Next Article in Journal
Subcuticular–Intracellular Hemibiotrophy of Colletotrichum lupini in Lupinus mutabilis
Previous Article in Journal
Ecophysiological Response of Vitis vinifera L. in an Urban Agrosystem: Preliminary Assessment of Genetic Variability
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Coffea canephora: Heterotic Crosses Indicated by Molecular Approach

1
Department of Plant Science, Universidade Estadual Norte Fluminense, Campos dos Goytacazes, Rio de Janeiro 28013-602, Brazil
2
Research Center, Universidade Estadual do Mato Grosso, Estudo e Desenvolvimento Agroambiental, Tangará da Serra 78300-000, Brazil
3
Department of Plant Science, Universidade Federal do Espírito Santo, São Mateus 29932-540, Brazil
*
Author to whom correspondence should be addressed.
Plants 2022, 11(22), 3023; https://doi.org/10.3390/plants11223023
Submission received: 26 September 2022 / Revised: 28 October 2022 / Accepted: 6 November 2022 / Published: 9 November 2022
(This article belongs to the Section Plant Molecular Biology)

Abstract

The genus Coffea comprises more than 100 species, of which the most commercially important are Coffea arabica and Coffea canephora. The latter is a self-incompatible plant with high natural genetic variability. The detection of polymorphism at the DNA level by molecular markers allowed significant progress with the selection of superior plants. The objective of this study was the molecular characterization of C. canephora using microsatellite markers. To this end, a population of forty-four C. canephora genotypes and one C. arabica genotype, was evaluated with 21 primers. These primers identified 61 alleles in the population and between 2 and 5 alleles per locus. The information index indicated a high level of polymorphism of the analyzed markers. According to the observed and expected heterozygosity, the genetic diversity in the population is high. The overall inbreeding coefficient of the population detected high heterozygosity and zero inbreeding within this population. Genetic diversity among the accessions was also evaluated by the unweighted pair-group method based on arithmetic averages (UPGMA). Six groups were formed based on Mojena’s cutting rule and three using the Bayesian approach. These results confirmed the existence of genetic diversity, genetic variability and a potential for selection in future breeding efforts involving the 45 genotypes studied.

1. Introduction

Of the more than 100 species of the genus Coffea, C. arabica L. and C. canephora Pierre ex A. Froehner account for approximately 99% of the global coffee bean production. Brazil is the world’s largest producer and second largest consumer of coffee. The production and demand of C. canephora has increased significantly due to its use in blends with C. arabica, to produce espresso and soluble coffee, owing to the high soluble solids content, high industrial yield and contribution to a full-bodied coffee [1].
In view of the gametophytic self-incompatibility, C. canephora is an allogamous species [2] with high natural genetic variability, cross-pollination and high genotypic diversity among plants in the same plantation [3,4]. In breeding programs, the availability of genetic variability is a basic prerequisite to ensure genetic gains with selection, and genetic diversity studies can serve as guidelines for the choice of parents in the development of clonal varieties [5].
In breeding programs in the past, plants were selected based on morphological markers, which are modified by environmental influence [6]. With the enhancement of molecular biology techniques, the selection of superior plants was significantly advanced by the use of molecular markers, for allowing the detection of polymorphism at the DNA level [7,8]. Molecular markers are more advantageous than phenotypic markers because they are free from environmental influence and also because they can be used at any stage of plant development [9].
These markers are already applied in studies on C. canephora breeding in the context of targeted high-throughput genotyping [10], genetic diversity characterization and species reclassification [11] or to evaluate the genetic diversity [12], population structure and genetic relationships [13].
Clonal cultivars of C. canephora must consist of a combination of genetically divergent genotypes to improve pollination efficiency and ensure successful crop production. In this sense, genetic diversity is essential to maintain productivity, quality and also raise the capacity of response to biotic and abiotic stresses [14]. Thus, the genetic characterization of C. canephora clones is fundamental in the planning of recombination strategies between genotypes and the composition of new cultivars, and SSR markers are an effective technique for these purposes. We raised the hypothesis that molecular markers such as SSR are able to detect differences at the DNA level allowing the distinction of genotypes without environmental influence.
Thus, the objectives of this research consisted of: (i) estimation of the genetic distance between plants or clones; (ii) genetic characterization, to measure and structure the genetic variability between genotypes; and (iii) identification of divergent plants for use as parents in coffee breeding programs.

