Comparative Evaluation of qnrA, qnrB, and qnrS Genes in Enterobacteriaceae Ciprofloxacin-Resistant Cases, in Swine Units and a Hospital from Western Romania
Abstract
1. Introduction
2. Results
2.1. Antibiotic Susceptibility Testing (AST)
2.2. PCR Techniques—Isolation of Bacterial DNA (E. coli) in Humans and Swine
3. Discussion
- Dissimilar evolution of bacterial diseases on farms,
- Diverse treatment protocols between units,
- Organization of antimicrobial products through treatment rotation.
4. Materials and Methods
4.1. Location and Samples Collecting for AST
4.1.1. Samples
4.1.2. Microbial Testing
4.2. PCR Techniques—Isolation of Bacterial DNA (E. coli) in Humans and Swine Samples
4.3. Statistical and Data Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Aslam, B.; Wang, W.; Arshad, M.I.; Khurshid, M.; Muzammil, S.; Rasool, M.H.; Nisar, M.A.; Alvi, R.F.; Aslam, M.A.; Qamar, M.U.; et al. Antibiotic resistance: A rundown of a global crisis. Infect. Drug Resist. 2018, 11, 1645–1658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cristina, R.T.; Doma, A.O.; Dumitrescu, E.; Muselin, F.; Chirilă, B.A. About the Development and Implications of the Drug Resistance Phenomenon of Veterinary Antinfectious and Parasitic Drugs and the Evolution of this Phenomenon in Romania. Med. Vet./Vet. Drug 2018, 12, 4–49. Available online: http://www.veterinarypharmacon.com/docs/1948-2018_VD_12(1)_ART2.RO.pdf (accessed on 20 March 2020).
- European Centre for Disease Prevention and Control (ECDC); European Food Safety Authority (EFSA); European Medicines Agency (EMA). ECDC/EFSA/EMA second joint report on the integrated analysis of the consumption of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from humans and food-producing animals. EFSA J. 2017, 15, e04872. [Google Scholar] [CrossRef] [Scilit]
- Frieri, M.; Kumar, K.; Boutin, A. Antibiotic Resistance. J. Inf. Public Health 2017, 10, 369–378. [Google Scholar] [CrossRef] [Scilit]
- Moruzi, R.F.; Tîrziu, E.; Muselin, F.; Dumitrescu, E.; Huțu, I.; Mircu, C.; Tulcan, C.; Doma, A.O.; Degi, J.; Degi, D.M.; et al. The Importance of Databases to Manage the Phenomenon of Resistance to Antimicrobials for Veterinary Use. Rev. Rom. Med. Vet. 2019, 29, 40–57. [Google Scholar]
- Khameneh, B.; Diab, R.; Ghazvini, K.; Bazzaz, B.S.F. Breakthroughs in bacterial resistance mechanisms and the potential ways to combat them. Microb. Pathog. 2016, 95, 32–42. [Google Scholar] [CrossRef] [Scilit]
- Marshall, B.M.; Levy, S.B. Food Animals and Antimicrobials: Impacts on Human Health. Clin. Microbiol. Rev. 2011, 24, 718–733. [Google Scholar] [CrossRef] [Scilit]
- Muloi, D.; Ward, M.J.; Pedersen, A.B.; Fèvre, E.M.; Woolhouse, M.E.J.; van Bunnik, B.A.D. Are Food Animals Responsible for Transfer of Antimicrobial Resistant Escherichia coli or their Resistance Determinants to Human Populations? A Systematic Review. Foodborne Pathog. Dis. 2018, 15, 464–474. [Google Scholar] [CrossRef] [Scilit]
- Tang, K.L.; Caffrey, N.P.; Nóbrega, D.B.; Cork, S.C.; Ronksley, P.E.; Barkema, H.W.; Polachek, A.J.; Ganshorn, H.; Sharma, N.; Kellner, J.D.; et al. Restricting the use of antibiotics in food-producing animals and its associations with antibiotic resistance in food-producing animals and human beings: A systematic review and meta-analysis. Lancet Planet. Health 2017, 1, e316–e327. [Google Scholar] [CrossRef] [Scilit]
