Scolopax rusticola Carrying Enterobacterales Harboring Antibiotic Resistance Genes
Abstract
1. Introduction
2. Results
2.1. Bacterial Isolation and Identification
2.2. MIC results and ARGs Detection
3. Discussion
4. Materials and Methods
4.1. Sampling and Bacterial Isolation
4.2. MIC Determination
4.3. ARGs Detection
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hahn, S.; Bauer, S.; Liechti, F. The Natural Link between Europe and Africa—2.1 Billion Birds on Migration. Oikos 2009, 118, 624–626. [Google Scholar] [CrossRef]
- Hoodless, A.N. Eurasian Woodcock Scolopax Rusticola. In the Migration Atlas: Movements of the Birds of Britain and Ireland; Wernham, C., Toms, M., Marchant, J.H., Clark, J., Siriwardena, G.M., Baillie, S.R., Eds.; T. & A.D., Poyser: London, UK, 2002. [Google Scholar]
- Hoodless, A.N.; Coulson, J.C. Survival Rates and Movements of British and Continental Woodcock Scolopax Rusticola in the British Isles. Bird Study 1994, 41, 48–60. [Google Scholar] [CrossRef] [Scilit]
- Duriez, O.; Fritz, H.; Binet, F.; Tremblay, Y.; Ferrand, Y. Individual Activity Rates in Wintering Eurasian Woodcocks: Starvation versus Predation Risk Trade-Off? Anim. Behav. 2005, 69, 39–49. [Google Scholar] [CrossRef] [Scilit]
- Spanò, S. Il Punto Sulla Beccaccia; Olimpia: Firenze, Italy, 2001; ISBN 88-253-7108-X. [Google Scholar]
- Yon, L.; Duff, J.P.; Ågren, E.O.; Erdélyi, K.; Ferroglio, E.; Godfroid, J.; Hars, J.; Hestvik, G.; Horton, D.; Kuiken, T.; et al. Recent Changes in Infectious Diseases in European Wildlife. J. Wildl. Dis. 2019, 55, 3. [Google Scholar] [CrossRef] [Scilit]
- Plaza-Rodríguez, C.; Alt, K.; Grobbel, M.; Hammerl, J.A.; Irrgang, A.; Szabo, I.; Stingl, K.; Schuh, E.; Wiehle, L.; Pfefferkorn, B.; et al. Wildlife as Sentinels of Antimicrobial Resistance in Germany? Front. Vet. Sci. 2021, 7, 627821. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Tan, L.; Zhang, H.; Bi, W.; Zhao, L.; Wang, X.; Lu, X.; Xu, X.; Sun, R.; Alvarez, P.J.J. Characteristics of Wild Bird Resistomes and Dissemination of Antibiotic Resistance Genes in Interconnected Bird-Habitat Systems Revealed by Similarity of Bla TEM Polymorphic Sequences. Environ. Sci. Technol. 2022, 56, 15084–15095. [Google Scholar] [CrossRef] [Scilit]
- Ramey, A.M.; Ahlstrom, C.A. Antibiotic Resistant Bacteria in Wildlife: Perspectives on Trends, Acquisition and Dissemination, Data Gaps, and Future Directions. J. Wildl. Dis. 2020, 56, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Reed, K.D.; Meece, J.K.; Henkel, J.S.; Shukla, S.K. Birds, Migration and Emerging Zoonoses: West Nile Virus, Lyme Disease, Influenza A and Enteropathogens. Clin. Med. Res. 2003, 1, 5–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- European Centre for Disease Prevention and Control; World Health Organization. Antimicrobial Resistance Surveillance in Europe 2023—2021 Data; European Centre for Disease Prevention and Control and World Health Organization: Stockholm, Sweden, 2023.
- World Health Organization. Critically Important Antimicrobials for Human Medicine, 6th Revision; World Health Organization: Geneva, Switzerland, 2018.