2. Results and Discussion

2.1. Diversity Parameters via SSR

For this study, a total of 48 primers between SSR and EST were tested to identify the most divergent plants within this C. canephora population and thus analyze the molecular genetic diversity.
In the analysis of genetic diversity of the study population, 21 of the 48 tested primers produced amplified DNA fragments, which were selected for being polymorphic.
In evaluation studies by Baltazar et al. [12], on the genetic diversity of C. arabica accessions from several areas of the Philippines conserved in an ex situ collection, 19 SSR markers were used, 15 of which were polymorphic. The markers used in this study were also highly polymorphic, i.e., they can be used to detect differences between genotypes based on their genetic relationships.
The 21 primers detected 61 alleles in the population and 2 to 5 alleles per locus. Five alleles were detected at SSR-463 and SSR-1005, indicating greater diversity of these than of the other loci. Averaged across the entire data set, the study population had 2.9 alleles (Table 1). This low number of alleles may be associated with the clonal propagation of the population as well as the small population size.
However, the estimated allele frequency is strongly influenced by the number of plants in the population and tends to increase with increasing sample size. The reason is that in large samples, the chance of detecting rare, i.e., low-frequency alleles in the population is greater [15,16].
In studies by Kiwuka et al. [17], on the susceptibility to climate, reproductive potential and conservation of genetic diversity in native and cultivated C. canephora in Uganda, a mean of 4.7 alleles per locus in native populations was found. In comparison, a greater number of alleles was detected in the collections of cultivated genotypes. The relatively low allelic diversity found in the native population may be due to restricted gene flow between the closest populations, isolation by fragmentation, genetic drift, anthropogenic disturbance in those forests or mortality due to extreme stress conditions. These results were expected, since different populations and germplasm collections were analyzed in the above studies, while in this study only one clonal C. canephora population was evaluated, which explains the low number of alleles it contains.
In a study of digital DNA screening of microsatellite markers in Coffea sp germplasm, conserved in Costa Rica, Sanchéz et al. [18], found a mean of 4 alleles in Arabica coffee and 3.5 alleles in non-Arabica coffee (C. canephora, C. excelsa and C. liberica). These authors also evaluated 46 Arabica and 3 non-Arabica coffee genotypes and concluded that the mean number of alleles was influenced by the number of samples, their genetic base, number of microsatellites used and polymorphism level. This result is similar to ours, as the low allele frequency found in this study may be due to the low number of genotypes in the studied population.
In an analysis of the population structure and genetic relationships between 33 C. arabica genotypes and three diploid Coffea species (C. canephora, C. eugenioides and C. racemosa) from Brazil and Ethiopia, using 30 SSR markers, Da Silva et al. [13], identified a total of 206 alleles (mean of 6.9), i.e., high allele richness. Although in this study the number of alleles analyzed was lower, these are still a potential source of new alleles to be exploited in coffee breeding programs.
For the 21 microsatellite loci analyzed in this study, the information index (I) of 12 loci (57%) exceeded 0.5. The highest value was 1.038 for locus SSR-845, the lowest 0.184 for locus SSR-552 and the mean across all loci was 0.58 (Table 1).
Studies by Botstein et al. [19], proposed that a locus can be classified as highly informative when the information index exceeds 0.5, moderately informative when between 0.5 and 0.25 and uninformative if lower than 0.25. According to this classification, the above mean value indicates a high level of polymorphism for the analyzed SSR-EST markers.
The genetic diversity of Arabica coffee in the Philippines was analyzed using SSR markers by Baltazar et al. [12], with a view to applications in breeding and selection, to guarantee the genetic stability of the coffee varieties. These authors found information indices between 0.140 and 0.609 and mentioned that most of the markers were moderate to highly informative, indicating their effectiveness in measuring the genetic diversity of the collection. Similarly, in this study, more than 50% of the loci were considered highly informative, which allowed an evaluation of the polymorphism at each locus of the study population with the forty-four genotypes of C. canephora and one C. arabica genotype. The index can be affected by the number of alleles and allele frequency at the locus.
The observed heterozygosity (Ho) ranged from 0.093 at locus SSR-1005 to 1 at locus SSR-744 (mean of 0.359). The observed heterozygosity is a measure of the frequency of heterozygotes in a studied sample and indicates the existence of genetic variation in the population, since each heterozygote has different alleles for a given gene, and the frequency of heterozygotes tends to be higher with higher genetic diversity.
According to Hardy–Weinberg expectations, the expected heterozygosity (He) ranged from 0.073 at SSR-552 to 0.588 at locus SSR-081 (mean of 0.34).
The observed heterozygosity was higher than expected at 17 loci (80%). When the Ho is greater than expected, this may suggest an excess of heterozygotes in the population in relation to the Hardy–Weinberg equilibrium model, De Moura et al. [20]. In the case of excess heterozygotes, there is no inbreeding, and the genetic diversity of the population is high, as the genotypes were previously selected in breeding programs.
In a study on the genetic structure and diversity of C. canephora in Upper Guinea, Labouisse et al. [21], found greater diversity in the Congolese than the Guinean group, with higher He and Ho values. They reported a mean He of 0.67 and mean Ho of 0.51 for the Congolese but a mean He of 0.48 and mean Ho of 0.34 for the Guinean group. The higher the number of alleles in a population, the greater the probability of it being heterozygous. The number of alleles found in this study, although rather low, may still contribute to the maintenance of the high diversity found in this population.
Antioxidant activity and stable free radicals in Robusta green coffee genotypes were analyzed by [22] and the authors stated that the natural reproduction of Robusta species generates highly heterozygous plants and populations with high genetic variability. Consequently, the characterization and exploitation of the genetic variability of this species might identify valuable genetic resources, for production systems or for breeding programs.
Analyzing the values of the fixation index (F) or inbreeding coefficient of the study population, the highest F values (0.947 and 0.522) were found at loci SSR-353 and SSR-1005. However, most values were lower and negative at 14 loci (66%) and the overall population mean was −0.035 (Table 1).
The fixation index is one of the most important parameters in population genetics, as it measures the balance between homozygotes and heterozygotes in populations, which can vary from −1 to +1. Values close to zero indicate random mating, negative values indicate excess heterozygosity and zero inbreeding for that locus in the study population, while high positive values indicate high inbreeding [23], causing the frequency of homozygotes to be higher than expected under H.W. equilibrium.
According to our results, the fixation index at one locus was very close to 1 (0.947). This may be related to the absence of alleles at that locus, caused by failure in the amplification of alleles, the occurrence of null alleles, or may also indicate the presence of inbreeding. According to Cruz et al. [24], the main effect of inbreeding is a decline in population heterozygosity. Another factor that may have raised the fixation index is the lower number of alleles at this locus, as according to Morgante et al. [25], the loci with the lowest number of alleles are probably located in genome regions where the transcription rate is lower than in the other regions.
Also, with regard to the fixation index, most values found were lower and negative, indicating heterozygosity excess at these loci. The general population mean was −0.035, i.e., zero inbreeding for this population. Another factor is that at the loci with negative values, heterozygosity was also greater than expected, which indicates that the alleles at these loci were not being fixed by inbreeding.
These data showed high rates of cross-pollination in the species under study as well as wide genetic diversity among the analyzed clones. Due to being a self-incompatible species, C. canephora receives pollen from several other coffee plants in its surroundings, maintaining the high heterozygosity and zero inbreeding, thus minimizing the risks of genetic drift and allele loss in the population. This result is extremely interesting from the point of view of productivity, showing that the establishment of homogeneous progenies for productivity and quality-related traits may be expected. Concomitantly, diversity is expected among the progenies, so that the best can be selected and cloned to ensure productivity and quality of the final product.

