mTORC1/ERK1/2 Interplay Regulates Protein Synthesis and Survival in Acute Myeloid Leukemia Cell Lines
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cells and Viability
2.3. Flow Cytometry Analysis of Cell Death
2.4. Western Blot Analysis
2.5. Protein Synthesis Assay—Surface Sensing of Translation (SUnSET) [43]
2.6. Silencing of ERK1/2
2.7. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
2.8. Subcellular Fractionation
2.9. Analysis of the Western Blot Bands
2.10. Statistical Analysis
3. Results
3.1. mTORC1/P70S6K Inhibition Promotes ERK1/2 Activation in AML Cells
3.2. ERK1/2, Retrived from mTORC1 Dependent Inhibition, Maintains mTORC1 Activation
3.3. ERK1/2 Counteracts Q- or Rap-Mediated Autophagy Inhibition
3.4. Autophagy Reduction Is Not Caused by Transcriptional Inhibition of Autophagy Genes
3.5. Activation of ERK1/2 Prevents Protein Synthesis Shutdown
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sabatini, D.M. Twenty-five years of mTOR: Uncovering the link from nutrients to growth. Proc. Natl. Acad. Sci. USA 2017, 114, 11818–11825. [Google Scholar] [CrossRef] [PubMed]
- Sabatini, D.M. mTOR and cancer: Insights into a complex relationship. Nat. Rev. Cancer 2006, 6, 729–734. [Google Scholar] [CrossRef] [PubMed]
- Guertin, D.A.; Sabatini, D.M. Defining the role of mTOR in cancer. Cancer Cell 2007, 12, 9–22. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.C.; Guan, K.-L. mTOR: A pharmacological target for autophagy regulation. J. Clin. Invest. 2015, 125, 25–31. [Google Scholar] [CrossRef]
- Oh, W.J.; Jacinto, E. mTOR complex 2 signaling and functions. Cell Cycle 2011, 10, 2305–2316. [Google Scholar] [CrossRef] [PubMed]
- Hay, N.; Sonenberg, N. Upstream and downstream of mTOR. Genes Dev. 2004, 18, 1926–1945. [Google Scholar] [CrossRef] [PubMed]
- Mamane, Y.; Petroulakis, E.; LeBacquer, O.; Sonenberg, N. mTOR, translation intiation and cancer. Oncogene 2006, 25, 6416–6422. [Google Scholar] [CrossRef]
- Pearce, L.R.; Komander, D.; Alessi, D.R. The nuts and bolts of AGC protein kinases. Nat. Rev. Mol. Cell Biol. 2010, 11, 9–22. [Google Scholar] [CrossRef]
- Inoki, K.; Li, Y.; Zhu, T.; Wu, J.; Guan, K.L. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signaling. Nat. Cell Biol. 2002, 4, 648–657. [Google Scholar] [CrossRef]
- Manning, B.D.; Tee, A.R.; Logsdon, M.N.; Blenis, J.; Cantley, L.C. Identification of the tuberous sclerosis complex-2 tumor suppressor gene product tuberin as a target of the phosphoinositide 3-kinase/Akt pathway. Mol. Cell 2002, 10, 151–162. [Google Scholar] [CrossRef]
- Garami, A.; Zwartkruis, F.J.T.; Nobukuni, T.; Joaquin, M.; Roccio, M.; Stocker, H.; Kozma, S.C.; Hafen, E.; Bos, J.L.; Thomas, G. Insulin activation of Rheb, a mediator of mTOR/S6K/4E-BP signaling, is inhibited by TSC1 and 2. Mol. Cell 2003, 11, 1457–1466. [Google Scholar] [CrossRef] [PubMed]
- Menon, S.; Dibble, C.C.; Talbott, G.; Hoxhaj, G.; Valvezan, A.J.; Takahashi, H.; Cantley, L.C.; Manning, B.D. Spatial control of the TSC complex integrates insulin and nutrient regulation of mTORC1 at the lysosome. Cell 2014, 156, 771–785. [Google Scholar] [CrossRef] [PubMed]
- Long, X.; Lin, Y.; Ortiz-Vega, S.; Yonezawa, K.; Avruch, J. Rheb binds and regulates the mTOR kinase. Curr. Biol. 2005, 15, 702–713. [Google Scholar] [CrossRef] [PubMed]
