Effects of Mixtures of Emerging Pollutants and Drugs on Modulation of Biomarkers Related to Toxicity, Oxidative Stress, and Cancer
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture Condition and Treatment
2.2. Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR)
2.3. Statistical Analysis
3. Results
3.1. Cytotoxicity as Measured by MTT Assay
3.2. Gene Expression Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Drakvik, E.; Altenburger, R.; Aoki, Y.; Backhaus, T.; Bahadori, T.; Barouki, R.; Brack, W.; Cronin, M.T.D.; Demeneix, B.; Hougaard Bennekou, S.; et al. Statement on advancing the assessment of chemical mixtures and their risks for human health and the environment. Environ. Int. 2020, 134, 105267. [Google Scholar] [CrossRef]
- Espinosa-Ruiz, C.; Manuguerra, S.; Curcuraci, E.; Santulli, A.; Messina, C.M. Carbamazepine, cadmium chloride and polybrominated diphenyl ether-47, synergistically modulate the expression of antioxidants and cell cycle biomarkers, in the marine fish cell line SAF-1. Mar. Environ. Res. 2020, 154, 104844. [Google Scholar] [CrossRef]
- Manuguerra, S.; Espinosa Ruiz, C.; Santulli, A.; Messina, C.M. Sub-lethal doses of polybrominated diphenyl ethers, in vitro, promote oxidative stress and modulate molecular markers related to cell cycle, antioxidant balance and cellular energy management. Int. J. Environ. Res. Public Health 2019, 16, 588. [Google Scholar] [CrossRef]
- Wilson, J.; Berntsen, H.F.; Zimmer, K.E.; Frizzell, C.; Verhaegen, S.; Ropstad, E.; Connolly, L. Effects of defined mixtures of persistent organic pollutants (POPs) on multiple cellular responses in the human hepatocarcinoma cell line, HepG2, using high content analysis screening. Toxicol. Appl. Pharmacol. 2016, 294, 21–31. [Google Scholar] [CrossRef]
- Gauthier, P.T.; Norwood, W.P.; Prepas, E.E.; Pyle, G.G. Metal-PAH mixtures in the aquatic environment: A review of co-toxic mechanisms leading to more-than-additive outcomes. Aquat. Toxicol. 2014, 154, 253–269. [Google Scholar] [CrossRef]
- Björvang, R.D.; Hassan, J.; Stefopoulou, M.; Gemzell-Danielsson, K.; Pedrelli, M.; Kiviranta, H.; Rantakokko, P.; Ruokojärvi, P.; Lindh, C.H.; Acharya, G.; et al. Persistent organic pollutants and the size of ovarian reserve in reproductive-aged women. Environ. Int. 2021, 155, 106589. [Google Scholar] [CrossRef]
- Messina, C.M.; Manuguerra, S.; Arena, R.; Espinosa-Ruiz, C.; Curcuraci, E.; Esteban, M.A.; Santulli, A. Contaminant-induced oxidative stress underlies biochemical, molecular and fatty acid profile changes, in gilthead seabream (Sparus aurata L.). Res. Vet. Sci. 2023, 159, 244–251. [Google Scholar] [CrossRef]
- Snyder, S.A. Emerging chemical contaminants: Looking for greater harmony. J. Am. Water Works Assoc. 2014, 106, 38–52. [Google Scholar] [CrossRef]
- Pose-Juan, E.; Fernández-Cruz, T.; Simal-Gándara, J. State of the art on public risk assessment of combined human exposure to multiple chemical contaminants. Trends Food Sci. Technol. 2016, 55, 11–28. [Google Scholar] [CrossRef]
- Lapworth, D.J.; Baran, N.; Stuart, M.E.; Ward, R.S. Emerging organic contaminants in groundwater: A review of sources, fate and occurrence. Environ. Pollut. 2012, 163, 287–303. [Google Scholar] [CrossRef]
