Gene Expression in Cucurbita spp. Root and Crown during Phytophthora capsici Infection
Abstract
:1. Introduction
2. Results
2.1. Phytophthora capsici Disease Evolution in Cucurbita spp.
2.2. Normalized Relative Quantity
2.3. Differentially Expressed Genes between Inoculated and Non-Inoculated Plants
2.4. Differentially Expressed Genes between Tolerant and Susceptible Genotypes
3. Discussion
4. Materials and Methods
4.1. Materials, Test Conditions, and Inoculation
4.2. Sample Collection and qPCR Conditions
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
References
- Babadoost, M. Oomycete Diseases of Cucurbits: History, Significance, and Management. In Horticultural Reviews; Wiley-Blackwell: Hoboken, NJ, USA, 2016; Volume 44, pp. 279–314. [Google Scholar]
- De Cara García, M.; Plaza, M.F.; Vázquez, J.M.G. Pathogenic and Biological Characterization of Phytophthora capsici Isolates from Zucchini and Pepper in Southeast Spain. Span. J. Agric. Res. 2018, 16, 22. [Google Scholar] [CrossRef]
- Sanogo, S.; Ji, P. Integrated Management of Phytophthora capsici on Solanaceous and Cucurbitaceous Crops: Current Status, Gaps in Knowledge and Research Needs. Can. J. Plant Pathol. 2012, 34, 479–492. [Google Scholar] [CrossRef]
- Kabelka, E.; Les Padley, J.; Roberts, P.; Ramos, L.; Martinez, M.; Klassen, W. Resistance to Phytophthora capsici within Winter Squash (Cucurbita moschata) Derived from a Wild Cucurbita Species. HortScience 2007, 42, 1014. [Google Scholar]
- Padley, L.D.; Kabelka, E.A.; Roberts, P.D. Evaluation of Cucurbita Pepo Accessions for Crown Rot Resistance to Isolates of Phytophthora capsici. HortScience 2008, 43, 1996–1999. [Google Scholar] [CrossRef] [Green Version]
- Chavez, D.J.; Kabelka, E.A.; Chaparro, J.X. Screening of Cucurbita moschata Duchesne Germplasm for Crown Rot Resistance to Floridian Isolates of Phytophthora capsici Leonian. HortScience 2011, 46, 536–540. [Google Scholar] [CrossRef] [Green Version]
- Padley, L.D.; Kabelka, E.A.; Roberts, P.D. Inheritance of Resistance to Crown Rot Caused by Phytophthora capsici in Cucurbita. HortScience 2009, 44, 211–213. [Google Scholar] [CrossRef] [Green Version]
- Michael, V.N.; Fu, Y.; Meru, G. Inheritance of Resistance to Phytophthora Crown Rot in Cucurbita pepo. HortScience 2019, 54, 1156–1158. [Google Scholar] [CrossRef] [Green Version]
- Ayala-Doñas, A.; de Cara-García, M.; Talavera-Rubia, M.; Verdejo-Lucas, S. Management of Soil-Borne Fungi and Root-Knot Nematodes in Cucurbits through Breeding for Resistance and Grafting. Agronomy 2020, 10, 1641. [Google Scholar] [CrossRef]
- Wang, P.; Wu, H.; Zhao, G.; He, Y.; Kong, W.; Zhang, J.; Liu, S.; Liu, M.; Hu, K.; Liu, L.; et al. Transcriptome Analysis Clarified Genes Involved in Resistance to Phytophthora capsici in Melon. PLoS ONE 2020, 15, e0227284. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Shi, L.; Yang, S.; Lin, Y.; Weng, Y.; Li, X.; Hussain, A.; Noman, A.; He, S. Functional and Promoter Analysis of ChiIV3, a Chitinase of Pepper Plant, in Response to Phytophthora capsici Infection. Int. J. Mol. Sci. 2017, 17, 1661. [Google Scholar] [CrossRef] [Green Version]