2.2. Relative Kinship and Estimates of Genetic Dissimilarity in C. canephora

Obvious kinship (K) was not detected in most individuals in this population (Figure 1). An approximate 76% of the pair-wise kinship estimates were between 0 and 0.09. About 23% between 0.1 and 0.3 and less than 1.5% of the pair-wise kinship estimates were from around 0.4 to 0.5 representing some familial relationships (Figure 1).
The genetic diversity among the accessions was evaluated using the average group linkage method (UPGMA), with the stopping rule of [26], resulting in six groups.
In genetic diversity studies with microsatellite markers, the most commonly used clustering method is UPGMA, which maximizes the cophenetic correlation coefficient and improves data reliability.
In this analysis, the cophenetic correlation index was 0.83, indicating a strong correlation between the dissimilarity matrix and the cophenetic distance matrix computed from the dendrogram. The cophenetic correlation estimate varies from 0 to 1; the higher this coefficient, the greater the representativeness of the dendrogram in relation to the genetic distance matrix. The diversity was confirmed by the formation of groups containing similar genotypes in the cluster analysis using the hierarchical UPGMA method (Figure 2).
Group I contained the largest number of plants, with 16 (35.55%). Group II contained 13 plants (28.88%), group III, 8 (17.77%), group IV, 6 (13.33%) and groups V and VI, 1 plant each (2.22% each). This amount of genotypes in the same group indicates that these plants share the highest number of alleles for the evaluated loci.
The seed-derived genotype and C. arabica genotype formed the fifth and sixth groups, respectively, with such high variability that they did not fit into any of the other groups. Groups with only one genotype were the most divergent in relation to the other groups. It is worth mentioning that both were used as a type of control. Genotype C. arabica was included in this study as control, and it was expected to have divergent genetic characteristics isolated from the C. canephora genotypes. Moreover, the fact that C. arabica formed an isolated group can confirm the effectiveness of the SSR–EST primers that are also used to distinguish different species of the genus Coffea.
The detection of divergent genotypes in genetically distinct heterotic groups of C. canephora populations is essential for the development of new cultivars of this crop. By selecting the most dissimilar genotypes for future crosses in breeding programs, the problems of genetic self-incompatibility in the species can be avoided.
The most genetically dissimilar genotypes, 122 and Arabica (0.71), had 13 alleles in common, at 16 of the 21 analyzed loci, although in this study Arabica was not used in crosses, but as a control.
Genotype Emcapa 02 was most dissimilar in relation to some genotypes, e.g., Z40, 700 and P1, with dissimilarity measures of 0.64, 0.63 and 0.61, respectively, and 16, 15 and 16 alleles in common.
The dissimilarity between the genotypes Peneirão and 122 and between Ouro Negro 2 and AT was 0.63 and 0.61, respectively; the first two had 16 and the latter 19 alleles in common.
These same genotypes were studied by [27], who reported a productivity of 97.10 bags ha−1 for Emcapa 02, 74.55 bags ha−1 for genotype Z40 and 89.19 bags ha−1 for genotype 700. The productivity of genotypes Peneirão and 122 was 81.07 and 99.22 bags ha−1, and genotypes Ouro Negro 2 and AT produced 74.70 and 128.93 bags ha−1, respectively. Genotypes 700 (Group III) and AT (Group IV) were not only dissimilar and highly productive, but also have an exceptionally low water requirement for mature coffee (less than 315 L) to yield one 60 kg bag of green coffee beans (Table 2).
Our data are promising since breeding targets the identification of genotypes with high productivity but also sufficient variability for selection, which was confirmed in the above-mentioned genotypes, with the greatest dissimilarities and high productivity.
The productivity of genotypes Bamburral and Z21 (Group I), A1 (Group II), L80 (Group III) and AT (Group IV) exceeded 100 bags ha−1 (118.08; 102.49; 108.19 and 128.93 bags ha−1, respectively) (Table 2). These high-yielding genotypes were allocated to different groups and can therefore be used in future crosses, targeting even higher productivity and variability.
The genotypes Emcapa 143 and Tardio V were the least dissimilar, in other words, the closest (0.06 dissimilarity, 39 common alleles). Most genotypes had shorter distances, probably due to the way in which these clones had been selected by farmers. In general, these producers all selected for the same agronomic characteristics of coffee trees, addressing high yield, plant height and disease resistance, among others. In this way, variability may have declined, and the clones may be somewhat similar. However, possible crosses will be proposed between plants from different groups, based on the greatest dissimilarity and high productivity.
The genotypes within a group are genetically similar, evidencing a certain pattern among most genotypes of the same group. This similarity was observed in groups I, II, III and IV, because in spite of the high genotypic diversity in this population, as mentioned above, some genotypes had a certain degree of genetic similarity and were therefore clustered in the same group.
The similarity between these genotypes can be explained by genetic drift that occurred when conilon was first introduced in the country, according to 30.
According to Fazuoli et al. [28], despite the high diversity, a large amount of seed from few plants was imported to establish the first plantations in Brazil, in the southeast region. The observed diversity is therefore still a minor sample of the natural diversity of the species; in addition, this variability has been decimated and may be at risk due to intense selection practiced by farmers over the years.
According to Cruz et al. [29] and Carmona et al. [30], the study of genetic divergence between accessions of a particular crop is essential to know and understand the genetic variability it contains. The resulting data are useful for the preservation and use of accessions, since genetically distinct and promising genotypes could be identified, making the grouping of these lines possible using statistical procedures, with a view to establishing homogeneity within and heterogeneity between the groups.
Genetic divergence analyses can be used to refine the selection of parents to be crossed. Crosses between highly divergent parents can maximize progeny heterozygosity and heterosis, thus increasing the chances of selecting superior elite plants. Clones with greater genetic dissimilarity can be selected for population formation, because by recommending a set of hybrids with greater genetic distances, the problems of genetic self-incompatibility of the species are minimized. In addition to the genetic distance, crosses between genotypes with a lower degree of kinship should be prioritized. As verified in Figure 1, the minority of peer-relatedness estimates were between 0.1 and 0.5.

2.3. Analysis of Genetic Structure

The Bayesian approach, based on the K criterion described by Evanno et al. (2005), used the alleles for inferences about the genetic structure of C. canephora genotypes and K = 3 was indicated as the most likely number of clusters (Figure 3 and Supplementary Material Figure S1). In a Bayesian analysis of the genetic structure and diversity of C. canephora in Upper Guinea, Labouisse et al. [21] found K = 5.
An adherence probability of 70% that each genotype belongs to a certain group was assumed. The 45 genotypes evaluated were grouped as follows: 25 genotypes in group I (red), four in group II (green) and 16 in group III (blue) (Figure 4). Some plants have mixed probabilities, i.e., they have alleles in common, which belong to the three groups (Figure 3 and Supplementary Material Table S1).
Genotypes 37, 15, 32, 39, 2, 10, 29, 42, 7, 9, 27, 22, 20, 26, 3, 40, 5 and 28 have 100% adherence to the red group and genotypes 30, 4, 11, 36, 24, 19, 1, 43, 35 and 23 have 100% adherence to the blue group. This organization means that the genotypes in the red/blue/green group have sets of alleles that differentiate them for the set of markers used.
The plants 33, 16, 25, 34 and 8 have characteristics of all three groups, that means, less than 70% adherence to any of the three groups. Therefore, some plants are more likely to adhere to the red or the blue group, which could indicate that they share alleles. The SSR markers proved efficient in differentiating the different genotypes from the different locations, according to their genetic variability. The presence of genotypes with mixed probabilities can be explained by the genetic structure of the population, which comprises a small number of genotypes that share alleles with each other, due to their form of reproduction.
Using a Bayesian analysis, the groups were distinguished with regard to the analyzed loci and the plants that shared the same analyzed genomic regions were detected. This kind of clustering is promising as an orientation for crosses between C. canephora genotypes that belong to different groups, as they are genetically distant. It is important to combine these data with agronomic performance data of these genotypes, to select the plants with the greatest agronomic potential.