- Albano, G.D.; Bonanno, A.; Montalbano, A.M.; Di Sano, C.; Anzalone, G.; Gagliardo, R.; Ruggieri, S.; Profita, M. Cadmium and Cadmium/BDE (47 or 209) Exposure Affect Mitochondrial Function, DNA Damage/Repair Mechanisms and Barrier Integrity in Airway Epithelial Cells. Atmosphere 2022, 13, 201. [Google Scholar] [CrossRef]
- Muniz, J.F.; McCauley, L.; Scherer, J.; Lasarev, M.; Koshy, M.; Kow, Y.W.; Nazar-Stewart, V.; Kisby, G.E. Biomarkers of oxidative stress and DNA damage in agricultural workers: A pilot study. Toxicol. Appl. Pharmacol. 2008, 227, 97–107. [Google Scholar] [CrossRef]
- Kaur, K.; Kaur, R. Modulation of DNA damage by XPF, XPG and ERCC1 gene polymorphisms in pesticide-exposed agricultural workers of Punjab, North-West India. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2021, 861–862, 503302. [Google Scholar] [CrossRef]
- Kozlov, A.V.; Javadov, S.; Sommer, N. Cellular ROS and Antioxidants: Physiological and Pathological Role. Antioxidants 2024, 13, 602. [Google Scholar] [CrossRef]
- Dalle-Donne, I.; Rossi, R.; Giustarini, D.; Milzani, A.; Colombo, R. Protein carbonyl groups as biomarkers of oxidative stress. Clin. Chim. Acta 2003, 329, 23–38. [Google Scholar] [CrossRef]
- Pedrete, T.d.A.; Moreira, J.C. Biomarkers of Susceptibility for Human Exposure to Environmental Contaminants. In Ecotoxicology; CRC Press: Boca Raton, FL, USA, 2018; pp. 252–280. [Google Scholar] [CrossRef]
- Barrett, J.C. Mechanisms of multistep carcinogenesis and carcinogen risk assessment. Environ. Health Perspect. 1993, 100, 9–20. [Google Scholar] [CrossRef]
- Espinosa-Ruiz, C.; Manuguerra, S.; Cuesta, A.; Santulli, A.; Messina, C.M. Oxidative stress, induced by sub-lethal doses of bde 209, promotes energy management and cell cycle modulation in the marine fish cell line SAF-1. Int. J. Environ. Res. Public Health 2019, 16, 474. [Google Scholar] [CrossRef]
- Espinosa-Ruiz, C.; Manuguerra, S.; Cuesta, A.; Esteban, M.A.; Santulli, A.; Messina, C.M. Sub-lethal doses of polybrominated diphenyl ethers affect some biomarkers involved in energy balance and cell cycle, via oxidative stress in the marine fish cell line SAF-1. Aquat. Toxicol. 2019, 210, 1–10. [Google Scholar] [CrossRef]
- Ogunbileje, J.O.; Sadagoparamanujam, V.M.; Anetor, J.I.; Farombi, E.O.; Akinosun, O.M.; Okorodudu, A.O. Lead, mercury, cadmium, chromium, nickel, copper, zinc, calcium, iron, manganese and chromium (VI) levels in Nigeria and United States of America cement dust. Chemosphere 2013, 90, 2743–2749. [Google Scholar] [CrossRef]
- Liu, X.; Song, Q.; Tang, Y.; Li, W.; Xu, J.; Wu, J.; Wang, F.; Brookes, P.C. Human health risk assessment of heavy metals in soil-vegetable system: A multi-medium analysis. Sci. Total Environ. 2013, 463–464, 530–540. [Google Scholar] [CrossRef]
- Zind, H.; Mondamert, L.; Remaury, Q.B.; Cleon, A.; Lettner, N.K.V.; Labanowki, J. Occurrence of carbamazepine, diclofenac, and their related metabolites and transformation products in a French aquatic environment and preliminary risk assessment. Water Res. 2021, 196, 117052. [Google Scholar] [CrossRef]