- Wang, P.; Liu, X.; Guo, J.; Liu, C.; Fu, N.; Shen, H. Identification and Expression Analysis of Candidate Genes Associated with Defense Responses to Phytophthora capsici in Pepper Line “PI 201234”. Int. J. Mol. Sci. 2015, 16, 11417–11438. [Google Scholar] [CrossRef] [Green Version]
- Mahdy, A.; Abd-El-Mageed, M.; Abd-El-Latif, F.; Diab, M.; Saied, N. Induction of Resistance in Watermelon Plants against Fusarium Wilt Using Chemical Inducers and Compost under Greenhouse Conditions. Egypt. J. Phytopathol. 2015, 42, 1–19. [Google Scholar] [CrossRef]
- Zhang, M.; Xu, J.H.; Liu, G.; Yao, X.F.; Li, P.F.; Yang, X.P. Characterization of the Watermelon Seedling Infection Process by Fusarium oxysporum f. Sp. niveum. Plant Pathol. 2015, 64, 1076–1084. [Google Scholar] [CrossRef]
- Zvirin, T.; Herman, R.; Brotman, Y.; Denisov, Y.; Belausov, E.; Freeman, S.; Perl-Treves, R. Differential Colonization and Defence Responses of Resistant and Susceptible Melon Lines Infected by Fusarium oxysporum Race 1·2: Response of Melon to Fusarium oxysporum Race 1·2. Plant Pathol. 2010, 59, 576–585. [Google Scholar] [CrossRef]
- Hammerschmidt, R.; Bonnen, A.M.; Bergstrom, G.C.; Baker, K.K. Association of Epidermal Lignification with Nonhost Resistance of Cucurbits to Fungi. Can. J. Bot. 1985, 63, 2393–2398. [Google Scholar] [CrossRef]
- Chen, M.; Wang, G.; Wu, D.; Cheng, Y. Histopathological Differences between Cucumber Cultivars with Different Resistances to Fusarium Wilt. J. South China Agric. Univ. 2003, 24, 110–112. [Google Scholar]
- Alfaro-Fernández, A.; García-Luis, A. Colonisation and Histological Changes in Muskmelon and Autumn Squash Tissues Infected by Acremonium cucurbitacearum or Monosporascus cannonballus. Eur. J. Plant Pathol. 2009, 125, 73–85. [Google Scholar] [CrossRef]
- Ongena, M.; Daayf, F.; Jacques, P.; Thonart, P.; Benhamou, N.; Paulitz, T.C.; Belanger, R.R. Systemic Induction of Phytoalexins in Cucumber in Response to Treatments with Fluorescent Pseudomonads. Plant Pathol. 2000, 49, 523–530. [Google Scholar] [CrossRef]
- Punja, Z.K.; Zhang, Y.-Y. Plant Chitinases and Their Roles in Resistance to Fungal Diseases. J. Nematol. 1993, 25, 526–540. [Google Scholar] [PubMed]
- Bhuiyan, N.H.; Selvaraj, G.; Wei, Y.; King, J. Role of Lignification in Plant Defense. Plant Signal. Behav. 2009, 4, 158–159. [Google Scholar] [CrossRef] [Green Version]
- Shafee, T.M.A.; Lay, F.T.; Hulett, M.D.; Anderson, M.A. The Defensins Consist of Two Independent, Convergent Protein Superfamilies. Mol. Biol. Evol. 2016, 33, 2345–2356. [Google Scholar] [CrossRef] [Green Version]
- van der Weerden, N.L.; Bleackley, M.R.; Anderson, M.A. Properties and Mechanisms of Action of Naturally Occurring Antifungal Peptides. Cell. Mol. Life Sci. 2013, 70, 3545–3570. [Google Scholar] [CrossRef]
- Stotz, H.U.; Thomson, J.; Wang, Y. Plant Defensins: Defense, Development and Application. Plant Signal. Behav. 2009, 4, 1010–1012. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di, X.; Takken, F.L.W.; Tintor, N. How Phytohormones Shape Interactions between Plants and the Soil-Borne Fungus Fusarium oxysporum. Front. Plant Sci. 2016, 7, 170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Z.; Zheng, Z.; Huang, J.; Lai, Z.; Fan, B. Biosynthesis of Salicylic Acid in Plants. Plant Signal. Behav. 2009, 4, 493–496. [Google Scholar] [CrossRef]