- Bush, K.; Bradford, P.A. Epidemiology of β-Lactamase-Producing Pathogens. Clin. Microbiol. Rev. 2020, 33, e00047-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sjölund, M.; Bonnedahl, J.; Hernandez, J.; Bengtsson, S.; Cederbrant, G.; Pinhassi, J.; Kahlmeter, G.; Olsen, B. Dissemination of Multidrug-Resistant Bacteria into the Arctic. Emerg. Infect. Dis. 2008, 14, 70–72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martín-Maldonado, B.; Rodríguez-Alcázar, P.; Fernández-Novo, A.; González, F.; Pastor, N.; López, I.; Suárez, L.; Moraleda, V.; Aranaz, A. Urban Birds as Antimicrobial Resistance Sentinels: White Storks Showed Higher Multidrug-Resistant Escherichia Coli Levels Than Seagulls in Central Spain. Animals 2022, 12, 2714. [Google Scholar] [CrossRef] [Scilit]
- Ahlstrom, C.A.; Woksepp, H.; Sandegren, L.; Mohsin, M.; Hasan, B.; Muzyka, D.; Hernandez, J.; Aguirre, F.; Tok, A.; Söderman, J.; et al. Genomically Diverse Carbapenem Resistant Enterobacteriaceae from Wild Birds Provide Insight into Global Patterns of Spatiotemporal Dissemination. Sci. Total Environ. 2022, 824, 153632. [Google Scholar] [CrossRef] [Scilit]
- Yuan, Y.; Liang, B.; Jiang, B.; Zhu, L.; Wang, T.; Li, Y.; Liu, J.; Guo, X.; Ji, X.; Sun, Y. Migratory Wild Birds Carrying Multidrug-Resistant Escherichia Coli as Potential Transmitters of Antimicrobial Resistance in China. PLoS ONE 2021, 16, e0261444. [Google Scholar] [CrossRef] [Scilit]
- Zeballos-Gross, D.; Rojas-Sereno, Z.; Salgado-Caxito, M.; Poeta, P.; Torres, C.; Benavides, J.A. The Role of Gulls as Reservoirs of Antibiotic Resistance in Aquatic Environments: A Scoping Review. Front. Microbiol. 2021, 12, 703886. [Google Scholar] [CrossRef] [Scilit]
- Marcelino, V.R.; Wille, M.; Hurt, A.C.; González-Acuña, D.; Klaassen, M.; Schlub, T.E.; Eden, J.-S.; Shi, M.; Iredell, J.R.; Sorrell, T.C.; et al. Meta-Transcriptomics Reveals a Diverse Antibiotic Resistance Gene Pool in Avian Microbiomes. BMC Biol. 2019, 17, 31. [Google Scholar] [CrossRef] [Scilit]
- Gambino, D.; Vicari, D.; Vitale, M.; Schirò, G.; Mira, F.; Giglia, M.L.; Riccardi, A.; Gentile, A.; Giardina, S.; Carrozzo, A.; et al. Study on Bacteria Isolates and Antimicrobial Resistance in Wildlife in Sicily, Southern Italy. Microorganisms 2021, 9, 203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foti, M.; Giacopello, C.; Bottari, T.; Fisichella, V.; Rinaldo, D.; Mammina, C. Antibiotic Resistance of Gram Negatives Isolates from Loggerhead Sea Turtles (Caretta Caretta) in the Central Mediterranean Sea. Mar. Pollut. Bull. 2009, 58, 1363–1366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giacopello, C.; Foti, M.; Mascetti, A. Antimicrobial Resistance Patterns of Enterobacteriaceae in European Wild Bird Species Admitted in a Wildlife Rescue Centre. Vet. Ital. 2016, 52, 139–144. [Google Scholar] [CrossRef] [Scilit]