- Paauw, A.; Fluit, A.C.; Verhoef, J.; Hall, M.A.L.-V. Enterobacter cloacae Outbreak and Emergence of Quinolone Resistance Gene in Dutch Hospital. Emerg. Infect. Dis. 2006, 12, 807–812. [Google Scholar] [CrossRef] [Scilit]
- Tamang, M.D.; Seol, S.Y.; Oh, J.-Y.; Kang, H.Y.; Lee, J.C.; Lee, Y.C.; Cho, D.T.; Kim, J. Plasmid-Mediated Quinolone Resistance Determinants qnrA, qnrB, and qnrS among Clinical Isolates of Enterobacteriaceae in a Korean Hospital. Antimicrob. Agents Chemother. 2008, 52, 4159–4162. [Google Scholar] [CrossRef] [Scilit]
- Corkill, J.E.; Anson, J.J.; Hart, C.A. High prevalence of the plasmid-mediated quinolone resistance determinant qnrA in multidrug-resistant Enterobacteriaceae from blood cultures in Liverpool, UK. J. Antimicrob. Chemother. 2005, 56, 1115–1117. [Google Scholar] [CrossRef] [Scilit]
- Cristina, R.T.; Doma, A.O.; Moșneang, C.L. Use of antibiotics and about quinolones in veterinary therapy. Med. Vet./Vet. Drug 2012, 6, 4–67. Available online: http://www.veterinarypharmacon.com/docs/1116-2012-6(2)-ART.2-ro.pdf (accessed on 20 March 2020).
- Du, X.D.; Lian, M.X.; LI, D.X.; Zhang, S.M.; Liu, J.H.; Pan, Y.S.; Li, X.S. Detection of Plasmid-mediated Quinolone Resistant Genes among Escherichia coli Strains Isolated from Healthy Pigs. Jiangxi J. Agric. Sci. 2009, 21, 9–11. [Google Scholar]
- Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.A.; Hooper, D.C. qnr Prevalence in Ceftazidime-Resistant Enterobacteriaceae Isolates from the United States. Antimicrob. Agents Chemother. 2006, 50, 2872–2874. [Google Scholar] [CrossRef] [Scilit]
- Martínez-Martínez, L.; Pascual, A.; Jacoby, G.A. Quinolone resistance from a transferable plasmid. Lancet 1998, 351, 797–799. [Google Scholar] [CrossRef] [Scilit]
- Azargun, R.; Barhaghi, M.H.S.; Kafil, H.S.; Oskouee, M.A.; Sadeghi, V.; Memar, M.Y.; Ghotaslou, R. Frequency of DNA gyrase and topoisomerase IV mutations and plasmid-mediated quinolone resistance genes among Escherichia coli and Klebsiella pneumoniae isolated from urinary tract infections in Azerbaijan, Iran. J. Glob. Antimicrob. Resist. 2019, 17, 39–43. [Google Scholar] [CrossRef] [Scilit]
- Yanat, B.; Rodríguez-Martínez, J.M.; Touati, A. Plasmid-mediated quinolone resistance in Enterobacteriaceae: A systematic review with a focus on Mediterranean countries. Eur. J. Clin. Microbiol. Infect. Dis. 2016, 36, 421–435. [Google Scholar] [CrossRef] [Scilit]
- Vieira, D.C.; Lima, W.G.; Paiva, M.C. Plasmid-mediated quinolone resistance (PMQR) among Enterobacteriales in Latin America: A systematic review. Mol. Biol. Rep. 2019, 47, 1471–1483. [Google Scholar] [CrossRef] [Scilit]
- Mahmoud, A.T.; Salim, M.T.; Ibrahem, R.A.; Gabr, A.; Halby, H.M. Multiple Drug Resistance Patterns in Various Phylogenetic Groups of Hospital-Acquired Uropathogenic E. coli Isolated from Cancer Patients. Antibiotics 2020, 9, 108. [Google Scholar] [CrossRef] [Scilit]