3. Materials and Methods

3.1. Experimental Area

The experiment was carried out in a plantation of 43 C. canephora genotypes, most of which had been selected by coffee growers in the region. Planting occurred in April 2014 in Nova Venécia, a county in northern Espírito Santo, Brazil, on a private property (lat. 18°66′23″ S, long. 40°43′07″ W; at least 199 m asl), where the mean annual temperature is 23 °C. The regional climate is tropical, characterized by hot and humid summers and dry winters, classified as Aw by Köppen (Alvares et al., 2013). The soil of the site was classified as a Latossolo Vermelho-Amarelo, distrófico, with clayey texture and wavy relief [27].
The genotypes were arranged in a randomized complete block design, with three replications, and each treatment consisted of seven plants of each genotype. The 44 genotypes (Table 3) were propagated from cuttings, planted at a spacing of 3 m between rows and 1 m between plants (3 × 1), equivalent to 3333 plants per hectare, and four stems per plant were left to grow. Two genotypes, identified as Clone 1 and Clone 2, were taken from another area to compare their genetic divergence with the above genotypes. For this reason, no yield-related data from previous scientific research was available. One Coffea arabica genotype of a cultivar (Catucaí 2SL) was also used, resulting in a total of 45 genotypes.
Management practices were applied according to the crop-specific technical guidelines and consisted basically of weed control with herbicides and brush cutters, preventive phytosanitary management, liming, fertilization and drip irrigation [27].

3.2. Sampling of Plant Material

Five light green (young) leaves were collected from the apex of each genotype (of one plant per genotype). The samples were immediately wrapped in aluminum foil, labelled and first frozen in liquid nitrogen. The samples were then transported on dry ice to the laboratory and stored at 80 °C until DNA extraction.

3.3. DNA Extraction

Genomic DNA was extracted and analyzed at the DNA Marker Sector of the Plant Breeding Laboratory of the Center of Agricultural Science and Technologies, State University of Northern Rio de Janeiro Darcy Ribeiro (LMGV/CCTA/UENF), Campos dos Goytacazes, RJ.
The frozen samples were ground with a pestle in crucibles with liquid nitrogen and stored in 2.0 mL microtubes. Genomic DNA was extracted by the method proposed by [34], with adaptations.
After extraction, the DNA was analyzed on 1% agarose gel with 1X TAE buffer (Tris, Sodium acetate, EDTA, pH 8.0), using a 100 bp Lambda (λ) marker (100 ng/μL−1) (Invitrogen, Waltham, MA, USA) and stained with a mixture of Gel RedTM and Blue Juice (1:1). The samples were photo-documented with the DNR MiniBIS Pro® bio-imaging system. Based on the images, the DNA concentration was estimated in comparison with the 100 bp marker and the DNA samples were diluted to a working concentration of 10 ng/μL−1.

3.4. Primer Screening

The microsatellite and genomic primers for this study were selected from coffee cultivars for being polymorphic [35].
For the polymerase chain reaction (PCR), a total of 58 primer pairs were tested and used to amplify SSR and EST loci of C. canephora and C. arabica, within a temperature gradient of 50 °C to 60 °C. After screening, a set of 21 primer pairs was selected for the amplification reactions (Table 4).

3.5. Polymerase Chain Reaction (PCR)

A 35-cycle PCR amplification was carried out in an (Applied Biosystems™ Veriti™, Waltham, MA, USA) 96-Well Thermal Cycler, as follows: 94 °C for 4 min (initial denaturation); 94 °C for 2 min (cyclic denaturation); primer-specific temperature, in °C, for 1 min (annealing); 72 °C for 2 min (cyclic extension); 72 °C for 10 min (final extension); and holding step at 4 °C for unlimited time. The final volume of each sample was 13 μL, containing 2 μL DNA (5 ng/μL), 1.50 μL 10X Buffer (NH4SO4), 1.5 μL MgCl2 (25 mM), 1.5 μL dNTPs (2 mM), 1 μL primer (R + F) (5 μM) and 0.12 μL Taq-DNA polymerase (5 U/μL) (Invitrogen, Carlsbad, CA, USA).
The PCR products were diluted at a ratio of 6 μL sample to 18 μL buffer E of kit DNF 900, and subjected to capillary electrophoresis (Fragment Analyzer, AATI, Santa Clara, CA, USA), where amplified fragments between 35 and 500 bp long were separated at a resolution of approximately 2 bp. Each run lasted 2 h 20 min at 8 kW.

3.6. Statistical Analysis of Molecular Variables

The data of the 21 amplified SSR and EST markers were converted into numerical codes for each allele per locus. This numerical matrix was constructed by assigning values from one to the maximum number of alleles per locus, as described below: one locus with three alleles in homozygous form is represented as 11, 22 and 33 (A1A1, A2A2 and A3A3) and 12, 13 and 23 for those in heterozygous form (A1A2, A1A3 and A2A3). Based on the numerical matrix, three indices were tested: unweighted index, weighted index and the Smouse and Peakall index [23]. Based on the highest cophenetic correlation, the weighted index was used, and the analyses were run on GENES software [36].
j 1 L p j c j
where:
pj = aj/A: weight associated with locus j, determined by:
aj: total number of alleles at locus j
A: total number of alleles studied
j = 1 L p j = 1
cj: number of common alleles between accession pairs i and i’.
The index represents similarity measures, while for cluster analysis, dissimilarity measures are recommended, defined by:
D = 1 − S
Once the distance matrix was calculated, dendrogram clustering was performed using the UPGMA method (Unweighted Pair-Group Method Average), on Mega software version 6 [37]. The optimal number of markers was estimated with GENES software [36] and the graph plotted with SigmaPlot software v14.
The genetic variability among the 45 genotypes was estimated with Genalex 6.5 software [23], based on the following parameters: number of alleles per polymorphic locus (NA), observed heterozygosity (Ho), expected heterozygosity (He), information index (I) and fixation index (ƒ). Relative kinship (K) among samples was calculated using 21 SSR markers by SPAGeDi software [38], and the Loiselle coefficient [39] was used to create the pair-wise kinship matrix (45 × 45).