- Shaw, R.J.; Cantley, L.C. Ras, PI(3)K and mTOR signalling controls tumour cell growth. Nature 2006, 441, 424–430. [Google Scholar] [CrossRef]
- Ma, L.; Chen, Z.; Erdjumement-Bromage, H.; Tempst, P.; Pandolfi, P.P. Phosphorylation and functional inactivation of TSC2 by ERK: Implications for tuberous sclerosis and cancer pathogenesis. Cell 2005, 121, 179–183. [Google Scholar] [CrossRef] [PubMed]
- Ballif, B.A.; Roux, P.P.; Gerber, S.A.; MacKeigan, J.P.; Blenis, J.; Gygi, S.P. Quantitative phosphorylation profiling of the ERK/p90 ribosomal S6 kinase-signaling cassette and its targets, the tuberous sclerosis tumor suppressor. Proc. Natl. Acad. Sci. USA 2005, 102, 667–672. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Bajraszewski, N.; Wu, E.; Wang, H.; Moseman, A.P.; Dabora, S.L.; Griffin, J.D.; Kwiatkowski, D.J. PDGFRs are critical for PI3K/Akt activation and negatively regulated by mTOR. J.Clin. Invest. 2007, 117, 730–738. [Google Scholar] [CrossRef]
- Zhang, H.; Cicchetti, G.; Onda, H.; Koon, H.B.; Asrican, K.; Bajraszewski, N.; Vazquez, F.; Carpenter, C.L.; Kwiatkowski, D.J. Loss of Tsc1/Tsc2 activates mTOR and disrupts PI3K-Akt signaling through downregulation of PDGFR. J Clin. Invest. 2003, 112, 1223–1233. [Google Scholar] [CrossRef]
- Harrington, L.S.; Findlay, G.M.; Gray, A.; Tolkacheva, T.; Wigfield, S.; Rebholz, H.; Barnett, J.; Leslie, N.R.; Cheng, S.; Shepherd, P.R.; et al. The Tsc1-2 tumor suppressor controls insulin-PI3K signaling via regulation of IRS proteins. J. Cell Biol. 2004, 166, 213–223. [Google Scholar] [CrossRef]
- Shah, O.J.; Wang, Z.; Hunter, T. Inappropriate activation of the TSC/Rheb/mTOR/S6K cassette induces IRS1/2 depletion, insulin resistance, and cell survival deficiencies. Curr. Biol. 2004, 14, 1650–1656. [Google Scholar] [CrossRef]
- O’Reilly, K.E.; Rojo, F.; She, Q.B.; Solit, D.; Mills, G.B.; Smith, D.; Lane, H.; Hofmann, F.; Hicklin, D.J.; Ludwig, D.L.; et al. mTOR inhibition induces upstream receptor tyrosine kinase signaling and activates Akt. Cancer Res. 2006, 66, 1500–1508. [Google Scholar] [CrossRef] [PubMed]
- Carracedo, A.; Ma, L.; Teruya-Feldstein, J.; Rojo, F.; Salmena, L.; Alimonti, A.; Egia, A.; Sasaki, A.T.; Thomas, G.; Kozma, S.C.; et al. Inhibition of mTORC1 leads to MAPK pathway activation through a PI3K-dependent feedback loop in human cancer. J. Clin. Invest. 2008, 118, 3065–3074. [Google Scholar] [CrossRef]
- Cagnol, S.; Chambard, J.C. Erk and cell death: Mechanisms of Erk-induced cell death—Apoptosis, autophagy and senescence. FEBS J. 2010, 277, 2–21. [Google Scholar] [CrossRef]
- Liu, X.; Ye, Q.; Zhao, X.P.; Zhang, P.B.; Li, S.; Li, R.Q.; Zhao, X.L. RAS mutations in acute myeloid leukaemia patients: A review and meta-analysis. Clin. Chim. Acta 2019, 489, 254–260. [Google Scholar] [CrossRef]
- Boots, A.W.; Haenen, G.R.M.M.; Bast, A. Health effects of quercetin: From antioxidant to nutraceutical. Eur. J. Pharmacol. 2008, 585, 325–337. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.H.; An, J.Y.; Kwon, Y.T.; Rhee, J.G.; Lee, Y.J. Effects of low dose quercetin: Cancer cell-specific inhibition of cell cycle progression. J. Cell. Biochem. 2009, 106, 73–82. [Google Scholar] [CrossRef]
