Label-Free and Ultrasensitive APE1 Detection Based on Hybridization Chain Reaction Combined with G-Quadruplex
Abstract
1. Introduction
2. Experimental
2.1. Cell Lines
2.2. Materials and Reagents
2.3. Standard Procedure for APE1 Determination
2.4. Specificity of the Proposed APE1 Assay
2.5. Inhibition of the APE1 Detection Assay
2.6. Polyacrylamide Gel Electrophoresis (PAGE) Analysis
2.7. Statistical Analysis
3. Results and Discussions
3.1. The Principle of Proposed Method for APE1 Activity Detection
3.2. Feasibility of the Proposed APE1 Assay
3.3. Optimization of Experimental Parameters
3.4. Analytical Performance of the Proposed APE1 Assay
3.5. Specificity, Repeatability, and Stability of the Proposed APE1 Assay
3.6. Application of the Proposed Assay in Actual Samples
3.7. APE1 Inhibition Assay
3.8. Evolution Towards Point-of-Care Diagnostics
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chou, K.M.; Cheng, Y.C. An exonucleolytic activity of human apurinic/apyrimidinic endonuclease on 3' mispaired DNA. Nature 2002, 415, 655–659. [Google Scholar] [CrossRef]
- Lindahl, T.; Wood, R.D. Quality control by DNA repair. Science 1999, 286, 1897–1905. [Google Scholar] [CrossRef]
- Robson, C.N.; Hickson, I.D. Isolation of cDNA clones encoding a human apurinic/apyrimidinic endonuclease that corrects DNA repair and mutagenesis defects in E.coli xth (exonuclease III) mutants. Nucleic Acids Res. 1991, 19, 5519–5523. [Google Scholar] [CrossRef]
- Demple, B.; Herman, T.; Chen, D.S. Cloning and expression of APE, the cDNA encoding the major human apurinic endonuclease: Definition of a family of DNA repair enzymes. Proc. Natl. Acad. Sci. USA 1991, 88, 11450–11454. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.S.; Herman, T.; Demple, B. Two distinct human DNA diesterases that hydrolyze 30-blocking deoxyribose fragments from oxidized DNA. Nucleic Acids Res. 1991, 19, 5907–5914. [Google Scholar] [CrossRef]
- Robson, C.N.; Hochhauser, D.; Craig, R.; Rack, K.; Buckle, V.J.; Hickson, I.D. Structure of the human DNA repair gene HAP1 and its localisation to chromosome 14q 11.2–12. Nucleic Acids Res. 1992, 20, 4417–4421. [Google Scholar] [CrossRef]
- Barzilay, G.; Hickson, I.D. Structure and function of apurinic/apyrimidinic endonucleases. BioEssays 1995, 17, 713–719. [Google Scholar] [CrossRef]
- Abdel-Fatah, T.M.; Perry, C.; Moseley, P.; Johnson, K.; Arora, A.; Chan, S.; Ellis, I.O.; Madhusudan, S. Clinicopathological significance of human apurinic/apyrimidinic endonuclease 1 (APE1) expression in oestrogen-receptor-positive breast cancer. Breast Cancer Res. Treat. 2014, 143, 411–421. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.M.; Zhuo, Y.; Tu, T.T.; Yuan, R.; Chai, Y.Q. Construction of fast-walking tetrahedral DNA walker with four arms for sensitive detection and intracellular imaging of apurinic/apyrimidinic endonuclease 1. Anal. Chem. 2022, 94, 8732–8739. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.; Wen, L.; Li, Y.; Lou, L.; Liu, W.; Zhang, J. The expression profile and prognostic value of APE/Ref-1 and NPM1 in high-grade serous ovarian adenocarcinoma. APMIS 2017, 125, 857–862. [Google Scholar] [CrossRef]