- Foster, H.R.; Burton, G.A.; Basu, N.; Werner, E.E. Chronic exposure to fluoxetine (Prozac) causes developmental delays in Rana pipiens larvae. Environ. Toxicol. Chem. 2010, 29, 2845–2850. [Google Scholar] [CrossRef]
- Ishaq, M.; Sultana, N.; Ikram, M.; Iqbal, A.; Shah, F.; Hamayun, M.; Hussain, A. Occurrence of heavy metals and pesticide residues in tomato crop: A threat to public health. Arab. J. Geosci. 2020, 13, 627. [Google Scholar] [CrossRef]
- Muthusamy, S.; Peng, C.; Ng, J.C. Effects of binary mixtures of benzo[a]pyrene, arsenic, cadmium, and lead on oxidative stress and toxicity in HepG2 cells. Chemosphere 2016, 165, 41–51. [Google Scholar] [CrossRef]
- Yokoyama, Y.; Sasaki, Y.; Terasaki, N.; Kawataki, T.; Takekawa, K.; Iwase, Y.; Shimizu, T.; Sanoh, S.; Ohta, S. Comparison of Drug Metabolism and Its Related Hepatotoxic Effects in. Biol. Pharm. Bull. 2018, 41, 722–732. [Google Scholar] [CrossRef]
- Saito, J.; Okamura, A.; Takeuchi, K.; Hanioka, K.; Okada, A.; Ohata, T. High content analysis assay for prediction of human hepatotoxicity in HepaRG and HepG2 cells. Toxicol. Vitr. 2016, 33, 63–70. [Google Scholar] [CrossRef]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Goretti, E.; Pallottini, M.; Rossi, R.; La Porta, G.; Gardi, T.; Cenci Goga, B.T.; Elia, A.C.; Galletti, M.; Moroni, B.; Petroselli, C.; et al. Heavy metal bioaccumulation in honey bee matrix, an indicator to assess the contamination level in terrestrial environments. Environ. Pollut. 2020, 256, 113388. [Google Scholar] [CrossRef]
- Zhang, C.; Barron, L.; Sturzenbaum, S. The transportation, transformation and (bio)accumulation of pharmaceuticals in the terrestrial ecosystem. Sci. Total Environ. 2021, 781, 146684. [Google Scholar] [CrossRef]
- Wang, K.; Ma, J.Y.; Li, M.Y.; Qin, Y.S.; Bao, X.C.; Wang, C.C.; Cui, D.L.; Xiang, P.; Ma, L.Q. Mechanisms of Cd and Cu induced toxicity in human gastric epithelial cells: Oxidative stress, cell cycle arrest and apoptosis. Sci. Total Environ. 2021, 756, 143951. [Google Scholar] [CrossRef]
- Ferrari, F.; Gallipoli, A.; Balderacchi, M.; Ulaszewska, M.M.; Capri, E.; Trevisan, M. Exposure of the main Italian river basin to pharmaceuticals. J. Toxicol. 2011, 2011, 989270. [Google Scholar] [CrossRef]
- Jia, C.; Han, S.; Wei, L.; Dang, X.; Niu, Q.; Chen, M.; Cao, B.; Liu, Y.; Jiao, H. Protective effect of compound danshen (Salvia miltiorrhiza) dripping pills alone and in combination with carbamazepine on kainic acidinduced temporal lobe epilepsy and cognitive impairment in rats. Pharm. Biol. 2018, 56, 217–224. [Google Scholar] [CrossRef]
- Monteoliva-García, A.; Martín-Pascual, J.; Muñío, M.M.; Poyatos, J.M. Removal of carbamazepine, ciprofloxacin and ibuprofen in real urban wastewater by using light-driven advanced oxidation processes. Int. J. Environ. Sci. Technol. 2019, 16, 6005–6018. [Google Scholar] [CrossRef]
- Wang, L.; Zou, W.; Zhong, Y.; An, J.; Zhang, X.; Wu, M.; Yu, Z. The hormesis effect of BDE-47 in HepG 2 cells and the potential molecular mechanism. Toxicol. Lett. 2012, 209, 193–201. [Google Scholar] [CrossRef]