- Rivera Rivera, A.; Castilho-Pichardo, L.; Gerena, Y.; Dharmawardhane, S. Anti-breast cancer potential of quercetin via the Akt/AMPK/mammalian target of rapamycin (mTOR) signaling cascade. PLoS ONE 2016, 11, e0157251. [Google Scholar] [CrossRef] [PubMed]
- Bruning, A. Inhibition of mTOR signaling by quercetin in cancer treatment and prevention. Anticancer Agents Med. Chem. 2013, 13, 1025–1031. [Google Scholar] [CrossRef]
- Vargas, A.J.; Burd, R. Hormesis and synergy: Pathways and mechanisms of quercetin in cancer prevention and management. Nutrition Rev. 2010, 68, 418–428. [Google Scholar] [CrossRef]
- Torello, C.O.; Alvarez, M.C.; Olalla Saad, S.T. Polyphenolic flavonoid compound Quercetin effects in the treatment of acute myeloid leukemia and myelodysplastic syndromes. Molecules 2021, 26, 5781. [Google Scholar] [CrossRef]
- Lee, T.J.; Kim, O.H.; Kim, Y.H.; Lim, J.H.; Kim, S.; Park, J.-W.; Kwon, T.K. Quercetin arrests G2/M phase and induces caspase dependent cell death in U937 cells. Cancer Lett. 2006, 240, 234–242. [Google Scholar] [CrossRef]
- Cheng, S.; Gao, N.; Zhang, Z.; Chen, G.; Budhraja, A.; Ke, Z.; Son, Y.O.; Wang, X.; Luo, J.; Shi, X. Quercetin Induces Tumor-SelectiveApoptosis through Downregulation of Mcl-1 and Activation of Bax. Clin. Cancer Res. 2010, 16, 5679–5691. [Google Scholar] [CrossRef] [PubMed]
- Spagnuolo, C.; Cerella, C.; Russo, M.; Chateauvieux, S.; Diederich, M.; Russo, G.L. Quercetin downregulates Mcl-1 by acting on mRNA stability and protein degradation. Br. J. Cancer 2011, 105, 221–230. [Google Scholar] [CrossRef]
- Alvarez, M.C.; Maso, V.; Torello, C.O.; Ferro, K.P.; Saad, S.T.O. The polyphenol quercetin induces cell death in leukemia by targeting epigenetic regulators of pro-apoptotic genes. Clin. Epigenet. 2018, 10, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Swarts, S.G.; Yin, L.; Liu, C.; Tian, Y.; Cao, Y.; Swarts, M.; Yang, S.; Zhang, S.B.; Zhang, K.; et al. Antioxidant Properties of Quercetin. Adv. Exp. Med. Biol. 2011, 701, 283–289. [Google Scholar] [PubMed]
- Chen, X.; Dong, X.S.; Gao, H.Y.; Jing, Y.F.; Jin, Y.L.; Chang, Y.Y.; Chen, L.Y.; Wang, J.H. Suppression of HSP27 increases the anti-tumor effects of quercetin in human leukemia U937 cells. Mol. Med. Rep. 2016, 13, 689–696. [Google Scholar] [CrossRef]
- Proud, C.G. Phosphorylation and signal transduction pathways in translational control. Cold Spring Harb. Perspect. Biol. 2019, 11, a033050. [Google Scholar] [CrossRef]
- Roux, P.P.; Topisirovic, I. Signaling pathways involved in the regulation of mRNA translation. Mol. Cell. Biol. 2018, 38, e00070-18. [Google Scholar] [CrossRef] [PubMed]
- Wek, R.C. Role of eIF2α kinases in translational control and adaptation to cellular stress. Cold Spring Harb. Perspect. Biol. 2018, 10, a032870. [Google Scholar] [CrossRef]
- Sundström, C.; Nilsson, K. Establishment and characterization of a human histiocytic lymphoma cell line (U-937). Int. J. Cancer 1976, 17, 565–577. [Google Scholar] [CrossRef] [PubMed]
- Tsuchiya, S.; Yamabe, M.; Yamaguchi, Y.; Kobayashi, Y.; Konno, T.; Tada, K. Establishment and characterization of a human acute monocytic cell line (THP-1). Int. J. Cancer 1980, 26, 171–176. [Google Scholar] [CrossRef] [PubMed]