- Houben, M.; van de Poel, B. 1-Aminocyclopropane-1-Carboxylic Acid Oxidase (ACO): The Enzyme That Makes the Plant Hormone Ethylene. Front. Plant Sci. 2019, 10, 695. [Google Scholar] [CrossRef] [Green Version]
- Krasnow, C.S.; Naegele, R.P.; Hausbeck, M.K. Evaluation of Fruit Rot Resistance in Cucurbita Germplasm Resistant to Phytophthora capsici Crown Rot. HortScience 2014, 49, 285–288. [Google Scholar] [CrossRef] [Green Version]
- Obrero, Á.; Die, J.V.; Román, B.; Gómez, P.; Nadal, S.; González-Verdejo, C.I. Selection of Reference Genes for Gene Expression Studies in Zucchini (Cucurbita pepo) Using QPCR. J. Agric. Food Chem. 2011, 59, 5402–5411. [Google Scholar] [CrossRef] [Green Version]
- Bellini, A.; Pugliese, M.; Guarnaccia, V.; Meloni, G.R.; Gullino, L.M. Calcium Oxide, Potassium Phosphite and a Trichoderma Enriched Compost Water Suspension Protect Capsicum annuum against Phytophthora capsici by Priming the Immune System. Pest. Manag. Sci. 2021, 77, 3484–3490. [Google Scholar] [CrossRef] [PubMed]
- Broekaert, W.F.; Delauré, S.L.; de Bolle, M.F.C.; Cammue, B.P.A. The Role of Ethylene in Host-Pathogen Interactions. Annu. Rev. Phytopathol. 2006, 44, 393–416. [Google Scholar] [CrossRef] [PubMed]
- Kasprzewska, A. Plant Chitinases—Regulation and Function. Cell. Mol. Biol. Lett. 2003, 8, 809–824. [Google Scholar]
- Li, Q.; Chen, Y.; Wang, J.; Zou, F.; Jia, Y.; Shen, D.; Zhang, Q.; Jing, M.; Dou, D.; Zhang, M. A Phytophthora capsici Virulence Effector Associates with NPR1 and Suppresses Plant Immune Responses. Phytopathol. Res. 2019, 1, 6. [Google Scholar] [CrossRef] [Green Version]
- Wildermuth, M.C.; Dewdney, J.; Wu, G.; Ausubel, F.M. Isochorismate Synthase Is Required to Synthesize Salicylic Acid for Plant Defence. Nature 2001, 414, 562–565. [Google Scholar] [CrossRef]
- Buzi, A.; Chilosi, G.; Magro, P. Induction of Resistance in Melon Seedlings against Soil-Borne Fungal Pathogens by Gaseous Treatments with Methyl Jasmonate and Ethylene. J. Phytopathol. 2004, 152, 491–497. [Google Scholar] [CrossRef]
- Frei, M. Lignin: Characterization of a Multifaceted Crop Component. Sci. World J. 2013, 2013, 436517. [Google Scholar] [CrossRef] [Green Version]
- Ayala-Doñas, A.; Fernandez-Plaza, M.; de Cara, M. Evaluación de La Tolerancia a Fusarium solani f. Sp. Cucurbita. In Libro de Actas del II Congreso de Jóvenes Investigadores en Ciencias Agroalimentarias; Almería University: Almería, Spain, 2019. [Google Scholar]
- Meyer, M.D.; Hausbeck, M.K. Age-Related Resistance to Phytophthora Fruit Rot in ‘Dickenson Field’ Processing Pumpkin and ‘Golden Delicious’ Winter Squash Fruit. Plant Disease 2013, 97, 446–552. [Google Scholar] [CrossRef] [Green Version]
- Tello, J.C.; Varés, F.; Lacasa, A. Manual de Laboratorio. Diagnóstico de Hongos, Bacterias y Nematodos Fitopatógenos; Ministerio de Agricultura y Pesca: Madrid, Spain, 1991.