- Salah, F.D.; Soubeiga, S.T.; Ouattara, A.K.; Sadji, A.Y.; Metuor-Dabire, A.; Obiri-Yeboah, D.; Kere, A.B.; Karou, S.D.; Simpore, J. Distribution of quinolone resistance gene (qnr) in ESBL-producing Escherichia coli and Klebsiella spp. in Lomé, Togo. Antimicrob. Resist. Infect. Control 2019, 8, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Hamed, S.M.; Elkhatib, W.F.; El-Mahallawy, H.A.; Helmy, M.M.; Ashour, M.S.; Aboshanab, K. Multiple mechanisms contributing to ciprofloxacin resistance among Gram negative bacteria causing infections to cancer patients. Sci. Rep. 2018, 8, 12268. [Google Scholar] [CrossRef] [Scilit]
- Kindle, P.; Zurfluh, K.; Nüesch-Inderbinen, M.; Von Ah, S.; Sidler, X.; Stephan, R.; Kümmerlen, D. Phenotypic and genotypic characteristics of Escherichia coli with non-susceptibility to quinolones isolated from environmental samples on pig farms. Porc. Health Manag. 2019, 5, 9. [Google Scholar] [CrossRef] [Scilit]
- Kuo, H.-C.; Chou, C.-C.; Tu, C.; Gong, S.-R.; Han, C.-L.; Liao, J.-W.; Chang, S.-K. Characterization of plasmid-mediated quinolone resistance by the qnrS gene in Escherichia coli isolated from healthy chickens and pigs. Vet. Med. 2009, 54, 473–482. [Google Scholar] [CrossRef] [Scilit]
- Yue, L.; Jiang, H.-X.; Liao, X.-P.; Liu, J.-H.; Li, S.-J.; Chen, X.-Y.; Chen, C.-X.; Lü, D.-H.; Liu, Y.-H. Prevalence of plasmid-mediated quinolone resistance qnr genes in poultry and swine clinical isolates of Escherichia coli. Vet. Microbiol. 2008, 132, 414–420. [Google Scholar] [CrossRef] [Scilit]
- Jacoby, G.A.; Strahilevitz, J.; Hooper, D.C. Plasmid-mediated Quinolone Resistance: A multifaceted threat. Clin. Microbiol. Rev. 2009, 22, 664–689. [Google Scholar] [CrossRef] [Scilit]
- Jacoby, G.; Cattoir, V.; Hooper, D.; Martínez-Martínez, L.; Nordmann, P.; Pascual, A.; Poirel, L.; Wang, M. qnr Gene Nomenclature. Antimicrob. Agents Chemother. 2008, 52, 2297–2299. [Google Scholar] [CrossRef] [Scilit]
- Jacoby, G.A.; Walsh, K.E.; Mills, D.M.; Walker, V.J.; Oh, H.; Robicsek, A.; Hooper, D.C. qnrB, Another Plasmid-Mediated Gene for Quinolone Resistance. Antimicrob. Agents Chemother. 2006, 50, 1178–1182. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.H.; Deng, Y.T.; Zeng, Z.L.; Gao, J.H. Coprevalence of Plasmid-Mediated Quinolone Resistance Determinants qepA, qnr, and AAC(6′)-Ib-cr among 16S rRNA Methylase RmtB-Producing Escherichia coli Isolates from Pigs. Antimicrob. Agents Chemother. 2008, 52, 2992–2993. [Google Scholar] [CrossRef] [Scilit]
- Poirel, L.; Nguyen, T.V.; Weintraub, A.; Leviandier, C.; Nordmann, P. Plasmid-mediated quinolone resistance determinant qnrS in Enterobacter cloacae. Clin. Microbiol. Infect. 2006, 12, 1021–1023. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Tran, J.H.; Jacoby, G.A.; Zhang, Y.; Wang, F.; Hooper, D.C. Plasmid-Mediated Quinolone Resistance in Clinical Isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother. 2003, 47, 2242–2248. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.-J.; Ko, W.-C.; Tsai, S.-H.; Yan, J.-J. Prevalence of Plasmid-Mediated Quinolone Resistance Determinants QnrA, QnrB, and QnrS among Clinical Isolates of Enterobacter cloacae in a Taiwanese Hospital. Antimicrob. Agents Chemother. 2007, 51, 1223–1227. [Google Scholar] [CrossRef] [Scilit]
- Commission Staff Document. EU Action on Antimicrobial Resistance. 2019. Available online: https://ec.europa.eu/health/amr/antimicrobial-resistance_en (accessed on 15 February 2020).