- Agathokleous, E.; Barceló, D.; Rinklebe, J.; Sonne, C.; Calabrese, E.J.; Koike, T. Hormesis induced by silver iodide, hydrocarbons, microplastics, pesticides, and pharmaceuticals: Implications for agroforestry ecosystems health. Sci. Total Environ. 2022, 820, 153116. [Google Scholar] [CrossRef]
- Longo, V.; Longo, A.; Di Sano, C.; Cigna, D.; Cibella, F.; Di Felice, G.; Colombo, P. In vitro exposure to 2,2″,4,4″-tetrabromodiphenyl ether (PBDE-47) impairs innate inflammatory response. Chemosphere 2019, 219, 845–854. [Google Scholar] [CrossRef]
- Slotkin, T.A.; Skavicus, S.; Stapleton, H.M.; Seidler, F.J. Brominated and organophosphate flame retardants target different neurodevelopmental stages, characterized with embryonic neural stem cells and neuronotypic PC12 cells. Toxicology 2017, 390, 32–42. [Google Scholar] [CrossRef]
- Chen, H.; Tang, X.; Zhou, B.; Xu, N.; Zhou, Z.; Fang, K.; Wang, Y. BDE-47 and BDE-209 inhibit proliferation of Neuro-2a cells via inducing G1-phase arrest. Environ. Toxicol. Pharmacol. 2017, 50, 76–82. [Google Scholar] [CrossRef]
- Kawaguchi, T.; Kodama, T.; Hikita, H.; Tanaka, S.; Shigekawa, M.; Nawa, T.; Shimizu, S.; Li, W.; Miyagi, T.; Hiramatsu, N.; et al. Carbamazepine promotes liver regeneration and survival in mice. J. Hepatol. 2013, 59, 1239–1245. [Google Scholar] [CrossRef]
- Sohaib, M.; Ezhilarasan, D. Carbamazepine, a Histone Deacetylase Inhibitor Induces Apoptosis in Human Colon Adenocarcinoma Cell Line HT-29. J. Gastrointest. Cancer 2020, 51, 564–570. [Google Scholar] [CrossRef]
- Akbarzadeh, L.; Moini Zanjani, T.; Sabetkasaei, M. Comparison of Anticancer Effects of Carbamazepine and Valproic Acid. Iran. Red Crescent Med. J. 2016, 18, 37230. [Google Scholar] [CrossRef]
- Fredriksson, L.; Wink, S.; Herpers, B.; Benedetti, G.; Hadi, M.; De Bont, H.; Groothuis, G.; Luijten, M.; Danen, E.; De Graauw, M.; et al. Drug-induced endoplasmic reticulum and oxidative stress responses independently sensitize toward TNFα-mediated hepatotoxicity. Toxicol. Sci. 2014, 140, 144–159. [Google Scholar] [CrossRef]
- Grewal, G.K.; Kukal, S.; Kanojia, N.; Madan, K.; Saso, L.; Kukreti, R. In vitro assessment of the effect of antiepileptic drugs on expression and function of ABC transporters and their interactions with ABCC2. Molecules 2017, 22, 1484. [Google Scholar] [CrossRef]
- Sirchia, R.; Longo, A.; Luparello, C. Cadmium regulation of apoptotic and stress response genes in tumoral and immortalized epithelial cells of the human breast. Biochimie 2008, 90, 1578–1590. [Google Scholar] [CrossRef]
- Skipper, A.; Sims, J.N.; Yedjou, C.G.; Tchounwou, P.B. Cadmium chloride induces DNA damage and apoptosis of human liver carcinoma cells via oxidative stress. Int. J. Environ. Res. Public Health 2016, 13, 88. [Google Scholar] [CrossRef]
- Damelin, L.H.; Vokes, S.; Whitcutt, J.M.; Damelin, S.B.; Alexander, J.J. Hormesis: A stress response in cells exposed to low levels of heavy metals. Hum. Exp. Toxicol. 2000, 19, 420–430. [Google Scholar] [CrossRef]
- Tagliaferri, S.; Caglieri, A.; Goldoni, M.; Pinelli, S.; Alinovi, R.; Poli, D.; Pellacani, C.; Giordano, G.; Mutti, A.; Costa, L.G. Low concentrations of the brominated flame retardants BDE-47 and BDE-99 induce synergistic oxidative stress-mediated neurotoxicity in human neuroblastoma cells. Toxicol. Vitr. 2010, 24, 116–122. [Google Scholar] [CrossRef]