3.7. Genetic Structure of the Population

To assess the structure of the 45 genotypes, a method based on Bayesian clustering algorithms was used, on STRUCTURE version 2.3.4 software [40]. To this end, we used the admixture model and independent allele frequencies, with a burn-in period of 250,000, followed by a final extension (Markov Chain Monte Carlo) of 750,000 iterations. Twenty simulations were run for each possible value of k (1–10).
The Δk statistical test was performed using Structure Harvester software and the Evanno criterion [41]. This criterion is based on the mean and standard deviation from the mean posterior probability (LnP(D)) values estimated at each of the 10 interactions per k. The Δki values were estimated as:
Δki = ABS (ki + 1 − (2 × ki) + ki − 1)/standard deviation of Ki
where:
I is the number of simulated groups, from i = 1 to i = 10; and ABS is the control module.
This Δk value was estimated for each k and the highest Δk selected. After choosing the optimal Δk, the simulation with the lowest LnP(D) value was chosen from a run of 10 simulations. In the resulting graph, each color represents a possible group of structured plants.

4. Conclusions

The SSR markers used in this study discriminated the C. canephora genotypes efficiently and were useful to make headway in breeding of conilon coffee. Genetic variability was confirmed in the evaluated population, which was structured into six distinct groups by UPGMA clustering and into three groups using a Bayesian analysis. Crosses between Bamburral and Z21 (Group I), A1 (Group II), L80 (Group III) and AT (Group IV) individuals are recommended in order to maintain the genetic variability of the population and high productivity. There is no kinship between the indicated genotypes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11223023/s1, Figure S1: Structure cluster graphs of 44 C. canephora and 1 genotype of C. arabica in Brazil with minor and major modes for the data. The runs were performed for K = 1 to 10 with 20 replicates, and division for runs by mode is provided below the graphs. In the graph, each horizontal bar represents an individual palm tree, and the proportion of each color in the bar corresponds to the proportion of the individual genotypes assigned to a given cluster. Codes correspond to their identification. Individuals labels: 1 = AP; 2 = Ouro negro 2; 3 = 18; 4 = Ouro negro 1; 5 = Graudão HP; 6 = Peneirão; 7 = Ouro Negro; 8 = Z18; 9 = Clementino; 10 = Beira Rio 8; 11 = VerdimD; 12 = Z39; 13 = Bamburral; 14 = P2; 15 = Imbigudinho; 16 = AT; 17 = Emcapa 153; 18 = Bicudo; 19 = Alecrim; 20 = Z38; 21 = 122; 22 = Sementes; 23 = Valcir P; 24 = Clone 1; 25 = Z40; 26 = CH1; 27 = Emcapa 143; 28 = VerdimR; 29 = Tardio C; 30 = Clone 2; 31 = 700; 32 = Z29; 33 = Emcapa 02; 34 = Pirata; 35 = A1; 36 = Z36; 37 = Z37; 38 = B01; 39 = Tardio V; 40 = Z21; 41 = Z35; 42 = LB1; 43 = L80; 44 = P1; 45 = Arábica; Table S1: The average in percentages of estimated membership coefficients of each individual to the inferred K cluster for 45 C. canephora genotypes and 1 C. arabica genotype.

Author Contributions

Conceptualization, P.S., H.V., A.V. and F.P.; methodology, P.S., E.S., M.B., H.V., A.V. and F.P. software, P.S., E.S. and M.B.; validation, P.S., H.V., A.V., F.P. and E.S.; formal analysis, P.S.; E.S. and M.B.; investigation, P.S. and E.S.; resources, P.S. and E.S.; data curation, P.S., E.S. and A.V.; writing—original draft preparation, P.S. and E.S.; writing—review & editing, P.S., E.S. and H.V.; visualization, P.S., E.S. and H.V.; supervision, H.V., E.S., A.V. and F.P.; project administration, H.V., A.V. and F.P.; funding acquisition, H.V., A.V. and F.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The study does not report any data.