| No. | CIP-Resistant Sample No. | Antibiotics Where Resistance Was Identified | Total Antibiotics |
|---|---|---|---|
| 1. | S.2. | CIP; NOR; FLO; AMX; CEF; SPCM; TC | 7 |
| 2. | S.6. | CIP; ENR; AMX; CEF; OXA; FLO; SPCM | 7 |
| 3. | S.7. | CIP; AMX; OXA; CEF; SPCM; TC | 6 |
| 4. | S.13. | CIP; ENR; NOR; AMX; FLO; CEF; SPCM; TC | 8 |
| 5. | S.14. | CIP; AMX; FLO; CEF; TC | 5 |
| 6. | S.16. | CIP; NOR; AMX; FLO; CEF; SPCM; TC | 7 |
| 7. | S.22. | CIP; ENR | 2 |
| 8. | S.28. | CIP ENR; AMX; PSTR; NEO; CST; TC | 7 |
| 9. | S.35. | CIP; ENR AMX; FLO; LCM; NEO; TC | 7 |
| 10. | S.36. | CIP; ENR; FLO; AMX; LCM; NEO; TC | 7 |
| 11. | S.38. | CIP; ENR; AMP; AMX; FLO; LCM; NEO; TC | 8 |
| 12. | S.46. | CIP; ENR; AMP; GEN; NEO; FLO; LCM; TC; POS | 9 |
| 13. | S.47. | CIP; ENR; AMP; GEN; NEO; FLO; LCM; TC; POS | 9 |
| 14. | S.49. | CIP; ENR; AMP; AMX; NEO; STR; GEN; FLO; LCM; TC; POS | 11 |
| 15. | S.50. | CIP; ENR; AMP; AMX; NEO; STR; FLO; LCM; TC; POS | 10 |
| No. | CIP -Resistant Sample No. | Antibiotics Where Resistance Was Identified | Total Antibiotics | No. | CIP -Resistant Sample No. | Antibiotics Where Resistance Was Identified | Total Antibiotics |
|---|---|---|---|---|---|---|---|
| 1. | H.6. | CIP; LVX; PIP; SAM; GEN | 5 | 20. | H.78. | CIP; PIP; SAM; CAZ; CTX; CFPM; TZP | 7 |
| 2. | H.13. | CIP; LVX; TPM | 3 | 21. | H.79. | CIP, PIP | 2 |
| 3. | H.15. | CIP; LVX; PIP | 3 | 22. | H.80. | CIP, LVX; PIP | 3 |
| 4. | H.16. | CIP; LVX; PIP; TPM | 4 | 23. | H.85. | CIP; PIP; CTX; CXM | 4 |
| 5. | H.19. | CIP | 1 | 24. | H.88. | CIP; LVX; PIP; CXM; TPM | 5 |
| 6. | H.20. | CIP, LVX | 2 | 25. | H.90. | CIP; LVX; GEN; PIP | 4 |
| 7. | H.21. | CIP, LVX; PIP | 3 | 26. | H.94. | CIP; PIP; CAZ; CTX; CXM; TPM | 6 |
| 8. | H.22. | CIP; PIP; CAP; CTX; CXM; GEN | 6 | 27. | H.97. | CIP; PIP; SAM; TPM | 4 |
| 9. | H.24. | CIP; PIP; CTX; TPM | 4 | 28. | H.102. | CIP; PIP; CAZ; CXM | 4 |
| 10. | H.26. | CIP, LVX | 2 | 29. | H.104. | CIP; PIP; CAZ. CTX; CFPM; TPM | 6 |
| 11. | H.32. | CIP; PIP; SAM; CTX; CXM | 5 | 30. | H.106. | CIP; PIP. | 2 |
| 12. | H.35 | CIP; PIP; CXM; TPM | 4 | 31. | H.110. | CIP; PIP; TPM | 3 |
| 13. | H.49. | CIP; LVX; PIP; CTX; CXM | 5 | 32. | H.116. | CIP; LVX; PIP; CXM; TPM | 5 |
| 14. | H.50. | CIP; LV | 2 | 33. | H.119. | CIP; PIP; SAM; TPM | 4 |
| 15. | H.60. | CIP; PIP; TPM | 3 | 34. | H.130. | CIP; LVX; SAM; CAZ; CTX; CFPM; GEN; TZP | 8 |
| 16. | H.65. | CIP; LVX; PIP; SAM; CAZ; CTX; CFPM; GEN | 8 | 35. | H.134. | CIP; TPM. | 2 |