- Nicoletti, I.; Migliorati, G.; Pagliacci, M.C.; Grignani, F.; Riccardi, C. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J. Immunol. Methods 1991, 139, 271–279. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, E.K.; Clavarino, G.; Ceppi, M.; Pierre, P. SunSet, a nonradioactive method to monitor protein synthesis. Nat. Methods 2009, 6, 275–277. [Google Scholar] [CrossRef]
- Ghosh, J.; Kapur, R. Role of mTORC1-S6K1 signaling pathway in regulation of hematopoietic stem cell and acute myeloid leukemia. Exp. Hematol. 2017, 50, 13–21. [Google Scholar] [CrossRef]
- Pearce, L.R.; Alton, G.R.; Richter, D.T.; Kath, J.C.; Lingardo, L.; Chapman, J.; Hwang, C.; Alessi, D.R. Characterization of PF-4708671, a novel and highly specific inhibitor of p70 ribosomal S6 kinase (S6K1). Biochem. J. 2010, 431, 245–255. [Google Scholar] [CrossRef]
- Saxton, R.A.; Sabatini, D.M. mTOR signaling in growth, metabolism and disease. Cell 2017, 168, 960–978. [Google Scholar] [CrossRef]
- Klionsky, D.J.; Abdelmohsen, K.; Abe, A.; Abedin, M.J.; Abeliovich, H.; Avecedo Arozena, A.; Adachi, H.; Adams, C.M.; Adams, P.D.; Adeli, K.; et al. Guidelines for the use and interpretation of assays for monitoring autophagy (3th edition). Autophagy 2016, 12, 1–222. [Google Scholar] [CrossRef]
- Sardiello, M.; Palmieri, M.; Di Ronza, A.; Medina, D.L.; Valenza, M.; Gennarino, V.A.; Di Malta, C.; Donaudy, F.; Embrione, V.; Polishchuk, R.S.; et al. A gene network regulating lysosomal biogenesis and function. Science 2009, 325, 473–477. [Google Scholar] [CrossRef] [PubMed]
- Settembre, C.; Di Malta, C.; Polito, V.A.; Arencibia, M.G.; Vetrini, F.; Erdin, S.; Erdin, S.U.; Huynh, T.; Medina, D.; Colella, P.; et al. TFEB links autophagy to lysosomal biogenesis. Science 2011, 332, 1429–1433. [Google Scholar] [CrossRef] [PubMed]
- Settembre, C.; Zoncu, R.; Medina, D.L.; Vetrini, F.; Erdin, S.; Erdin, S.U.; Huynh, T.; Ferron, M.; Karsenty, G.; Vellard, M.C.; et al. A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. EMBO J. 2012, 31, 1095–1108. [Google Scholar] [CrossRef]
- Martina, J.A.; Chen, Y.; Gucek, M.; Puertollano, R. mTORC1 functions as a transcriptional regulator of autophagy by preventing nuclear transport of TFEB. Autophagy 2012, 8, 903–914. [Google Scholar] [CrossRef]
- Roczniak-Ferguson, A.; Petit, C.S.; Froehlich, F.; Qian, S.; Ky, J.; Angarola, B.; Walther, T.C.; Ferguson, S.M. The transcription factor TFEB links mTORC1 signaling to transcriptional control of lysosome homeostasis. Sci. Signal. 2012, 5, ra42. [Google Scholar] [CrossRef] [PubMed]
- Settembre, C.; Medina, D.L. TFEB and the CLEAR network. Methods Cell Biol. 2015, 126, 45–62. [Google Scholar]
- Park, S.; Chapuis, N.; Tamburini, J.; Bardet, V.; Cornillet-Lefebvre, P.; Willems, L.; Green, A.; Mayeux, P.; Lacombe, C.; Bouscary, D. Role of the PI3K/AKT and mTOR signaling pathways in acute myeloid leukemia. Haematologica 2010, 95, 819–828. [Google Scholar] [CrossRef]
- Nepstad, I.; Hatfield, K.J.; Gronningsaeter, I.S.; Reikvam, H. The PI3K-Akt-mTOR signaling pathway in human Acute Myeloid Leukemia (AML) cells. Int. J. Mol. Sci. 2020, 21, 2907. [Google Scholar] [CrossRef]
- Carriere, A.; Romeo, Y.; Acosta-Jaquez, H.A.; Moreau, J.; Bonneil, E.; Thibault, P.; Fingar, D.C.; Roux, P.P. ERK1/2 phosphorylate Raptor to promote Ras-dependent activation of mTOR complex 1 (mTORC1). J. Biol. Chem. 2011, 286, 567–577. [Google Scholar] [CrossRef] [PubMed]