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Green Version]
- Madeira, F.; Park, Y.M.; Lee, J.; Buso, N.; Gur, T.; Madhusoodanan, N.; Basutkar, P.; Tivey, A.R.N.; Potter, S.C.; Finn, R.D.; et al. The EMBL-EBI Search and Sequence Analysis Tools APIs in 2019. Nucleic Acids Res. 2019, 47, W636–W641. [Google Scholar] [CrossRef] [Green Version]
- Derbalah, A.; Elsharkawy, M.M.; Hamza, A.; El-Shaer, A. Resistance Induction in Cucumber and Direct Antifungal Activity of Zirconium Oxide Nanoparticles against Rhizoctonia solani. Pestic. Biochem. Phys. 2019, 157, 230–236. [Google Scholar] [CrossRef]
- Shoresh, M.; Yedidia, I.; Chet, I. Involvement of Jasmonic Acid/Ethylene Signaling Pathway in the Systemic Resistance Induced in Cucumber by Trichoderma asperellum T203. Phytopathology 2005, 95, 76–84. [Google Scholar] [CrossRef] [Green Version]
- Hellemans, J.; Mortier, G.; Paepe, A.D.; Speleman, F.; Vandesompele, J. QBase Relative Quantification Framework and Software for Management and Automated Analysis of Real-Time Quantitative PCR Data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef] [Green Version]
- Pomares-Viciana, T.; Die, J.; Del Río-Celestino, M.; Román, B.; Gómez, P. Auxin Signalling Regulation during Induced and Parthenocarpic Fruit Set in Zucchini. Mol. Breed. 2017, 37, 56. [Google Scholar] [CrossRef]
Days Post Inoculation | Species | Number of Evaluated Plants 2 | DSI 1 | Plant Showing Symptoms (%) |
---|---|---|---|---|
3 | MUCU-16 M63 | 38 | 0.05 ± 0.32 | 2.6 |
32 | 0 | 0 | ||
7 | MUCU-16 M63 | 30 | 0.13 ± 0.73 | 3.3 |
24 | 0 | 0 | ||
10 | MUCU-16 M63 | 30 | 0.47 ± 0.94 | 26.7 |
24 | 0.08 ± 0.28 | 8.3 | ||
14 | MUCU-16 M63 | 22 | 1.50 ± 1.68 | 50.0 |
16 | 0.50 ± 1.02 | 21.4 | ||
19 | MUCU-16 M63 | 14 | 2.14 ± 1.99 | 57.1 |
8 | 1.00 ± 1.85 | 25.0 |
Pooled Data | p-Value 3 | |||||||
---|---|---|---|---|---|---|---|---|
DPI | Genotypes | Tissue | N1 | CpACO | CpPAL | CpLPOX | CpChiIV | CpDEF |
all 2 | MUC + M63 | crown + root | 24 | - | - | - | - | 0.000 |
all | M63 | crown + root | 12 | - | - | 0.007 | - | 0.000 |
all | MUC | crown + root | 12 | - | - | - | - | - |
all | MUC + M63 | crown | 12 | - | - | - | - | 0.013 |
all | MUC + M63 | root | 12 | 0.001 | - | - | - | 0.000 |
3 | MUC + M63 | crown + root | 8 | - | - | - | - | - |
10 | MUC + M63 | crown + root | 8 | - | - | - | - | 0.002 |
14 | MUC + M63 | crown + root | 8 | 0.008 | 0.043 | - | - | - |
10, 14 | MUC + M63 | crown + root | 16 | 0.028 | - | 0.045 | - | 0.000 |
Pooled Data | p-Value 3 | |||||||
---|---|---|---|---|---|---|---|---|
DPI | Genotypes | Treatment | N1 | CpACO | CpPAL | CpLPOX | CpChiIV | CpDEF |
all 2 | MUC + M63 | inoc. + non-inoc. | 28 | - | - | - | 0.011 | - |
all | MUC + M63 | non-inoculated | 16 | - | - | - | 0.036 | - |
all | MUC + M63 | inoculated | 12 | - | - | - | - | - |
all | M63 | inoc. + non-inoc. | 14 | - | - | - | 0.024 | - |
all | MUC | inoc. + non-inoc. | 14 | 0.002 | - | 0.042 | 0.029 | - |
Pooled Data | p-Value 3 | |||||||