Acknowledgments

I thank the Universidade Estadual Norte Fluminense for supporting the research and CNPq for granting the scholarship and the Universidade Federal do Espírito Santo for the research partnership.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Companhia Nacional de Abastecimento—CONAB. Acompanhamento da Safra Brasileira de Café–Safra 2021. Brasília. 2021. Available online: https://www.conab.gov.br/info-agro/safras/cafe (accessed on 24 March 2022).
  2. Moraes, M.S.; Teixeira, A.L.; Ramalho, A.R.; Espíndula, M.C.; Ferrão, M.A.G.; Rocha, R.B. Characterization of gametophytic self-incompatibility of superior clones of Coffea canephora. Genet. Mol. Res. 2018, 17, 16039876. [Google Scholar] [CrossRef]
  3. Ramalho, A.R.; Rocha, R.B.; Souza, F.F.; Veneziano, W.; Teixeira, A.L. Genetic gain in the productivity of processed coffee from the selection of clones of ‘Conilon’ coffee. Rev. Cienc. Agron. 2016, 47, 516–523. [Google Scholar] [CrossRef]
  4. Bergo, C.L.L.; Miqueloni, D.P.; Lunz, A.M.P.; De Assis, G.M.L. Estimation of genetic parameters and selection of Coffea canephora progenies evaluated in Brazilian Western Amazon. Coffee Sci. 2020, 15, e151663. [Google Scholar] [CrossRef]
  5. Babova, O.; Occhipinti, A.; Maffei, M.E. Chemical partitioning and antioxidant capacity of green coffee (Coffea arabica and Coffea canephora) of different geographical origin. Phytochemistry 2016, 123, 33–39. [Google Scholar] [CrossRef] [PubMed]
  6. Toppa, E.V.B.; Jadoski, C.J. O Uso dos Marcadores Moleculares no Melhoramento Genético de Plantas. Sci. Agrar. Parana. 2013, 12, 1–5. [Google Scholar] [CrossRef]
  7. Sousa, T.V.; Caixeta, E.T.; Alkimim, E.R.; de Oliveira, A.C.B.; Pereira, A.A.; Zambolim, L.; Sakiyama, N.S. Molecular markers useful to discriminate Coffea arabica cultivars with high genetic similarity. Euphytica 2017, 213, 75. [Google Scholar] [CrossRef]
  8. Alkimim, E.R.; Caixeta, E.T.; Sousa, T.V.; Pereira, A.A.; de Oliveira, A.C.B.; Zambolim, L.; Sakiyama, N.S. Marker-assisted selection provides arabica coffee with genes from other Coffea species targeting on multiple resistance to rust and coffee berry disease. Mol. Plant Breed. 2017, 37, 6. [Google Scholar] [CrossRef]
  9. Gartner, G.A.L.; McCouch, S.R.; Moncada, M.D.P. A genetic map of an interspecific diploid pseudo testcross population of coffee. Euphytica 2013, 192, 305–323. [Google Scholar] [CrossRef]
  10. Alkimim, E.R.; Caixeta, E.T.; Sousa, T.V.; da Silva, F.L.; Sakiyama, N.S.; Zambolim, L. High-throughput targeted genotyping using next-generation sequencing applied in Coffea canephora breeding. Euphytica 2018, 214, 50. [Google Scholar] [CrossRef]
  11. Anagbogu, C.F.; Bhattacharjee, R.; Ilori, C.; Tongyoo, P.; Dada, K.E.; Muyiwa, A.A.; Gepts, P.; Beckles, D.M. Genetic diversity and re-classification of coffee (Coffea canephora Pierre ex A. Froehner) from South Western Nigeria through geno-typing-by-sequencing-single nucleotide polymorphism analysis. Genet. Resour. Crop Evol. 2019, 66, 685–696. [Google Scholar] [CrossRef]
  12. Baltazar, M.D.; Fabella, J.M.A.O. Assessment of the genetic diversity of Philippine Arabica coffee (Coffea arabica L.) using SSR markers. Philipp. J. Sci. 2020, 149, 993–1003. [Google Scholar]
  13. da Silva, B.S.R.; Sant’Ana, G.C.; Chaves, C.L.; Androcioli, L.G.; Ferreira, R.V.; Sera, G.H.; Charmetant, P.; Leroy, T.; Pot, D.; Domingues, D.S.; et al. Population structure and genetic relationships between Ethiopian and Brazilian Coffea arabica genotypes revealed by SSR markers. Genetica 2019, 147, 205–216. [Google Scholar] [CrossRef] [PubMed]
  14. Ferrão, M.A.G.; Ferrão, R.G.; Fonseca, A.F.A.; Verdin Filho, A.C.; Volpi, P.S. Origin, geographical dispersion, taxonomy and genetic diversity of Coffea canephora. In Conilon Coffee; Ferrão, R.G., Fonseca, A.F.A., Ferrão, M.A.G., De Muner, L.H., Eds.; Incaper: Vitória, Brazil, 2019; pp. 85–110. [Google Scholar]
  15. Zucchi, M.I.; Brondani, R.P.V.; Pinheiro, J.B.; Chaves, L.J.; Coelho, A.S.G.; Vencovsky, R. Genetic structure and gene flow in Eugenia dysenterica DC in the Brazilian Cerrado utilizing SSR markers. Genet. Mol. Biol. 2003, 26, 449–457. [Google Scholar] [CrossRef][Green Version]
  16. Caballero, A.; Rodríguez-Ramilo, S.T.; Ávila, V.; Fernández, J. Management of genetic diversity of subdivided populations in conservation programmes. Conserv. Genet. 2010, 11, 409–419. [Google Scholar] [CrossRef]
  17. Kiwuka, C.; Goudsmit, E.; Tournebize, R.; de Aquino, S.O.; Douma, J.C.; Bellanger, L.; Crouzillat, D.; Stoffelen, P.; Sumirat, U.; Legnaté, H.; et al. Genetic diversity of native and cultivated Ugandan Robusta coffee (Coffea canephora Pierre ex A. Froehner): Climate influences, breeding potential and diversity conservation. PLoS ONE 2021, 16, e0245965. [Google Scholar] [CrossRef]
  18. Sánchez, E.; Solano, W.; Gatica-Arias, A.; Chavarría, M.; Araya-Valverde, E. Microsatellite DNA fingerprinting of Coffea sp. germplasm conserved in Costa Rica through singleplex and multiplex PCR. Crop Breed. Appl. Biotechnol. 2020, 20, 1–9. [Google Scholar] [CrossRef]
  19. Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar]
  20. De Moura, T.M.; Sebbenn, A.M.; Chaves, L.J.; Coelho, A.S.G.; Oliveira, G.C.X.; Kageyama, P.Y. Diversidade e estrutura genética espacial em populações fragmentadas de Solanum spp. do Cerrado, estimadas por meio de locos microssatélites. Sci. For. 2009, 37, 143–150. [Google Scholar]
  21. Labouisse, J.-P.; Cubry, P.; Austerlitz, F.; Rivallan, R.; Nguyen, H.A. New insights on spatial genetic structure and diversity of Coffea canephora (Rubiaceae) in Upper Guinea based on old herbaria. Plant Ecol. Evol. 2020, 153, 82–100. [Google Scholar] [CrossRef]
