asperellum | 1239 ± 109.5a | 762 ± 288 | 1704 ± 42a | 1338 ± 692 | 1.63 | 1.06 | 1.69 | 1.12 |
CV (%) | 107.35 | 162.37 | 285.25 | 460.37 | ||||
Level of Significance | * | NS | * | NS |
Genes | Primer Name | Sequence (5′-3′) | Marker Gene |
---|---|---|---|
OsPR1 | OsPR1forward | TTATCCTGCTGCTTGCTGGT | SA pathway |
OsPR1 reverse | GATGTTCTCGCCGTACTTCC | ||
OsPR10 | OsPR10 forward | GGCACCATCTACACCATGAA | SA pathway |
OsPR10 reverse | TTGTCGG CTGTGATGA ATGT | ||
OsWRKY45 | OsWRKY45 forward | CCGGCATGGAGTTCTTCAAG | SA pathway |
OsWRKY45 reverse | TATTT CTGTACACACGCGTGGAA | ||
OsWRKY62 | OsWRKY62 forward | AGGATGGGTACCAATGGA | SA pathway |
OsWR KY62 reverse | ACGAGTTGATGGAGATGGA | ||
OsWRKY71 | OsWRKY71 forward | AGCCCAA GA TCTCC AAGCTC | SA pathway |
OsWRKY71 reverse | ACGAGGATCGTGTTGTCCTC | ||
OsACS2 | OsACS2 forward | GGAATAAAGCTGC TGCCGAT | SA pathway |
OsACS2 reverse | TGAGCCTGAAG TCGTTGAAGC | ||
OsHI-LOX | OsHI-LOX forward | GCATCCCCAACAGCACATC | JA Pathway |
OsHI-LOX reverse | AATAAAGATTTGGGA GTGACATATTGG | ||
18S rRNA | 18S rRNA Forward | CTACGTCCCTGCCCTTTGTACA | |
18S rRNA Reverse | ACACTTCACCGGACCATTCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Islam, M.R.; Chowdhury, R.; Roy, A.S.; Islam, M.N.; Mita, M.M.; Bashar, S.; Saha, P.; Rahat, R.A.; Hasan, M.; Akter, M.A.; et al. Native Trichoderma Induced the Defense-Related Enzymes and Genes in Rice against Xanthomonas oryzae pv. oryzae (Xoo). Plants 2023, 12, 1864. https://doi.org/10.3390/plants12091864
Islam MR, Chowdhury R, Roy AS, Islam MN, Mita MM, Bashar S, Saha P, Rahat RA, Hasan M, Akter MA, et al. Native Trichoderma Induced the Defense-Related Enzymes and Genes in Rice against Xanthomonas oryzae pv. oryzae (Xoo). Plants. 2023; 12(9):1864. https://doi.org/10.3390/plants12091864
Chicago/Turabian StyleIslam, Md. Rashidul, Rabin Chowdhury, Arpita Saha Roy, Md. Nazmul Islam, Mamuna Mahjabin Mita, Samrin Bashar, Plabon Saha, Ridwan Ahmed Rahat, Mehedi Hasan, Mst. Arjina Akter, and et al. 2023. "Native Trichoderma Induced the Defense-Related Enzymes and Genes in Rice against Xanthomonas oryzae pv. oryzae (Xoo)" Plants 12, no. 9: 1864. https://doi.org/10.3390/plants12091864
APA StyleIslam, M. R., Chowdhury, R., Roy, A. S., Islam, M. N., Mita, M. M., Bashar, S., Saha, P., Rahat, R. A., Hasan, M., Akter, M. A., Alam, M. Z., & Latif, M. A. (2023). Native Trichoderma Induced the Defense-Related Enzymes and Genes in Rice against Xanthomonas oryzae pv. oryzae (Xoo). Plants, 12(9), 1864. https://doi.org/10.3390/plants12091864