| 17. | H.68. | CIP; LVX | 2 | 36. | H.142. | CIP; CXM. | 2 |
| 18 | H.70. | CIP; LVX; PIP; CTX; CXM | 5 | 37. | H.144. | CIP; TPM | 2 |
| 19 | H.71. | CIP; PIP; CTX; CXM; TPM | 5 | 38. | H.147. | CIP; PIP; SAM; TPM. | 4 |
| Cross-Tabulation Results | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Humans (H) | Swine (S) | ||||||||||
| Antibacterial | Results | Total | Antibacterial | Results | Total | ||||||
| N | R | S | N | R | S | ||||||
| Amikacin | count | 4 | 1 | 142 | 147 | Amoxicillin | count | 6 | 43 | 4 | 53 |
| % | 2.7 | 0.7 | 96.6 | 100.0 | % | 11.32 | 81.13 | 7.55 | 100.0 | ||
| Ampicillin-sulbctam | count | 20 | 14 | 113 | 147 | Ampicillin | count | 44 | 9 | 0 | 53 |
| % | 13.6 | 9.5 | 76.9 | 100.0 | % | 83.02 | 16.98 | 0.0 | 100.0 | ||
| Aztreonam | count | 145 | 0 | 2 | 147 | Sulfadoxin | count | 49 | 0 | 4 | 53 |
| % | 98.6 | 0.0 | 1.4 | 100.0 | % | 92.45 | 0.0 | 7.55 | 100.0 | ||
| Cefepime | count | 5 | 5 | 137 | 147 | Cefalotin | count | 36 | 17 | 0 | 53 |
| % | 3.4 | 3.4 | 93.2 | 100.0 | % | 67.92 | 32.08 | 0.0 | 100.0 | ||
| Cefoperazona-sulbactam | count | 146 | 0 | 1 | 147 | Ceftiofur | count | 41 | 0 | 12 | 53 |
| % | 99.3 | 0.0 | 0.7 | 100.0 | % | 77.35 | 0.0 | 22.65 | 100.0 | ||
| Ceftazidime | count | 6 | 9 | 132 | 147 | Ciprofloxacin | count | 22 | 15 | 16 | 53 |
| % | 4.1 | 6.1 | 89.8 | 100.0 | % | 41.51 | 28.30 | 30.19 | 100.0 | ||
| Ceftriaxone | count | 11 | 15 | 121 | 147 | Cefquinome | count | 46 | 0 | 7 | 53 |
| % | 7.5 | 10.2 | 82.3 | 100.0 | % | 86.79 | 0.0 | 13.21 | 100.0 | ||
| Cefuroxime | count | 11 | 21 | 115 | 147 | Colistin | count | 22 | 14 | 17 | 53 |
| % | 7.5 | 14.3 | 78.2 | 100.0 | % | 41.51 | 26.42 | 32.07 | 100.0 | ||
| Ciprofloxacin | count | 4 | 39 | 104 | 147 | Doxycycline | count | 37 | 10 | 6 | 53 |
| % | 2.7 | 26.5 | 70.7 | 100.0 | % | 68.81 | 18.87 | 11.32 | 100.0 | ||
| Colistin sulphate | count | 36 | 0 | 111 | 147 | Enrofloxacin | count | 16 | 13 | 24 | 53 |
| % | 24.5 | 0.0 | 75.5 | 100.0 | % | 30.19 | 24.53 | 45.28 | 100.0 | ||
| Gentamicin | count | 10 | 6 | 131 | 147 | Erythromycin | count | 39 | 12 | 2 | 53 |
| % | 6.8 | 4.1 | 89.1 | 100.0 | % | 73.58 | 22.65 | 3.77 | 100.0 | ||
| Imipenem | count | 0 | 0 | 147 | 147 | Florfenicol | count | 5 | 27 | 21 | 53 |
| % | 0.0 | 0.0 | 100.0 | 100.0 | % | 9.43 | 50.95 | 39.62 | 100.0 | ||
| Levofloxacin | count | 10 | 19 | 118 | 147 | Gentamycin | count | 4 | 8 | 41 | 53 |