---|---|---|---|---|---|---|---|---|
DPI | Tissues | Treatment | N1 | CpACO | CpPAL | CpLPOX | CpChiIV | CpDEF |
all 2 | crown + root | inoc. + non-inoc. | 28 | 0.004 | 0.035 | 0.000 | 0.001 | - |
all | crown + root | non-inoculated | 16 | 0.023 | 0.002 | 0.002 | 0.003 | 0.030 |
all | crown + root | inoculated | 14 | 0.040 | - | 0.027 | - | 0.023 |
all | crown | inoc. + non-inoc. | 14 | 0.002 | - | 0.000 | 0.047 | - |
all | root | inoc. + non-inoc. | 14 | - | 0.025 | - | 0.002 | - |
Pooled Data | p-Value 3 | ||||||
---|---|---|---|---|---|---|---|
DPI | Tissues | N1 | CpACO | CpPAL | CpLPOX | CpChiIV | CpDEF |
all 2 | crown + root | 12 | - | 0.021 | - | - | 0.012 |
all | crown | 6 | - | 0.017 | - | - | - |
all | root | 6 | - | - | - | - | - |
10, 14 | crown + root | 8 | - | 0.021 | - | - | 0.043 |
Pooled Data | p-Value 3 | ||||||
---|---|---|---|---|---|---|---|
DPI | Genotypes | N1 | CpACO | CpPAL | CpLPOX | CpChiIV | CpDEF |
all 2 | MUCU-16 + M63 | 12 | - | - | - | - | - |
10, 14 | MUCU-16 + M63 | 8 | - | - | - | - | 0.032 |
10, 14 | MUCU-16 | 4 | - | - | - | 0.037 | 0.047 |
10, 14 | M63 | 4 | - | - | - | - | 0.021 |
Pooled Data | p-Value 3 | ||||||
---|---|---|---|---|---|---|---|
DPI | Tissue | N1 | CpACO | CpPAL | CpLPOX | CpChiIV | CpDEF |
all 2 | crown + root | 12 | - | - | - | - | 0.000 |
all | crown | 6 | - | - | - | 0.035 | 0.000 |
all | root | 6 | - | - | - | - | 0.024 |
10, 14 | crown + root | 8 | - | 0.013 | - | - | 0.035 |
Code 1 | Target mRNA | Homology (%) | Primers (5′-3′) | Size (pb) | |
---|---|---|---|---|---|
CpACO | XM_023673456.1 XM_023075072.1 | 98.2 | AGGTTTAAGGAGGCTGTGGC | AACGTGCTTTCCCAGTCCAT | 80 |
CpChiIV | XM_023664295.1 XM_023071306.1 | 98.3 | GGAGGAGTTCTTCAACGGCA | ACGATTGGAGGGCTTCAAGG | 98 |
CpDEF | XM_023694257.1 XM_023084199.1 | 87.5 2 | CAACTTCAGGGGGCTATGCT | TGCAAGCGCCATCGTTAAAC | 80 |
CpPAL | XM_023688417.1 XM_023070093.1 | 92.6 | CCTTCAAATCTCTCTGCAAG | AGATATTGAAGCTCAGAGC | 98 |
CpLPOX | XM_023674350.1 XM_023077519.1 | 97.0 | CTGTCGGTGGTCCATCTTGG | TGAAAGTGTGGAAGCTCGCT | 94 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ayala-Doñas, A.; Gómez, P.; de Cara-García, M. Gene Expression in Cucurbita spp. Root and Crown during Phytophthora capsici Infection. Plants 2021, 10, 2718. https://doi.org/10.3390/plants10122718
Ayala-Doñas A, Gómez P, de Cara-García M. Gene Expression in Cucurbita spp. Root and Crown during Phytophthora capsici Infection. Plants. 2021; 10(12):2718. https://doi.org/10.3390/plants10122718
Chicago/Turabian StyleAyala-Doñas, Alejandro, Pedro Gómez, and Miguel de Cara-García. 2021. "Gene Expression in Cucurbita spp. Root and Crown during Phytophthora capsici Infection" Plants 10, no. 12: 2718. https://doi.org/10.3390/plants10122718
APA StyleAyala-Doñas, A., Gómez, P., & de Cara-García, M. (2021). Gene Expression in Cucurbita spp. Root and Crown during Phytophthora capsici Infection. Plants, 10(12), 2718. https://doi.org/10.3390/plants10122718