- Kumari, B.; Banerjee, S.S.; Singh, V.; Das, P.; Bhowmick, A.K. Processing of abasic site damaged lesions by APE1 enzyme on DNA adsorbed over normal and organomodified clay. Chemosphere 2014, 112, 503–510. [Google Scholar] [CrossRef]
- Dai, N.; Cao, X.J.; Li, M.X.; Qing, Y.; Liao, L.; Lu, X.F.; Zhang, S.H.; Li, Z.; Yang, Y.X.; Wang, D. Serum APE1 autoantibodies: A novel potential tumor marker and predictor of chemotherapeutic efficacy in non-small cell lung cancer. PLoS ONE 2013, 8, e58001. [Google Scholar] [CrossRef]
- Coskun, E.; Jaruga, P.; Reddy, P.T.; Dizdaroglu, M. Extreme Expression of DNA Repair Protein Apurinic/Apyrimidinic Endonuclease 1 (APE1) in Human Breast Cancer As Measured by Liquid Chromatography and Isotope Dilution Tandem Mass Spectrometry. Biochemistry 2015, 54, 5787–5790. [Google Scholar] [CrossRef]
- Zhuo, Y.; Liao, N.; Chai, Y.Q.; Gui, G.F.; Zhao, M.; Han, J.; Xiang, Y.; Yuan, R. Ultrasensitive Apurinic/Apyrimidinic Endonuclease 1 Immunosensing Based on Self-Enhanced Electrochemiluminescence of a Ru(II) Complex. Anal. Chem. 2013, 86, 1053–1060. [Google Scholar] [CrossRef] [PubMed]
- Kang, Q.; Yang, X.Y.; Du, Y.M.; He, Z.Q.; Xiang, H. A molecular gated HRCA quick sensing system intelligently controlled by APE1. Microchem. J. 2023, 191, 108880. [Google Scholar] [CrossRef]
- Hu, Y.Q.; Zhang, Z.; Ye, W.C.; Zhang, W.; Hu, M.H.; Yuan, W.Q.; Wang, H.B.; Xiao, X.J.; Wu, T.B. A DNA structure-mediated fluorescent biosensor for apurinic/apyrimidinic endonuclease 1 activity detection with ultra-high sensitivity and selectivity. Sens. Actuators B Chem. 2021, 330, 129332. [Google Scholar] [CrossRef]
- Qi, H.J.; Li, H.Y.; Li, F. N-heterocyclic Ir(III) complex targeting G-quadruplex structure to boost label-free and immobilization-free electrochemiluminescent sensing. Biosens. Bioelectron. 2023, 220, 114839. [Google Scholar] [CrossRef]
- Dirks, R.M.; Pierce, N.A. Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. USA 2004, 101, 15275–15278. [Google Scholar] [CrossRef]
- Levine, H. Thioflavine T interaction with synthetic Alzheimer’s disease bamyloid peptides: Detection of amyloid aggregation in solution. Protein Sci. 1993, 2, 404–410. [Google Scholar] [CrossRef]
- Haidekker, M.A.; Theodorakis, E.A. Molecular rotors-fluorescent biosensors for viscosity and flow. Org. Biomol. Chem. 2007, 5, 1669–1678. [Google Scholar] [CrossRef]
- Mohanty, J.; Barooah, N.; Dhamodharan, V.; Harikrisshna, S.; Pradeepkumar, P.L.; Bhasikuttan, A.C. Thioflavin T as an efficient inducer and selective fluorescent sensor for the human telomeric G-quadruplex DNA. J. Am. Chem. Soc. 2013, 135, 367–376. [Google Scholar] [CrossRef]