| % | 6.8 | 12.9 | 80.3 | 100.0 | % | 7.55 | 15.09 | 77.36 | 100.0 | ||
| Meropeneme | count | 3 | 0 | 144 | 147 | Lincomycin | count | 27 | 15 | 11 | 53 |
| % | 2.0 | 0.0 | 98.0 | 100.0 | % | 50.95 | 28.30 | 20.75 | 100.0 | ||
| Minocycline | count | 145 | 0 | 2 | 147 | Neomycin | count | 19 | 30 | 4 | 53 |
| % | 98.6 | 0.0 | 1.4 | 100.0 | % | 35.85 | 56.60 | 7.55 | 100.0 | ||
| Ofloxacime | count | 145 | 0 | 2 | 147 | Norfloxacin | count | 36 | 6 | 11 | 53 |
| % | 98.6 | 0.0 | 1.4 | 100.0 | % | 67.92 | 11.32 | 20.75 | 100.0 | ||
| Piperacillin-tazobactam | count | 16 | 4 | 127 | 147 | Oxacillin | count | 36 | 4 | 13 | 53 |
| % | 10.9 | 2.7 | 86.4 | 100.0 | % | 67.92 | 7.55 | 24.53 | 100.0 | ||
| Piperacillin | count | 9 | 71 | 67 | 147 | Penicillin-Streptomycin | count | 49 | 3 | 1 | 53 |
| % | 6.1 | 48.3 | 45.6 | 100.0 | % | 92.45 | 5.66 | 1.89 | 100.0 | ||
| Ticarcillin | count | 145 | 0 | 2 | 147 | Spectinomycin | count | 36 | 13 | 4 | 53 |
| % | 98.6 | 0.0 | 1.4 | 100.0 | % | 67.92 | 24.53 | 7.55 | 100.0 | ||
| Tobramycin | count | 145 | 0 | 2 | 147 | Streptomycin | count | 44 | 7 | 2 | 53 |
| % | 98.6 | 0.0 | 1.4 | 100.0 | % | 83.02 | 13.21 | 3.77 | 100.0 | ||
| Trimethoprim | count | 28 | 42 | 77 | 147 | Sulfonamides | count | 44 | 8 | 1 | 53 |
| % | 19.0 | 28.6 | 52.4 | 100.0 | % | 83.02 | 15.09 | 1.89 | 100.0 | ||
| Total | 1044 | 246 | 1497 | 3087 | Tetracycline | count | 16 | 31 | 6 | 53 | |
| % | 30.19 | 58.49 | 11.32 | 100.0 | |||||||
| Tiamulin | count | 36 | 3 | 14 | 53 | ||||||
| % | 67.92 | 5.66 | 26.42 | 100.0 | |||||||
| Total | 710 | 288 | 221 | 1219 | |||||||
| Humans (H) | Swine (S) | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Chi-Square Tests | Value | df | Asymp. Sig. (2-sided) | Value | df | Asymp. Sig. (2-sided) | ||||||||||||
| Pearson Chi-Square | 2925.127 a | 40 | 0.000 | 574.795a | 44 | 0.000 | ||||||||||||
| Likelihood Ratio | 3113.083 | 40 | 0.000 | 588.576 | 44 | 0.000 | ||||||||||||
| 0 cells (0.0%) have expected count less than 5.0. The minimum expected count is 11.71. | 0 cells (0.0%) have expected count less than 5.0. The minimum expected count is 9.61. | |||||||||||||||||
| Case Processing Summary | Valid | Missing | Total | Valid | Missing | Total | ||||||||||||
| 3087 | 100.0% | 0 | 0.0% | 3087 | 100.0% | 1219 | 100.0% | 0 | 0.0% | 1219 | 100.0% | |||||||
| Humans (H) | Gene | Swine (S) | Gene |
|---|---|---|---|