- Wang, L.; Zheng, M.; Gao, Y.; Cui, J. In vitro study on the joint hepatoxicity upon combined exposure of cadmium and BDE-209. Environ. Toxicol. Pharmacol. 2018, 57, 62–69. [Google Scholar] [CrossRef]
- Espinosa-Ruiz, C.; Cuesta, A.; Esteban, M.Á. Effects of dietary polyvinylchloride microparticles on general health, immune status and expression of several genes related to stress in gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol. 2017, 68, 251–259. [Google Scholar] [CrossRef]
- Hofseth, L.J.; Hussain, S.P.; Harris, C.C. p53: 25 Years after its discovery. Trends Pharmacol. Sci. 2004, 25, 177–181. [Google Scholar] [CrossRef]
- Lee, H.Y.; Oh, S.H. Autophagy-mediated cytoplasmic accumulation of p53 leads to apoptosis through DRAM-BAX in cadmium-exposed human proximal tubular cells. Biochem. Biophys. Res. Commun. 2021, 534, 128–133. [Google Scholar] [CrossRef]
- Song, N.H.; Koh, J.W. Effects of cadmium chloride on the cultured human lens epithelial cells. Mol. Vis. 2012, 18, 983–988. [Google Scholar]
- Aimola, P.; Carmignani, M.; Volpe, A.R.; Di Benedetto, A.; Claudio, L.; Waalkes, M.P.; van Bokhoven, A.; Tokar, E.J.; Claudio, P.P. Cadmium induces p53-dependent apoptosis in human prostate epithelial cells. PLoS ONE 2012, 7, e33647. [Google Scholar] [CrossRef]
- Abiko, Y.; Aoki, H.; Kumagai, Y. Effect of combined exposure to environmental aliphatic electrophiles from plants on Keap1/Nrf2 activation and cytotoxicity in HepG2 cells: A model of an electrophile exposome. Toxicol. Appl. Pharmacol. 2021, 413, 115392. [Google Scholar] [CrossRef]
- Schmidlin, C.J.; Zeng, T.; Liu, P.; Wei, Y.; Dodson, M.; Chapman, E.; Zhang, D.D. Chronic arsenic exposure enhances metastatic potential via NRF2-mediated upregulation of SOX9. Toxicol. Appl. Pharmacol. 2020, 402, 115138. [Google Scholar] [CrossRef]
- Ingelman-Sundberg, M. Polymorphism of cytochrome P450 and xenobiotic toxicity. Toxicology 2002, 181–182, 447–452. [Google Scholar] [CrossRef]
- Goldstein, J.A.; de Morais, S.M.F. Biochemistry and molecular biology of the human CYP2C subfamily. Pharmacogenetics 1994, 4, 285–300. [Google Scholar] [CrossRef]
- Shuaichen, L.; Guangyi, W. Bioinformatic analysis reveals CYP2C9 as a potential prognostic marker for HCC and liver cancer cell lines suitable for its mechanism study. Cell. Mol. Biol. 2018, 64, 70–74. [Google Scholar] [CrossRef]
- Boecker, R.; Schwind, B.; Kraus, V.; Pullen, S.; Tiegs, G. Cellular disturbances by various brominated flame retardants. In Proceedings of the Second International Workshop on Brominated Flame Retardants, Stockholm, Sweden, 14–16 May 2001. [Google Scholar]
- Casalino, E.; Calzaretti, G.; Landriscina, M.; Sblano, C.; Fabiano, A.; Landriscina, C. The Nrf2 transcription factor contributes to the induction of alpha-class GST isoenzymes in liver of acute cadmium or manganese intoxicated rats: Comparison with the toxic effect on NAD(P)H:quinone reductase. Toxicology 2007, 237, 24–34. [Google Scholar] [CrossRef]