- Zhou, S.Y.; Li, X.R.; Shu, X.J.; Cai, X.Y.; Wu, H.P.; Ding, S.J.; Yan, Y.R. An all-in-one enzymatic DNA network based on catalytic hairpin assembly for label-free and highly sensitive detection of APE1. Anal. Chim. Acta 2023, 1278, 341678. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.D.; He, Z.N.; Zhou, K.J.; Zhi, H.Z.; Yang, J.F. Fabrication of bifunctional G-quadruplex-hemin DNAzymes for colorimetric detection of apurinic/apyrimidinic endonuclease 1 and microRNA-21. Analyst 2021, 146, 7379–7385. [Google Scholar] [CrossRef]
- Li, J.Y.; Heng, H.; Lv, J.L.; Jiang, T.T.; Wang, Z.Y.; Dai, Z.H. Graphene oxide-assisted and DNA-modulated SERS of AuCu alloy for the fabrication of apurinic/apyrimidinic endonuclease 1 biosensor. Small 2019, 15, 1901506. [Google Scholar] [CrossRef]
- Wang, X.C.; Meng, J.T.; Zhang, H.P.; Mou, J.Y.; Xiong, J.P.; Wang, H.; Su, X.; Zhang, Y.W. Electrochemical biosensor based on bipedal DNA walker for highly sensitive amplification detection of apurinic/apyrimidinic endonuclease 1. Sens. Actuators B Chem. 2023, 381, 133425. [Google Scholar] [CrossRef]
- Zhou, M.R.; Feng, C.; Mao, D.S.; Yang, S.Q.; Ren, L.J.; Chen, G.F.; Zhu, X.L. An electrochemical biosensor integrating immunoassay and enzyme activity analysis for accurate detection of active human apurinic/apyrimidinic endonuclease 1. Biosens. Bioelectron. 2019, 142, 111558. [Google Scholar] [CrossRef]
- Chen, X.L.; Cao, G.H.; Zhang, J.J.; Deng, Y.Y.; Luo, X.G.; Yang, M.; Huo, D.Q.; Hou, C.J. An ultrasensitive and point-of-care strategy for enzyme activity detection based on enzyme extends activators to unlock the ssDNase activity of CRISPR/Cas12a (EdU-CRISPR/Cas12a). Sens. Actuators B Chem. 2021, 333, 129553. [Google Scholar] [CrossRef]
- Han, J.; Zhuo, Y.; Chai, Y.Q.; Xiang, Y.; Yuan, R.; Yuan, Y.L.; Liao, N. Ultrasensitive electrochemical strategy for trace detection of APE-1 via triple signal amplification strategy. Biosens. Bioelectron. 2013, 41, 116–122. [Google Scholar] [CrossRef]
- Song, Y.; Long, J.; Wang, H.; Tang, W.Y.; Yang, W.; Zheng, Y.; Yuan, R.; Zhang, D.C.; Gu, B.; Nian, W.Q. High-efficiency detection of APE1 using a defective PAM-driven CRISPR-Cas12a self-catalytic biosensor. Biosens. Bioelectron. 2025, 279, 117410. [Google Scholar] [CrossRef]
- Chai, Q.L.; Chen, J.Y.; Zeng, S.S.; Zhu, T.; Chen, J.T.; Qi, C.J.; Mao, G.B.; Liu, Y.C. Closed Cyclic DNA Machine for Sensitive Logic Operation and APE1 Detection. Small 2023, 19, e2207736. [Google Scholar] [CrossRef]
- Liu, B.R.; Yang, Z.Z.; Huang, T.; Li, M.M.; Duan, W.J.; Xie, B.P.; Chen, J.X.; Dai, Z.; Chen, J. Label-free and highly sensitive APE1 detection based on rolling circle amplification combined with G-quadruplex. Talanta 2022, 244, 123404. [Google Scholar] [CrossRef] [PubMed]







| Name | Sequence (5′-3′) |
|---|---|
| H1 | TGGGTTTAATCTCCTGACACTCATGTTAAGAGGTTGAGTGTCAGGGTAGGGCGGGA |
| H2 | AGGGCGGGTGGGTTGAGTGTCAGGAGATTAATGACACTCAACCTCTTAACTGGGA |
| HCR initiator | TGAGTGTCAGGAGATTAATCACTCAATAGCA |