| H.1. | qnrS + qnrB + qnrA | S.1. | qnrS + qnrB |
| H.2. | qnrS + qnrB | S.2. | qnrS + qnrB |
| H.3. | qnrS + qnrB + qnrA | S.3. | qnrS + qnrB |
| H.4. | qnrS | S.4. | qnrS + qnrB |
| H.5. | - | S.5. | qnrS + qnrB |
| H.6. | qnrS | S.6. | qnrS + qnrB |
| H.7. | qnrS | S.7. | qnrS + qnrB |
| H.8. | qnrS + qnrB | S.8. | qnrS + qnrB |
| H.9. | qnrS | S.9. | qnrS + qnrB |
| H.10. | qnrS + qnrB +qnrA | S.10. | qnrS + qnrB |
| H.11. | - | S.11. | qnrS + qnrB |
| H.12. | qnrS + qnrB | S.12. | qnrS + qnrB |
| H.13. | qnrS + qnrB | - | - |
| H.14. | qnrS + qnrB | - | - |
| H.15. | qnrS + qnrB | - | - |
| Gene | Primer Used | Fragment Size |
|---|---|---|
| qnrS | F: ACGACATTCGTCAACTGGAA R: TTAATTGGCACCCTGTAGGC | 417 bp |
| qnrA | F: ATTTCTCACGCCAGGATTTG R:GATCGGCAAAGGTTAGGTCA | 516 bp |
| qnrB | F: GTTGGCGAAAAAATTGACAGAA R: ACTCCGAATTGGTCAGATCG | 526 bp |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Doma, A.O.; Popescu, R.; Mitulețu, M.; Muntean, D.; Dégi, J.; Boldea, M.V.; Radulov, I.; Dumitrescu, E.; Muselin, F.; Puvača, N.; et al. Comparative Evaluation of qnrA, qnrB, and qnrS Genes in Enterobacteriaceae Ciprofloxacin-Resistant Cases, in Swine Units and a Hospital from Western Romania. Antibiotics 2020, 9, 698. https://doi.org/10.3390/antibiotics9100698
Doma AO, Popescu R, Mitulețu M, Muntean D, Dégi J, Boldea MV, Radulov I, Dumitrescu E, Muselin F, Puvača N, et al. Comparative Evaluation of qnrA, qnrB, and qnrS Genes in Enterobacteriaceae Ciprofloxacin-Resistant Cases, in Swine Units and a Hospital from Western Romania. Antibiotics. 2020; 9(10):698. https://doi.org/10.3390/antibiotics9100698
Chicago/Turabian StyleDoma, Alexandru O., Roxana Popescu, Mihai Mitulețu, Delia Muntean, János Dégi, Marius V. Boldea, Isidora Radulov, Eugenia Dumitrescu, Florin Muselin, Nikola Puvača, and et al. 2020. "Comparative Evaluation of qnrA, qnrB, and qnrS Genes in Enterobacteriaceae Ciprofloxacin-Resistant Cases, in Swine Units and a Hospital from Western Romania" Antibiotics 9, no. 10: 698. https://doi.org/10.3390/antibiotics9100698
APA StyleDoma, A. O., Popescu, R., Mitulețu, M., Muntean, D., Dégi, J., Boldea, M. V., Radulov, I., Dumitrescu, E., Muselin, F., Puvača, N., & Cristina, R. T. (2020). Comparative Evaluation of qnrA, qnrB, and qnrS Genes in Enterobacteriaceae Ciprofloxacin-Resistant Cases, in Swine Units and a Hospital from Western Romania. Antibiotics, 9(10), 698. https://doi.org/10.3390/antibiotics9100698