  22. Alves, A.L.; Leitão, A.E.B.; de Souza, P.E.N.; Santos, M.D.F.P.D.; Moscon, P.S.; Pessoa, M.S.; Pinheiro, C.A.; Morais, P.C.; Partelli, F.L. Antioxidant Activity and Stable Free Radicals in Robusta Green Coffee Genotypes/Atividade antioxidante e Radicais Estáveis Livres em Genótipos de Café Verde Robusta. Braz. J. Dev. 2021, 7, 37312–37330. [Google Scholar] [CrossRef]
  23. Peakall, R.; Smouse, P.E. GenAlEx 6, 5: Genetic analysis in Excel, Population genetic software for teaching and research an update. BMC Bioinform. 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
  24. Cruz, C.D.; Ferreira, F.M.; Pessoni, L.A. Biometria Aplicada ao Estudo da Diversidade Genética, 1st ed.; Produção Independente: Viçosa, Brazil, 2011. [Google Scholar]
  25. Morgante, M.; Hanafey, M.; Powell, W. Microsatellites are preferentially associated with nonrepetitive DNA in plant genomes. Nat. Genet. 2002, 30, 194–200. [Google Scholar] [CrossRef]
  26. Mojena, R. Hierarchical grouping methods and stopping rules: An evaluation. Comput. J. 1977, 20, 359–363. [Google Scholar] [CrossRef]
  27. Partelli, F.L.; Oliosi, G.; Dalazen, J.R.; da Silva, C.A.; Vieira, H.D.; Espindula, M.C. Proportion of ripe fruit weight and volume to green coffee: Differences in 43 genotypes of Coffea canephora. Agron. J. 2021, 113, 1050–1057. [Google Scholar] [CrossRef]
  28. Fazuoli, L.C.; Mistro, J.C.; Braghini, M.T. Melhoramento de café robusta no Instituto Agronômico de Campinas. In Tecnologia para Produção do Café Conilon; Zambolim, L., Ed.; UFV: Viçosa, Brazil, 2009; Volume cap.8, pp. 201–248. [Google Scholar]
  29. Cruz, C.D.; Carneiro, P.C.S.; Regazzi, A.J. Modelos Biométricos Aplicados ao Melhoramento Genético, 3rd ed.; UFV: Viçosa, Brazil, 2014; 668p. [Google Scholar]
  30. Carmona, P.A.; Peixoto, J.R.; Amaro, G.B.; Mendonça, M.A. Divergência genética entre acessos de batata-doce utilizando descritores morfoagronômicos das raízes. Hortic. Bras. 2015, 33, 241–250. [Google Scholar] [CrossRef]
  31. Bragança, S.M.; Carvalho, C.H.S.; Fonseca, A.F.A.F.; Ferrão, R.G. Clonal varieties of Conilon coffee for the Espírito Santo State, Brazil. Pesq. Agropec. Bras. 2001, 36, 765–770. [Google Scholar] [CrossRef]
  32. Partelli, F.L.; Giles, J.A.D.; Oliosi, G.; Covre, A.M.; Ferreira, A.; Rodrigues, E.V.M. Tributun: A coffee cultivar developed in partnership with farmers. Crop Breed. Appl. Biotechnol. 2020, 20, 30002025. [Google Scholar] [CrossRef]
  33. Partelli, F.B.; Golynski, A.; Ferreira, A.; Martins, M.Q.; Mauri, A.L.; Ramalho, J.C.; Vieira, H.D. Andina—First clonal cultivar of high-altitude conilon coffee. Crop Breed. Appl. Biotechnol. 2019, 19, 476–480. [Google Scholar] [CrossRef]
  34. Diniz, L.E.C.; Sakiyama, N.S.; Lashermes, P.; Caixeta, E.T.; Oliveira, A.C.B.; Zambolim, E.; Loureiro, M.E.; Pereira, A.A.; Zambolim, L. Analysis of AFLP markers associated to the Mex-1 resistance locus in Icatu progenies. Crop Breed. Appl. Biotechnol. 2005, 5, 387–393. [Google Scholar] [CrossRef]
  35. Souza, F.D.F.; Caixeta, E.T.; Ferrão, L.F.V.; Pena, G.F.; Sakiyama, N.S.; Zambolim, E.M.; Zambolim, L.; Cruz, C.D. Molecular diversity in Coffea canephora germplasm conserved and cultivated in Brazil. Crop Breed. Appl. Biotechnol. 2013, 13, 221–227. [Google Scholar] [CrossRef]
  36. Cruz, C.D. Genes: A Software Package for Analysis in Experimental Statistics and Quantitative Genetics. Acta Sci. 2013, 35, 271–276. [Google Scholar]
  37. Kumar, S.; Nei, M.; Dudley, J.; Tamura, K. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 2008, 9, 299–306. [Google Scholar] [CrossRef] [PubMed]
  38. Hardy, O.J.; Vekemans, X. spagedi: A versatile computer program to analyse spatial genetic structure at the individual or population levels. Mol. Ecol. Notes 2002, 2, 618–620. [Google Scholar] [CrossRef]
  39. Loiselle, B.A.; Spork, V.L.; Nason, J.; Graham, C. Spatial genetic structure of a tropical understory shrub. Psychotria officinalis (Rubiaceae). Am. J. Bot. 1995, 82, 1420–1425. [Google Scholar] [CrossRef]
  40. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
  41. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software structure: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
Figure 1. The distributions of pair-wise kinship coefficients for 45 genotypes of C. canephora.
Figure 1. The distributions of pair-wise kinship coefficients for 45 genotypes of C. canephora.
Plants 11 03023 g001
Figure 2. Dendrogram of genetic dissimilarity among 44 Coffea canephora genotypes and 1 Coffea arabica genotype, constructed using the UPGMA method, with SSR and EST markers.
Figure 2. Dendrogram of genetic dissimilarity among 44 Coffea canephora genotypes and 1 Coffea arabica genotype, constructed using the UPGMA method, with SSR and EST markers.
Plants 11 03023 g002
Figure 3. ΔK peak, indicating the optimal number of genetic clusters for Bayesian analysis with software Structure 2.3.4. UENF, Campos dos Goytacazes, RJ, 2021.
Figure 3. ΔK peak, indicating the optimal number of genetic clusters for Bayesian analysis with software Structure 2.3.4. UENF, Campos dos Goytacazes, RJ, 2021.
Plants 11 03023 g003
Figure 4. Bayesian inference clustering of 44 Coffea canephora and 1 Coffea arabica genotype. Genotypes are represented in the horizontal line and each genetic group is represented by a color. UENF, Campos dos Goytacazes, RJ, 2021.
Figure 4. Bayesian inference clustering of 44 Coffea canephora and 1 Coffea arabica genotype. Genotypes are represented in the horizontal line and each genetic group is represented by a color. UENF, Campos dos Goytacazes, RJ, 2021.
Plants 11 03023 g004
Table 1. Genetic parameters for the 20 SSR markers and 1 EST marker of the 44 analyzed genotypes. NA: number of alleles; I: information index; He: expected heterozygosity; Ho: observed heterozygosity; and F: fixation index.