| HP | TGCTAXTGAGTGTCAGGAGATTAATCACTCAATAGCA |
| HP-T | TGCTAXTGAGTGTCAGGAGATTAATCACTCATTAGCA |
| HP-C | TGCTAXTGAGTGTCAGGAGATTAATCACTCACTAGCA |
| HP-G | TGCTAXTGAGTGTCAGGAGATTAATCACTCAGTAGCA |
| A-2 | TAXTGAGTGTCAGGAGATTAATCACTCAATA |
| A-3 | CTAXTGAGTGTCAGGAGATTAATCACTCAATAG |
| A-7 | ATTGCTAXTGAGTGTCAGGAGATTAATCACTCAATAGCAAT |
| A-9 | AGATTGCTAXTGAGTGTCAGGAGATTAATCACTCAATAGCAATCT |
| Strategy | Detection Mode | Linear Range (U/mL) | LOD (U/mL) | Ref. |
|---|---|---|---|---|
| HRCA | Fluorescence | 0.0001–0.2 | 1.0 × 10−4 | [15] |
| TdT/Endo IV | Fluorescence | 2.0 × 10−6–0.004 | 1.7 × 10−6 | [16] |
| CHA | Fluorescence | 5.0 × 10−6–30.0 | 4.78 × 10−6 | [22] |
| DNAzymes | Colorimetry | 2.5–22.5 | 1.8 | [23] |
| AuCu/GO | SERS | 0.002–20 | 0.001 | [24] |
| CHA-HCR | Electrochemical | 0.001–1 | 0.001 | [25] |
| CHA | Electrochemistry | 0.01–4 | 0.005 | [26] |
| CRISPR/Cas12a | Fluorescence | 0.0025–25.0 | 2.5 × 10−4 | [27] |
| Ni-AuNCs | Electrochemical | 8.6 × 10−6–8.6 × 10−2 | 3.34 × 10−6 | [28] |
| DEP-Cas-APE | Fluorescence | 0.0001–1.0 | 7.66 × 10−5 | [29] |
| HCR/CHA | Fluorescence | 0.0001–1.0 | 7.80 × 10−5 | [30] |
| RCA/G-quadruplex | Fluorescence | 2.0 × 10−6–10 | 1.52 × 10−6 | [31] |
| DNA Walker/AuNPs | Fluorescence | 0.01–100 | 5.54 × 10−3 | [9] |
| HCR | Fluorescence | 6.0 × 10−8–7.5 × 10−6 | 1.0 × 10−8 | This work |
| Sample | Content/U/mL | Added/U/mL | Measured/U/mL | Found/U/mL | Recovery/% | RSD/% |
|---|---|---|---|---|---|---|
| GES-1 | 2.00 × 10−7 | 1.00 × 10−7 | 3.00 × 10−7 | 1.00 × 10−7 | 100.76 | 3.56 |
| 3.00 × 10−7 | 4.91 × 10−7 | 2.91 × 10−7 | 97.29 | 2.32 | ||
| 5.00 × 10−7 | 7.02 × 10−7 | 5.02 × 10−7 | 99.57 | 3.03 | ||
| AGS | 1.80 × 10−7 | 1.00 × 10−7 | 2.79 × 10−7 | 9.89 × 10−8 | 98.88 | 2.94 |
| 3.00 × 10−7 | 4.82 × 10−7 | 3.02 × 10−7 | 100.89 | 3.04 | ||
| 5.00 × 10−7 | 6.78 × 10−7 | 4.98 × 10−7 | 99.64 | 3.23 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Ma, H.; Gao, Z.; Li, M.; Yang, F.; Sun, L.; Zhang, Y. Label-Free and Ultrasensitive APE1 Detection Based on Hybridization Chain Reaction Combined with G-Quadruplex. Biomolecules 2025, 15, 1275. https://doi.org/10.3390/biom15091275
Zhang Y, Ma H, Gao Z, Li M, Yang F, Sun L, Zhang Y. Label-Free and Ultrasensitive APE1 Detection Based on Hybridization Chain Reaction Combined with G-Quadruplex. Biomolecules. 2025; 15(9):1275. https://doi.org/10.3390/biom15091275
Chicago/Turabian StyleZhang, Yarong, Hongyan Ma, Zhenyao Gao, Miao Li, Fan Yang, Lingbo Sun, and Yuecheng Zhang. 2025. "Label-Free and Ultrasensitive APE1 Detection Based on Hybridization Chain Reaction Combined with G-Quadruplex" Biomolecules 15, no. 9: 1275. https://doi.org/10.3390/biom15091275
APA StyleZhang, Y., Ma, H., Gao, Z., Li, M., Yang, F., Sun, L., & Zhang, Y. (2025). Label-Free and Ultrasensitive APE1 Detection Based on Hybridization Chain Reaction Combined with G-Quadruplex. Biomolecules, 15(9), 1275. https://doi.org/10.3390/biom15091275