- Hu, X.Z.; Hu, D.C. Effects of perfluorooctanoate and perfluorooctane sulfonate exposure on hepatoma Hep G2 cells. Arch. Toxicol. 2009, 83, 851–861. [Google Scholar] [CrossRef]
- Yarahalli Jayaram, V.; Baggavalli, S.; Reddy, D.; Sistla, S.; Malempati, R. Effect of endosulfan and bisphenol A on the expression of SUMO and UBC9. Drug Chem. Toxicol. 2020, 43, 637–644. [Google Scholar] [CrossRef]
- Nisticò, R.; Ferraina, C.; Marconi, V.; Blandini, F.; Negri, L.; Egebjerg, J.; Feligioni, M. Age-related changes of protein SUMOylation balance in the AβPP Tg2576 mouse model of Alzheimer’s disease. Front. Pharmacol. 2014, 5, 63. [Google Scholar] [CrossRef]
- Wang, P.; Xue, N.; Zhang, C.; Shan, S.; Jiang, Z.; Wu, W.; Liu, X. Inhibition of SUMO2/3 antagonizes isoflurane-induced cancer-promoting effect in hepatocellular carcinoma Hep3B cells. Oncol. Lett. 2021, 21, 274. [Google Scholar] [CrossRef]
- Lee-Law, P.Y.; Olaizola, P.; Caballero-Camino, F.J.; Izquierdo-Sanchez, L.; Rodrigues, P.M.; Santos-Laso, A.; Azkargorta, M.; Elortza, F.; Martinez-Chantar, M.L.; Perugorria, M.J.; et al. Targeting UBC9-mediated protein hyper-SUMOylation in cystic cholangiocytes halts polycystic liver disease in experimental models. J. Hepatol. 2021, 74, 394–406. [Google Scholar] [CrossRef]
- Bossis, G.; Melchior, F. Regulation of SUMOylation by reversible oxidation of SUMO conjugating enzymes. Mol. Cell 2006, 21, 349–357. [Google Scholar] [CrossRef]
- Hu, J.; Liu, J.; Li, J.; Lv, X.; Yu, L.; Wu, K.; Yang, Y. Metal contamination, bioaccumulation, ROS generation, and epigenotoxicity influences on zebrafish exposed to river water polluted by mining activities. J. Hazard. Mater. 2021, 405, 124150. [Google Scholar] [CrossRef]
- Dey Bhowmik, A.; Podder, S.; Mondal, P.; Shaw, P.; Bandyopadhyay, A.; Das, A.; Bhattacharjee, P.; Chakraborty, A.; Sudarshan, M.; Chattopadhyay, A. Chronic exposure to environmentally relevant concentration of fluoride alters Ogg1 and Rad51 expressions in mice: Involvement of epigenetic regulation. Ecotoxicol. Environ. Saf. 2020, 202, 110962. [Google Scholar] [CrossRef]
- Fernandez, S.V.; Huang, Y.; Snider, K.E.; Zhou, Y.; Pogash, T.J.; Russo, J. Expression and DNA methylation changes in human breast epithelial cells after bisphenol A exposure. Int. J. Oncol. 2012, 41, 369–377. [Google Scholar] [CrossRef]
- Winz, C.; Suh, N. Understanding the Mechanistic Link between Bisphenol A and Cancer Stem Cells: A Cancer Prevention Perspective. J. Cancer Prev. 2021, 26, 18–24. [Google Scholar] [CrossRef]
- Tan, H.W.; Liang, Z.L.; Yao, Y.; Wu, D.D.; Mo, H.Y.; Gu, J.; Chiu, J.F.; Xu, Y.M.; Lau, A.T.Y. Lasting DNA Damage and Aberrant DNA Repair Gene Expression Profile Are Associated with Post-Chronic Cadmium Exposure in Human Bronchial Epithelial Cells. Cells 2019, 8, 842. [Google Scholar] [CrossRef]
- Trabelsi, F.; Khlifi, R.; Goux, D.; Guillamin, M.; Hamza-Chaffai, A.; Sichel, F. Genotoxic effects of cadmium in human head and neck cell line SQ20B. Environ. Sci. Pollut. Res. 2016, 23, 16127–16136. [Google Scholar] [CrossRef]
- Steinbrecht, S.; Kammerer, S.; Küpper, J.H. HepG2 cells with recombinant cytochrome P450 enzyme overexpression: Their use and limitation as in vitro liver model. J. Cell. Biotechnol. 2019, 5, 55–64. [Google Scholar] [CrossRef]
- Shulman, M.; Nahmias, Y. Long-term culture and coculture of primary rat and human hepatocytes. Methods Mol. Biol. 2013, 945, 287–302. [Google Scholar] [CrossRef]
- Madan, A.; Graham, R.A.; Carroll, K.M.; Mudra, D.R.; Alayne Burton, L.; Krueger, L.A.; Downey, A.D.; Czerwinski, M.; Forster, J.; Ribadeneira, M.D.; et al. Effects of prototypical microsomal enzyme inducers on cytochrome P450 expression in cultured human hepatocytes. Drug Metab. Dispos. 2003, 31, 421–431. [Google Scholar] [CrossRef]
- Wilkening, S.; Stahl, F.; Bader, A. Comparison of primary human hepatocytes and hepatoma cell line HepG2 with regard to their biotransformation properties. Drug Metab. Dispos. 2003, 31, 1035–1042. [Google Scholar] [CrossRef]
- Westerink, W.M.A.; Schoonen, W.G.E.J. Phase II enzyme levels in HepG2 cells and cryopreserved primary human hepatocytes and their induction in HepG2 cells. Toxicol. Vitr. 2007, 21, 1592–1602. [Google Scholar] [CrossRef]
- Wiśniewski, J.R.; Vildhede, A.; Norén, A.; Artursson, P. In-depth quantitative analysis and comparison of the human hepatocyte and hepatoma cell line HepG2 proteomes. J. Proteom. 2016, 136, 234–247. [Google Scholar] [CrossRef]




| Gene | Access Number | F/R Primer Sequence (5′–3′) |
|---|---|---|
| p53 | AAGAAACCACTGGATGGAGAA CAGCTCGGAACATCTCGAA | |
| NRF2 | ATAGCTGAGCCCAG TATC CATGCACGTGAGTGCTCT | |
| CYP2C9 | KF248055.1 | AGGCACACACCGAATTAGCA TCTCCCAGAGCTCTGTCTCC |
| GST | M99422.1 | GGACGCCTTCCCAAATCTGA CAGTTTGGTGGATGCCTCCT |
| SUMO1 | TGTGGGGAAGGGAGAAGGAT AAGGTTTTGCCTCCTGGTCA | |
| UBC9 | CGAACCACCATTATTTCACC GGATCTGTTTGATTGTGATGG | |
| RAD51 | GCCCTTTACAGAACAGACTACT AAACATCGCTGCTCCATCC | |
| γH2AFX | NM_002105.2 | GGTGCTTAGCCCAGGACTTT TGGAGGGAGAGCTGATGTGA |
| GAPDH | ACCCACTCCTCCACCTTTGAC GTCCACCACCCTGTTGCTGTA | |
| β actin | AGGCTGTGCTGTCCCTGTAT ACCCAAGAAGGAAGGCTGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Manuguerra, S.; Carli, F.; Scoditti, E.; Santulli, A.; Gastaldelli, A.; Messina, C.M. Effects of Mixtures of Emerging Pollutants and Drugs on Modulation of Biomarkers Related to Toxicity, Oxidative Stress, and Cancer. Metabolites 2024, 14, 559. https://doi.org/10.3390/metabo14100559
Manuguerra S, Carli F, Scoditti E, Santulli A, Gastaldelli A, Messina CM. Effects of Mixtures of Emerging Pollutants and Drugs on Modulation of Biomarkers Related to Toxicity, Oxidative Stress, and Cancer. Metabolites. 2024; 14(10):559. https://doi.org/10.3390/metabo14100559
Chicago/Turabian StyleManuguerra, Simona, Fabrizia Carli, Egeria Scoditti, Andrea Santulli, Amalia Gastaldelli, and Concetta Maria Messina. 2024. "Effects of Mixtures of Emerging Pollutants and Drugs on Modulation of Biomarkers Related to Toxicity, Oxidative Stress, and Cancer" Metabolites 14, no. 10: 559. https://doi.org/10.3390/metabo14100559
APA StyleManuguerra, S., Carli, F., Scoditti, E., Santulli, A., Gastaldelli, A., & Messina, C. M. (2024). Effects of Mixtures of Emerging Pollutants and Drugs on Modulation of Biomarkers Related to Toxicity, Oxidative Stress, and Cancer. Metabolites, 14(10), 559. https://doi.org/10.3390/metabo14100559