- Rajalingam, K.; Schreck, R.; Rapp, U.R.; Albert, S. Ras oncogenes and their downstream targets. Biochim. Biophys. Acta 2007, 1773, 1177–1195. [Google Scholar] [CrossRef]
- Carriere, A.; Cargnello, M.; Julien, L.A.; Gao, H.; Bonneil, E.; Thibault, P.; Roux, P.P. Oncogenic MAPK signaling stimulates mTORC1 activity by promoting RSK-mediated raptor phosphorylation. Curr. Biol. 2008, 18, 1269–1277. [Google Scholar] [CrossRef] [PubMed]
- Zeng, X.; Kinsella, T.J. Mammalian target of rapamycin and S6 Kinase 1 positively regulate 6-thioguanine-induced autophagy. Cancer Res. 2008, 68, 2384–2390. [Google Scholar] [CrossRef] [PubMed]
- Arico, S.; Petiot, A.; Bauvy, C.; Dubbelhuis, P.F.; Meijer, A.J.; Codogno, P.; Ogier-Denis, E. The tumor suppressor PTEN positively regulates macroautophagy by inhibiting the phosphatidylinositol 3-kinase/protein kinase B pathway. J. Biol. Chem. 2001, 276, 35243–35246. [Google Scholar] [CrossRef]
- Scott, R.C.; Schuldiner, O.; Neufeld, T.P. Role and regulation of starvation-induced autophagy in the Drosophila fat body. Dev. Cell 2004, 7, 167–178. [Google Scholar] [CrossRef] [PubMed]
- Armour, S.M.; Baur, J.A.; Hsieh, S.N.; Land-Bracha, A.; Thomas, S.M.; Sinclair, D.A. Inhibition of mammalian S6 kinase by resveratol supresses autophagy. Aging 2009, 1, 515–528. [Google Scholar] [CrossRef] [PubMed]
- Storniolo, A.; Raciti, M.; Cucina, A.; Bizzarri, M.; Di Renzo, L. Quercetin affects Hsp70/IRE1α mediated protection from death induced by endoplasmic reticulum stress. Oxid. Med. Cell. Longev. 2015, 2015, 645157. [Google Scholar] [CrossRef] [PubMed]








| BECN1 | for: TGGACACGAGTTTCAAGATCC |
| rev: CTCCTGGGTCTCTCCTGGTT | |
| Map1LC3b | for: GAGAAGACCTTCAAGCAGCG |
| rev: AAGCTGCTTCTCACCCTTGT | |
| SQTM1/p62 | for: CCCGTCTACAGGTGAACTCC |
| rev: CTGGGAGAGGGACTCAATCA | |
| LAMP1 | for: ACTACGACACCAAGAGTGGC |
| rev: AAGCAATCACGAGACTGGGG | |
| ULK1 | for: TGAAAACATCGTGGCCCTGT |
| rev: CCGTTGCAGTACTCCATAACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Germano, C.A.; Clemente, G.; Storniolo, A.; Romeo, M.A.; Ferretti, E.; Cirone, M.; Di Renzo, L. mTORC1/ERK1/2 Interplay Regulates Protein Synthesis and Survival in Acute Myeloid Leukemia Cell Lines. Biology 2023, 12, 676. https://doi.org/10.3390/biology12050676
Germano CA, Clemente G, Storniolo A, Romeo MA, Ferretti E, Cirone M, Di Renzo L. mTORC1/ERK1/2 Interplay Regulates Protein Synthesis and Survival in Acute Myeloid Leukemia Cell Lines. Biology. 2023; 12(5):676. https://doi.org/10.3390/biology12050676
Chicago/Turabian StyleGermano, Concetta Anna, Giuseppe Clemente, Antonello Storniolo, Maria Anele Romeo, Elisabetta Ferretti, Mara Cirone, and Livia Di Renzo. 2023. "mTORC1/ERK1/2 Interplay Regulates Protein Synthesis and Survival in Acute Myeloid Leukemia Cell Lines" Biology 12, no. 5: 676. https://doi.org/10.3390/biology12050676
APA StyleGermano, C. A., Clemente, G., Storniolo, A., Romeo, M. A., Ferretti, E., Cirone, M., & Di Renzo, L. (2023). mTORC1/ERK1/2 Interplay Regulates Protein Synthesis and Survival in Acute Myeloid Leukemia Cell Lines. Biology, 12(5), 676. https://doi.org/10.3390/biology12050676