Table 1. Genetic parameters for the 20 SSR markers and 1 EST marker of the 44 analyzed genotypes. NA: number of alleles; I: information index; He: expected heterozygosity; Ho: observed heterozygosity; and F: fixation index.
LocusNAIHoHeF
CaEST-01020.4130.2890.247−0.169
SSR-08130.9870.50.5880.15
SSR-30340.450.2110.196−0.076
SSR-34320.4740.2730.2980.083
SSR-35320.650.0240.4570.947
SSR-37330.6250.3940.363−0.085
SSR-43320.6250.6360.434−0.467
SSR-46350.8820.5120.487−0.05
SSR-48240.8690.5710.477−0.198
SSR-49330.5160.20.2840.296
SSR-55230.1840.0750.073−0.03
SSR-59320.2640.1480.137−0.08
SSR-70420.5280.3950.344−0.148
SSR-71420.2530.140.13−0.075
SSR-74431.00310.609−0.643
SSR-84541.0380.4320.5530.219
SSR-87530.4820.250.2570.029
SSR-100550.4620.0930.1950.522
SSR-106120.6110.60.42−0.429
SSR-114630.3330.1780.164−0.086
SSR-119320.6190.6190.427−0.448
Mean2.9040.5840.3590.34−0.035
Table 2. Mean yield in liters of coffee per 60 kg bag and productivity of the genotypes in the groups defined by microsatellite markers using the UPGMA clustering method.
Table 2. Mean yield in liters of coffee per 60 kg bag and productivity of the genotypes in the groups defined by microsatellite markers using the UPGMA clustering method.
GroupsGenotypesYieldProductivity
Liter/BagBag/ha
IEmcapa 143312.2694.65
Tardio V329.9569.84
Imbigudinho324.8279.67
Z29366.6170.15
18422.6749.30
Clementino355.4897.86
Bicudo366.2193.09
Z37363.7886.84
Ouro Negro346.3975.24
CH1359.8781.40
Beira rio 8439.7261.81
Z35402.2372.48
Bamburral357.2386.60
LB1312.21118.08
Verdim R398.3282.35
Z21294.01102.49
IITardio C345.1574.73
B01418.2143.11
Z39339.9295.48
Ouro Negro 2316.4674.70
A1365.44108.19
Alecrim341.4654.37
Z36316.6291.45
Verdim D336.6590.43
Ouro Negro 1359.8772.23
Clone 1--
Valcir P341.1187.93
Graudão HP317.5986.13
Z38372.5374.94
IIIAP313.5386.28
122330.0381.07
P2316.792.32
P1332.593.47
700303.2389.19
Clone 2--
Pirata379.6376.22
L80364.68105.53
IVZ18330.280.05
Z40356.1874.55
Emcapa 153322.4585.52
Peneirão326.699.22
AT303.49128.93
Emcapa 02323.1897.10
VSementes348.0670.32
VIArabica--
Source: [27].
Table 3. Identification of Coffea canephora and Coffea arabica genotypes used for molecular evaluation.
Table 3. Identification of Coffea canephora and Coffea arabica genotypes used for molecular evaluation.
Sample NumberNameSample NumberName
1AP24Clone 1
2Ouro negro 225Z40
31826CH1
4Ouro negro 127Emcapa 143
5Graudão HP28Verdim R
6Peneirão29Tardio C
7Ouro Negro30Clone 2
8Z1831700
9Clementino32Z29
10Beira Rio 833Emcapa 02
11Verdim D34Pirata
12Z3935A1
13Bamburral36Z36
14P237Z37
15Imbigudinho38B01
16AT39Tardio V
17Emcapa 15340Z21
18Bicudo41Z35
19Alecrim42LB1
20Z3843L80
2112244P1
22Sementes45Arabica
23Valcir P
Note: Genotype 33 belongs to cultivar Emcapa 8111, genotypes 17 and 22 to cv. Emcapa 8131 [31], genotypes 28, 10, 13, 34, 35 and 09 to cv. ‘Tributun’ [32], genotypes 35 and 44 to cv. ‘Andina’ [33], and genotype 22 were derived from seed-propagated plants. The other genotypes do not belong to any cultivar.
Table 4. Sequence of 21 microsatellite primer pairs used to analyze 44 C. canephora and 1 C. arabica genotype.
Table 4. Sequence of 21 microsatellite primer pairs used to analyze 44 C. canephora and 1 C. arabica genotype.
LocusSequence (5′3′)atReference
CaEST-010F: CTTCTTCATCCAACAACACG54 °C[35]
R: TGCCATTCCACTGTGTCACT
SSR-081F: CACTGGCATTAGAAAGCACC55 °C[35]
R: GGCAAAGTCAATGATGACTC
SSR-303F: ATGGGGCCAACTTGAATATG55 °C[35]
R: CAGGGCATCTATCTACTTCTCTTT
SSR-343F: GGAGACGCAGGTGGTAGAAG55 °C[35]
R: TCGAGAAGTCTTGGGGTGTT
SSR-353F: CTGGCATTAGAAAGCACCTTG54 °C[35]
R: GCTTGGCTCACTGTAGGACTG
SSR-373F: CAACACTATCTCTTGATTTTTCACT53 °C[35]
R: CGTGCAAGTCACATACTTTACTAC
SSR-433F: TTTTCTGGGTTTTCTGTGTTCTC50 °C[35]
R: TAACTCTCCATTCCCGCATT
SSR-463F: AATGAAGAAGAGGGTGGTG53 °C[35]
R: CGAGGGTATTGTTTTCCAG
SSR-482F: AGCAAGTGGAGCAGAAGAAG56 °C[35]
R: CGGTGAATAAGTCGCAGTC
SSR-493F: TGGAGAAGGCTGTTGAAACC56 °C[35]
R: GGCGTGAAGCAAAAAGGTAT
SSR-552F: GCAGGTATTTGAAGGATGAACC56 °C[35]
R: GTGTAGGTGGTGCGATGTGT
SSR-593F: CCAGCTCTCCTCACTCTTTTCA58 °C[35]
R: GGTGGTGGAGGGGTAATAGG
SSR-704F: GTAACCACCACCTCCTCTGC59 °C[35]
R: TGGAGGTAACGGAAGCTCTG
SSR-714F: GCTAAGTTCAATTGCCCCTGT55 °C[35]
R: GGGTTAATTTGATTGCGTGA
SSR-744F: TGGGGAAAAGAAGGATATAGACAAGAG59 °C[35]
R: GAGGGGGGCTAAGGGAATAACATA
SSR-845F: AAGTAGATTGGTGAAAGGGAAGC57 °C[35]
R: TCCTTCATTTTCTCCTCTTGGTT
SSR-875F: ATTCGACGACTCCAAAGCATA58 °C[35]
R: CCTTGCTGGCCCTTCCTT
SSR-1005F: ACCCTTTACTACTTATTTACTCTC50 °C[35]
R: ACATCCCCTTGCCATTTCTTC
SSR-1061F: CCCTCCCTCTTTCTCCTCTC56 °C[35]
R: TCTGGGTTTTCTGTGTTCTCG
SSR-1146F: TAACAGAAGCACCAAAACC53 °C[35]
R: TCTAAACCCACCTCACAAC
SSR-1193F: TTGCCATCATCGTTCATTCT56 °C[35]
R: GCATAGTGTCGGTTGTGTTGTT
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sousa, P.; Vieira, H.; Santos, E.; Viana, A.; Boaechat, M.; Partelli, F. Coffea canephora: Heterotic Crosses Indicated by Molecular Approach. Plants 2022, 11, 3023. https://doi.org/10.3390/plants11223023

AMA Style

Sousa P, Vieira H, Santos E, Viana A, Boaechat M, Partelli F. Coffea canephora: Heterotic Crosses Indicated by Molecular Approach. Plants. 2022; 11(22):3023. https://doi.org/10.3390/plants11223023

Chicago/Turabian Style

Sousa, Priscila, Henrique Vieira, Eileen Santos, Alexandre Viana, Marcela Boaechat, and Fábio Partelli. 2022. "Coffea canephora: Heterotic Crosses Indicated by Molecular Approach" Plants 11, no. 22: 3023. https://doi.org/10.3390/plants11223023

APA Style

Sousa, P., Vieira, H., Santos, E., Viana, A., Boaechat, M., & Partelli, F. (2022). Coffea canephora: Heterotic Crosses Indicated by Molecular Approach. Plants, 11(22), 3023. https://doi.org/10.3390/plants11223023

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop