Inhibition of the MRSA Biofilm Formation and Skin Antineoplastic Activity of Ethyl Acetate Roots and Aerial Parts Extracts from Geum urbanum L.
Abstract
1. Introduction
2. Results
2.1. Evaluation of MRSA to Produce Slime (Congo Red Agar Plate Test)
2.2. Evaluation of MRSA Biofilm Formation Capability
2.3. Gene Expression
2.4. Cytotoxicity and Antiproliferative Activity
2.5. Assessment of Clonogenicity
2.6. Induction of Apoptosis—Caspase 3 Activity
2.7. Induction of Apoptosis—Hoechst Staining
2.8. Assessment of Skin Irritation Potential
3. Discussion
3.1. Chemical Profile
3.2. Antimicrobial and Antioxidant Activities
3.3. Slime Production and Biofilm Formation of MRSA
3.4. Gene Expression
3.5. Cytotoxicity and Antiproliferative Activity
3.6. In Vivo Experiments
4. Materials and Methods
4.1. Plant Material and Extraction
4.2. Antistaphylococcal Activity
4.2.1. Bacterial Strain and Growth Condition
4.2.2. CRA Plate Test
4.2.3. Determination to Inhibit MRSA Biofilm Formation
4.2.4. Isolation of RNA and cDNA Synthesis
4.2.5. Real-Time PCR
4.2.6. Gene Expression Analysis
4.2.7. Cell Line and Culture Conditions
4.2.8. MTT Assay
4.2.9. Colony Forming Unit Assay
4.2.10. Determination of Caspase 3 Activity
4.2.11. Hoechst Staining
4.2.12. Statistical Methods
4.2.13. Skin Irritation Test
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Murray, C.J.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Aguilar, G.R.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Del Giudice, P. Skin infections caused by Staphylococcus aureus. Acta Derm.-Venereol. 2020, 100, 5725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CDC. Methicillin-Resistant Staphylococcus aureus (MRSA). Available online: https://www.cdc.gov/mrsa/about/index.html#:~:text=MRSA%20is%20a%20type%20of%20staph%20that%20can%20be%20resistant,to%20crowded%20and%20unhygienic%20places (accessed on 10 June 2025).
- Mikziński, P.; Kraus, K.; Widelski, J.; Paluch, E. Modern Microbiological Methods to Detect Biofilm Formation in Orthopedy and Suggestions for Antibiotic Therapy, with Particular Emphasis on Prosthetic Joint Infection (PJI). Microorganisms 2024, 12, 1198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dryden, M.; Baguneid, M.; Eckmann, C.; Corman, S.; Stephens, J.; Solem, C.; Li, J.; Charbonneau, C.; Baillon-Plot, N.; Haider, S. Pathophysiology and burden of infection in patients with diabetes mellitus and peripheral vascular disease: Focus on skin and soft-tissue infections. Clin. Microbiol. Infect. 2015, 21, S27–S32. [Google Scholar] [CrossRef] [Scilit]
- Wei, Y.; Sandhu, E.; Yang, X.; Yang, J.; Ren, Y.; Gao, X. Bidirectional functional effects of staphylococcus on carcinogenesis. Microorganisms 2022, 10, 2353. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Zhuang, H.; Wang, G.; Wang, H.; Dong, Y. Prevalence, predictors, and mortality of bloodstream infections due to methicillin-resistant Staphylococcus aureus in patients with malignancy: Systemic review and meta-analysis. BMC Infect. Dis. 2021, 21, 74. [Google Scholar] [CrossRef] [Scilit]
- WHO. World Health Statistics 2024. Monitoring Health for the SDGs, Sustainable Development Goals; WHO: Geneva, Switzerland, 2024; pp. 1–86. [Google Scholar]
- Adeiza, S.S.; Aminul, I. Meta-meta-analysis of the mortality risk associated with MRSA compared to MSSA bacteraemia. Le Infez. Med. 2024, 32, 131. [Google Scholar] [CrossRef] [Scilit]
- Kaplan, J.B.; Mlynek, K.D.; Hettiarachchi, H.; Alamneh, Y.A.; Biggemann, L.; Zurawski, D.V.; Black, C.C.; Bane, C.E.; Kim, R.K.; Granick, M.S. Extracellular polymeric substance (EPS)-degrading enzymes reduce staphylococcal surface attachment and biocide resistance on pig skin in vivo. PLoS ONE 2018, 13, e0205526. [Google Scholar] [CrossRef] [Scilit]
- Jeong, G.-J.; Khan, F.; Tabassum, N.; Cho, K.-J.; Kim, Y.-M. Controlling biofilm and virulence properties of Gram-positive bacteria by targeting wall teichoic acid and lipoteichoic acid. Int. J. Antimicrob. Agents 2023, 62, 106941. [Google Scholar] [CrossRef] [Scilit]
- Schilcher, K.; Horswill, A.R. Staphylococcal biofilm development: Structure, regulation, and treatment strategies. Microbiol. Mol. Biol. Rev. 2020, 84, e00026-19. [Google Scholar] [CrossRef] [Scilit]
- Panlilio, H.; Rice, C.V. The role of extracellular DNA in the formation, architecture, stability, and treatment of bacterial biofilms. Biotechnol. Bioeng. 2021, 118, 2129–2141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, N.; Bai, X.; Shen, Y.; Zhang, T. Target-based screening for natural products against Staphylococcus aureus biofilms. Crit. Rev. Food Sci. Nutr. 2023, 63, 2216–2230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kord, M.; Ardebili, A.; Jamalan, M.; Jahanbakhsh, R.; Behnampour, N.; Ghaemi, E.A. Evaluation of biofilm formation and presence of ica genes in Staphylococcus epidermidis clinical isolates. Osong Public Health Res. Perspect. 2018, 9, 160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Darwish, S.F.; Asfour, H.A. Investigation of biofilm forming ability in Staphylococci causing bovine mastitis using phenotypic and genotypic assays. Sci. World J. 2013, 2013, 378492. [Google Scholar] [CrossRef] [Scilit]
- Oliveira, A.; Cunha, M.d.L.R. Comparison of methods for the detection of biofilm production in coagulase-negative staphylococci. BMC Res. Notes 2010, 3, 260. [Google Scholar] [CrossRef] [Scilit]
- Liberto, M.C.; Matera, G.; Quirino, A.; Lamberti, A.G.; Capicotto, R.; Puccio, R.; Barreca, G.S.; Foca, E.; Cascio, A.; Foca, A. Phenotypic and genotypic evaluation of slime production by conventional and molecular microbiological techniques. Microbiol. Res. 2009, 164, 522–528. [Google Scholar] [CrossRef] [Scilit]
- Assyov, B.; Petrova, A.; Dimitrov, D.; Vassilev, R. Conspectus of the Bulgarian Vascular Flora: Distribution Maps and Floristic Elements. Fourth Revised and Updated Edition; Bulgarian Biodiversity Foundation: Sofia, Bulgaria, 2012; pp. 1–489. [Google Scholar]
- Taylor, K. Geum urbanum L. J. Ecol. 1997, 85, 705–720. [Google Scholar] [CrossRef] [Scilit]
- Grodzinsky, A.M. Medicinal Plants: Encyclopedic Reference Book; Encyclopedia Publishing House: Kyiv, Ukraine, 1992; pp. 124–125. (In Ukrainian) [Google Scholar]
- Кьoсев, П.А. Пoлный справoчник лекарственных растений; ЭКСМО-Пресс: Moscow, Russia, 2001; p. 992. [Google Scholar]
- Йoрданoв, Д.; Никoлoв, А. Бoйчинoв. In Фитoтерапия; Сoфия: Sofia, Bulgaria, 1970; Volume 2. [Google Scholar]
- Levchuk, A.P. Hemostatic and uterine agents. Proc. NIHFI 1927, 3–79. [Google Scholar]
- Bunse, M.; Mailänder, L.K.; Lorenz, P.; Stintzing, F.C.; Kammerer, D.R. Evaluation of Geum urbanum L. Extracts with Respect to Their Antimicrobial Potential. Chem. Biodivers. 2022, 19, e202100850. [Google Scholar] [CrossRef] [Scilit]
- Dimitrova, L.; Zaharieva, M.M.; Popova, M.; Kostadinova, N.; Tsvetkova, I.; Bankova, V.; Najdenski, H. Antimicrobial and antioxidant potential of different solvent extracts of the medicinal plant Geum urbanum L. Chem. Cent. J. 2017, 11, 113. [Google Scholar] [CrossRef] [Scilit]
- Dimitrova, L.; Popova, M.; Bankova, V.; Najdenski, H. Anti-quorum sensing potential of Geum urbanum L. Comptes Rendus De L’académie Bulg. Des Sci. 2019, 72, 341–349. [Google Scholar] [CrossRef] [Scilit]
- Dimitrova, L.; Mileva, M.; Georgieva, A.; Tzvetanova, E.; Popova, M.; Bankova, V.; Najdenski, H. Redox-Modulating Capacity and Effect of Ethyl Acetate Roots and Aerial Parts Extracts from Geum urbanum L. on the Phenotype Inhibition of the Pseudomonas aeruginosa Las/RhI Quorum Sensing System. Plants 2025, 14, 213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farzaneh, A.; Faramarzi, M.A.; Delnavazi, M.R.; Monsef-Esfahani, H.R. In vitro anti-diabetic and anti-oxidant activities of Geum species from Iran. Res. J. Pharmacogn. 2022, 9, 37–44. [Google Scholar] [CrossRef]
- Schmitt, M.; Magid, A.A.; Nuzillard, J.-M.; Hubert, J.; Etique, N.; Duca, L.; Voutquenne-Nazabadioko, L. Investigation of antioxidant and elastase inhibitory activities of Geum urbanum aerial parts, chemical characterization of extracts guided by chemical and biological assays. Nat. Prod. Commun. 2020, 15, 1934578X20915307. [Google Scholar] [CrossRef] [Scilit]
- Mileva, M.; Dimitrova, L.; Popova, M.; Bankova, V.; Krastev, D.; Najdenski, H.; Zhelev, Z.; Aoki, I.; Bakalova-Zheleva, R. Redox-modulation, Suppression of “Oncogenic” Superoxide and Induction of Apoptosis in Burkitt’s Lymphoma Cells Using Geum urbanum L. Extracts. Int. J. Bioautomation 2021, 25, 315–330. [Google Scholar] [CrossRef] [Scilit]
- Zaharieva, M.M.; Dimitrova, L.L.; Philipov, S.; Nikolova, I.; Vilhelmova, N.; Grozdanov, P.; Nikolova, N.; Popova, M.; Bankova, V.; Konstantinov, S.M.; et al. In vitro antineoplastic and antiviral activity and in vivo toxicity of Geum urbanum L. extracts. Molecules 2021, 27, 245. [Google Scholar] [CrossRef] [Scilit]
- Lobbens, E.S.; Breydo, L.; Skamris, T.; Vestergaard, B.; Jäger, A.K.; Jorgensen, L.; Uversky, V.; van de Weert, M. Mechanistic study of the inhibitory activity of Geum urbanum extract against α-Synuclein fibrillation. Biochim. Et Biophys. Acta (BBA)-Proteins Proteom. 2016, 1864, 1160–1169. [Google Scholar] [CrossRef] [Scilit]
- Neshati, V.; Mollazadeh, S.; Fazly Bazzaz, B.S.; Iranshahi, M.; Mojarrad, M.; Naderi-Meshkin, H.; Kerachian, M.A. Cardiogenic effects of characterized Geum urbanum extracts on adipose-derived human mesenchymal stem cells. Biochem. Cell Biol. 2018, 96, 610–618. [Google Scholar] [CrossRef] [Scilit]
- Granica, S.; Kłębowska, A.; Kosiński, M.; Piwowarski, J.P.; Dudek, M.K.; Kaźmierski, S.; Kiss, A.K. Effects of Geum urbanum L. root extracts and its constituents on polymorphonuclear leucocytes functions. Significance in periodontal diseases. J. Ethnopharmacol. 2016, 188, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Hassanpour, S.H.; Doroudi, A. Review of the antioxidant potential of flavonoids as a subgroup of polyphenols and partial substitute for synthetic antioxidants. Avicenna J. Phytomedicine 2023, 13, 354. [Google Scholar]
- Rae, N.; Jarchow-MacDonald, A.; Nathwani, D.; Marwick, C.A. MRSA: Treating people with infection. BMJ Clin. Evid. 2016, 2016, 0922. [Google Scholar]
- Wang, B.; Wei, P.-W.; Wan, S.; Yao, Y.; Song, C.-R.; Song, P.-P.; Xu, G.-B.; Hu, Z.-Q.; Zeng, Z.; Wang, C. Ginkgo biloba exocarp extracts inhibit S. aureus and MRSA by disrupting biofilms and affecting gene expression. J. Ethnopharmacol. 2021, 271, 113895. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le, K.Y.; Otto, M. Approaches to combating methicillin-resistant Staphylococcus aureus (MRSA) biofilm infections. Expert Opin. Investig. Drugs 2024, 33, 1–3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Milanov, D.; Lazić, S.; Vidić, B.; Petrović, J.; Bugarski, D.; Šeguljev, Z. Slime production and biofilm forming ability by Staphylococcus aureus bovine mastitis isolates. Acta Vet. 2010, 60, 217–226. [Google Scholar] [CrossRef] [Scilit]
- Quave, C.L.; Estevez-Carmona, M.; Compadre, C.M.; Hobby, G.; Hendrickson, H.; Beenken, K.E.; Smeltzer, M.S. Ellagic acid derivatives from Rubus ulmifolius inhibit Staphylococcus aureus biofilm formation and improve response to antibiotics. PLoS ONE 2012, 7, e28737. [Google Scholar] [CrossRef] [Scilit]
- Chusri, S.; Voravuthikunchai, S. Damage of staphylococcal cytoplasmic membrane by Quercus infectoria G. Olivier and its components. Lett. Appl. Microbiol. 2011, 52, 565–572. [Google Scholar] [CrossRef] [Scilit]
- Nourbakhsh, F.; Namvar, A.E. Detection of genes involved in biofilm formation in Staphylococcus aureus isolates. GMS Hyg. Infect. Control 2016, 11, Doc07. [Google Scholar]
- Goerke, C.; Wolz, C. Adaptation of Staphylococcus aureus to the cystic fibrosis lung. Int. J. Med. Microbiol. 2010, 300, 520–525. [Google Scholar] [CrossRef] [Scilit]
- Haaber, J.; Cohn, M.T.; Frees, D.; Andersen, T.J.; Ingmer, H. Planktonic aggregates of Staphylococcus aureus protect against common antibiotics. PLoS ONE 2012, 7, e41075. [Google Scholar] [CrossRef] [Scilit]
- Ammendolia, M.; Di Rosa, R.; Montanaro, L.; Arciola, C.; Baldassarri, L. Slime production and expression of the slime-associated antigen by staphylococcal clinical isolates. J. Clin. Microbiol. 1999, 37, 3235–3238. [Google Scholar] [CrossRef] [Scilit]
- Arciola, C.R.; Baldassarri, L.; Montanaro, L. Presence of icaA and icaD genes and slime production in a collection of staphylococcal strains from catheter-associated infections. J. Clin. Microbiol. 2001, 39, 2151–2156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Majid, B.T.; Hussein, S.A.; Rachid, S.K. Unraveling the molecular regulation of biofilm underlying effect of chronic disease medications. Cell. Mol. Biol. 2024, 70, 15–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kannappan, A.; Balasubramaniam, B.; Ranjitha, R.; Srinivasan, R.; Packiavathy, I.A.S.V.; Balamurugan, K.; Pandian, S.K.; Ravi, A.V. In vitro and in vivo biofilm inhibitory efficacy of geraniol-cefotaxime combination against Staphylococcus spp. Food Chem. Toxicol. 2019, 125, 322–332. [Google Scholar]
- O’Neill, E.; Pozzi, C.; Houston, P.; Humphreys, H.; Robinson, D.A.; Loughman, A.; Foster, T.J.; O’Gara, J.P. A novel Staphylococcus aureus biofilm phenotype mediated by the fibronectin-binding proteins, FnBPA and FnBPB. J. Bacteriol. 2008, 190, 3835–3850. [Google Scholar] [CrossRef] [Scilit]
- Craft, K.M.; Nguyen, J.M.; Berg, L.J.; Townsend, S.D. Methicillin-resistant Staphylococcus aureus (MRSA): Antibiotic-resistance and the biofilm phenotype. MedChemComm 2019, 10, 1231–1241. [Google Scholar] [CrossRef] [Scilit]
- Al-Mathkhury, H.J.F. Estimation the Expression of Glucose-Dependent Biofilm-Encoding icaA and icaD Genes in Methicillin Resistant Staphylococcus aureus Isolates. Iraqi J. Biotechnol. 2025, 24. [Google Scholar]
- O’Neill, E.; Pozzi, C.; Houston, P.; Smyth, D.; Humphreys, H.; Robinson, D.A.; O’Gara, J.P. Association between methicillin susceptibility and biofilm regulation in Staphylococcus aureus isolates from device-related infections. J. Clin. Microbiol. 2007, 45, 1379–1388. [Google Scholar] [CrossRef] [Scilit]
- Kannappan, A.; Gowrishankar, S.; Srinivasan, R.; Pandian, S.K.; Ravi, A.V. Antibiofilm activity of Vetiveria zizanioides root extract against methicillin-resistant Staphylococcus aureus. Microb. Pathog. 2017, 110, 313–324. [Google Scholar] [CrossRef] [Scilit]
- Coelho, L.R.; Souza, R.R.; Ferreira, F.A.; Guimaraes, M.A.; Ferreira-Carvalho, B.T.; Figueiredo, A.M.S. agr RNAIII divergently regulates glucose-induced biofilm formation in clinical isolates of Staphylococcus aureus. Microbiology 2008, 154, 3480–3490. [Google Scholar] [CrossRef] [Scilit]
- Zembower, T.R. Epidemiology of infections in cancer patients. Infect. Complicat. Cancer Patients 2014, 161, 43–89. [Google Scholar]
- Jiang, Y.; Tsoi, L.C.; Billi, A.C.; Ward, N.L.; Harms, P.W.; Zeng, C.; Maverakis, E.; Kahlenberg, J.M.; Gudjonsson, J.E. Cytokinocytes: The diverse contribution of keratinocytes to immune responses in skin. JCI Insight 2020, 5, e142067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plikus, M.V.; Wang, X.; Sinha, S.; Forte, E.; Thompson, S.M.; Herzog, E.L.; Driskell, R.R.; Rosenthal, N.; Biernaskie, J.; Horsley, V. Fibroblasts: Origins, definitions, and functions in health and disease. Cell 2021, 184, 3852–3872. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- D’Errico, M.; Teson, M.; Calcagnile, A.; De Santis, L.P.; Nikaido, O.; Botta, E.; Zambruno, G.; Stefanini, M.; Dogliotti, E. Apoptosis and efficient repair of DNA damage protect human keratinocytes against UVB. Cell Death Differ. 2003, 10, 754–756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arnold, M.; Singh, D.; Laversanne, M.; Vignat, J.; Vaccarella, S.; Meheus, F.; Cust, A.E.; De Vries, E.; Whiteman, D.C.; Bray, F. Global burden of cutaneous melanoma in 2020 and projections to 2040. JAMA Dermatol. 2022, 158, 495–503. [Google Scholar] [CrossRef] [Scilit]
- Naeimi, A.; Tafrihi, M.; Mohadjerani, M. Antioxidant and cytotoxic potentials of the methanolic extract of Teucrium persicum Boiss. in A-375 melanoma cells. Avicenna J. Phytomedicine 2022, 12, 185. [Google Scholar]
- Vega-Bello, M.J.; Moreno, M.L.; Estellés-Leal, R.; Hernández-Andreu, J.M.; Prieto-Ruiz, J.A. Usnea aurantiaco-atra (Jacq) bory: Metabolites and biological activities. Molecules 2023, 28, 7317. [Google Scholar] [CrossRef] [Scilit]
- Arya, V.; Gill, A.K.; Singh, Y.; Acharya, A.; Jamwal, A. The Purified Fraction of Persicaria capitata Flowers Attenuates Proliferation in A-431 Cell Lines. Pharmacogn. Mag. 2025, 09731296251333884. [Google Scholar] [CrossRef] [Scilit]
- Rani, A.; Gupta, T.; Kangra, K.; Garg, V.; Dutt, R. Evaluation of antioxidant, antibacterial and anticancer activity of fruit and leaf extracts of manilkara zapota against a431 skin cancer cell lines. S. Afr. J. Bot. 2023, 153, 219–226. [Google Scholar] [CrossRef] [Scilit]
- Dimitrova, L.; Philipov, S.; Zaharieva, M.M.; Miteva-Staleva, J.; Popova, M.; Tserovska, L.; Krumova, E.; Zhelezova, G.; Bankova, V.; Najdenski, H. In vivo assessment of acute and subacute toxicity of ethyl acetate extract from aerial parts of Geum urbanum L. Biotechnol. Equip. 2021, 35, 61–73. [Google Scholar] [CrossRef] [Scilit]
- Linz, M.S.; Mattappallil, A.; Finkel, D.; Parker, D. Clinical impact of Staphylococcus aureus skin and soft tissue infections. Antibiotics 2023, 12, 557. [Google Scholar] [CrossRef] [Scilit]
- Kullander, J.; Forslund, O.; Dillner, J. Staphylococcus aureus and squamous cell carcinoma of the skin. Cancer Epidemiol. Biomark. Prev. 2009, 18, 472–478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giese, M.A.; Ramakrishnan, G.; Steenberge, L.H.; Dovan, J.X.; Sauer, J.-D.; Huttenlocher, A. Staphylococcus aureus lipid factors modulate melanoma cell clustering and invasion. Dis. Models Mech. 2024, 17, dmm050770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Shabib, N.A.; Husain, F.M.; Ahmad, I.; Baig, M.H. Eugenol inhibits quorum sensing and biofilm of toxigenic MRSA strains isolated from food handlers employed in Saudi Arabia. Biotechnol. Biotechnol. Equip. 2017, 31, 387–396. [Google Scholar] [CrossRef] [Scilit]
- Stepanović, S.; Vuković, D.; Dakić, I.; Savić, B.; Švabić-Vlahović, M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods 2000, 40, 175–179. [Google Scholar] [CrossRef] [Scilit]
- Bekir, K.; Haddad, O.; Grissa, M.; Chaieb, K.; Bakhrouf, A.; Elgarssdi, S.I. Molecular detection of adhesins genes and biofilm formation in methicillin resistant Staphylococcus aureus. Afr J Microbiol Res 2012, 6, 4908–4917. [Google Scholar]
- Theis, T.; Skurray, R.A.; Brown, M.H. Identification of suitable internal controls to study expression of a Staphylococcus aureus multidrug resistance system by quantitative real-time PCR. J. Microbiol. Methods 2007, 70, 355–362. [Google Scholar] [CrossRef] [Scilit]
- ISO 10993-5:2009; Biological Evaluation of Medical Devices—Part 5: Tests for In Vitro Cytotoxicity. ICS 11.100.20. International Organization for Standardization: Geneva, Switzerland, 2009.
- Dineva, I.K.; Zaharieva, M.M.; Konstantinov, S.M.; Eibl, H.; Berger, M.R. Erufosine suppresses breast cancer in vitro and in vivo for its activity on PI3K, c-Raf and Akt proteins. J. Cancer Res. Clin. Oncol. 2012, 138, 1909–1917. [Google Scholar] [CrossRef] [Scilit]
- Yosifov, D.Y.; Konstantinov, S.M.; Berger, M.R. Erucylphospho-N,N,N-trimethylpropylammonium shows substantial cytotoxicity in multiple myeloma cells. Ann. N. Y. Acad. Sci. 2009, 1171, 350–358. [Google Scholar] [CrossRef] [Scilit]
- Yosifov, D.Y.; Todorov, P.T.; Zaharieva, M.M.; Georgiev, K.D.; Pilicheva, B.A.; Konstantinov, S.M.; Berger, M.R. Erucylphospho-N, N, N-trimethylpropylammonium (erufosine) is a potential antimyeloma drug devoid of myelotoxicity. Cancer Chemother. Pharmacol. 2011, 67, 13–25. [Google Scholar] [CrossRef] [Scilit]
- Zaharieva, M.M.; Konstantinov, S.M.; Berger, M.R. The Antineoplastic Activity of Erufosine in a Panel of Leukemia and Lymphoma Cell Lines is Related to Selected Signal Proteins. Int. J. Curr. Chem. 2010, 1, 249–257. [Google Scholar]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chazotte, B. Labeling nuclear DNA with hoechst 33342. Cold Spring Harb. Protoc. 2011, 2011, pdb. prot5557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- ISO 10993-10: 2010; Biological Evaluation of Medical Devices, Part 10: Tests for Irritation and Skin Sensitization. International Organization for Standardization: Geneva, Switzerland, 2010.
- Yoncheva, K.; Benbassat, N.; Zaharieva, M.M.; Dimitrova, L.; Kroumov, A.; Spassova, I.; Kovacheva, D.; Najdenski, H.M. Improvement of the antimicrobial activity of oregano oil by encapsulation in chitosan—Alginate nanoparticles. Molecules 2021, 26, 7017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- ISO 10993-2; I. Biological Evaluation of Medical Devices—Part 2: Animal Welfare Requirements. International Organization for Standardization: Geneva, Switzerland, 2022.
- Ministry of Agriculture and Food. Rule 20 of 1 November 2012 on Minimum Requirements For The Protection And Humane Treatment of Experimental Animals and the Requirements for Their Use, Breeding and/or Delivery; Ministry of Agriculture and Food: Sofia, Bulgaria, 2012.









| Cell Line | Extract | Parameters | |||
|---|---|---|---|---|---|
| IC50 (µg/mL) | CI 95% | R2 | SI | ||
| A-375 | EtOAcAP | 14.68 | 13.60 to 15.83 | 0.99 | 12.55 |
| EtOAcR | 23.67 | 22.20 to 25.24 | 0.99 | 4.08 | |
| A-431 | EtOAcAP | 6.07 | 5.24 to 7.03 | 0.97 | 30.36 |
| EtOAcR | 8.71 | 7.86 to 9.65 | 0.98 | 11.11 | |
| CCL-1 | EtOAcAP | 184.3 | 164.1 to 206.9 | 0.96 | - |
| EtOAcR | 96.73 | 86.84 to 107.7 | 0.97 | - | |
| Primers | Sequences | Tm | Reference |
|---|---|---|---|
| icaA F | ACACTTGCTGGCGCAGTCAA | 69.4 °C | [71] |
| icaA R | TCTGGAACCAACATCCAACA | 64.1 °C | |
| icaD F | ATGGTCAAGCCCAGACAGAG | 64.3 °C | |
| icaD R | AGTATTTTCAATGTTTAAAGCAA | 56.4 °C | |
| rho F | GGAAGATACGACGTTCAGAC | 58.8 | |
| rho R | GAAGCGGGTGGAAGTTTA | 60.3 | [72] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dimitrova, L.; Zaharieva, M.M.; Tserovska, L.; Popova, M.; Bankova, V.; Najdenski, H. Inhibition of the MRSA Biofilm Formation and Skin Antineoplastic Activity of Ethyl Acetate Roots and Aerial Parts Extracts from Geum urbanum L. Antibiotics 2025, 14, 627. https://doi.org/10.3390/antibiotics14070627
Dimitrova L, Zaharieva MM, Tserovska L, Popova M, Bankova V, Najdenski H. Inhibition of the MRSA Biofilm Formation and Skin Antineoplastic Activity of Ethyl Acetate Roots and Aerial Parts Extracts from Geum urbanum L. Antibiotics. 2025; 14(7):627. https://doi.org/10.3390/antibiotics14070627
Chicago/Turabian StyleDimitrova, Lyudmila, Maya M. Zaharieva, Lilia Tserovska, Milena Popova, Vassya Bankova, and Hristo Najdenski. 2025. "Inhibition of the MRSA Biofilm Formation and Skin Antineoplastic Activity of Ethyl Acetate Roots and Aerial Parts Extracts from Geum urbanum L." Antibiotics 14, no. 7: 627. https://doi.org/10.3390/antibiotics14070627
APA StyleDimitrova, L., Zaharieva, M. M., Tserovska, L., Popova, M., Bankova, V., & Najdenski, H. (2025). Inhibition of the MRSA Biofilm Formation and Skin Antineoplastic Activity of Ethyl Acetate Roots and Aerial Parts Extracts from Geum urbanum L. Antibiotics, 14(7), 627. https://doi.org/10.3390/antibiotics14070627