- Anand, U.; Reddy, B.; Singh, V.K.; Singh, A.K.; Kesari, K.K.; Tripathi, P.; Kumar, P.; Tripathi, V.; Simal-Gandara, J. Potential Environmental and Human Health Risks Caused by Antibiotic-Resistant Bacteria (ARB), Antibiotic Resistance Genes (ARGs) and Emerging Contaminants (ECs) from Municipal Solid Waste (MSW) Landfill. Antibiotics 2021, 10, 374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bréchet, C.; Plantin, J.; Sauget, M.; Thouverez, M.; Talon, D.; Cholley, P.; Guyeux, C.; Hocquet, D.; Bertrand, X. Wastewater Treatment Plants Release Large Amounts of Extended-Spectrum β-Lactamase-Producing Escherichia Coli into the Environment. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2014, 58, 1658–1665. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernandez, J.; Johansson, A.; Stedt, J.; Bengtsson, S.; Porczak, A.; Granholm, S.; González-Acuña, D.; Olsen, B.; Bonnedahl, J.; Drobni, M. Characterization and Comparison of Extended-Spectrum β-Lactamase (ESBL) Resistance Genotypes and Population Structure of Escherichia Coli Isolated from Franklin’s Gulls (Leucophaeus Pipixcan) and Humans in Chile. PLoS ONE 2013, 8, e76150. [Google Scholar] [CrossRef] [Scilit]
- Gillings, M.R.; Gaze, W.H.; Pruden, A.; Smalla, K.; Tiedje, J.M.; Zhu, Y.-G. Using the Class 1 Integron-Integrase Gene as a Proxy for Anthropogenic Pollution. ISME J. 2015, 9, 1269–1279. [Google Scholar] [CrossRef] [Scilit]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023; ISBN 978-1-68440-171-0. [Google Scholar]
- European Commission Commission Implementing Regulation (EU). 2022/1255 of 19 July 2022 Designating Antimicrobials or Groups of Antimicrobials Reserved for Treatment of Certain Infections in Humans, in Accordance with Regulation (EU) 2019/6 of the European Parliament and of the Council; European Commission Commission Implementing Regulation (EU): Brussels, Belgium, 2022. [Google Scholar]
- European Medicines Agency: Categorisation of Antibiotics…—Google Scholar. Available online: https://scholar.google.com/scholar_lookup?title=Categorisation+of+Antibiotics+in+the+European+Union&author=European+Medicines+Agency+(EMA)&publication_year=2019#d=gs_cit&t=1685977653465&u=%2Fscholar%3Fq%3Dinfo%3AsxN2ntDqljEJ%3Ascholar.google.com%2F%26output%3Dcite%26scirp%3D0%26hl%3Dit (accessed on 5 June 2023).
- Smith, A.; Wayne, A.S.; Fellman, C.L.; Rosenbaum, M.H. Usage Patterns of Carbapenem Antimicrobials in Dogs and Cats at a Veterinary Tertiary Care Hospital. J. Vet. Intern. Med. 2019, 33, 1677–1685. [Google Scholar] [CrossRef] [Scilit]
- Cole, S.D.; Perez-Bonilla, D.; Hallowell, A.; Redding, L.E. Carbapenem Prescribing at a Veterinary Teaching Hospital before an Outbreak of Carbapenem-Resistant Escherichia Coli. J. Small Anim. Pract. 2022, 63, 442–446. [Google Scholar] [CrossRef] [Scilit]
- European Food Safety; European Centre for Disease Prevention and Control (ECDC). The European Union Summary Report on Antimicrobial Resistance in Zoonotic and Indicator Bacteria from Humans, Animals and Food in 2020/2021. EFSA J. 2023, 21, e07867. [Google Scholar] [CrossRef] [Scilit]
- Garavini, E. Beccacce e Beccacciai, 4th ed.; Editoriale Olimpia: Firenze, Italy, 2005; ISBN 978-88-253-0089-5. [Google Scholar]
- Larsson, D.G.J.; Flach, C.-F. Antibiotic Resistance in the Environment. Nat. Rev. Microbiol. 2022, 20, 257–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benavides, J.A.; Godreuil, S.; Opazo-Capurro, A.; Mahamat, O.O.; Falcon, N.; Oravcova, K.; Streicker, D.G.; Shiva, C. Long-Term Maintenance of Multidrug-Resistant Escherichia Coli Carried by Vampire Bats and Shared with Livestock in Peru. Sci. Total Environ. 2022, 810, 152045. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kusi, J.; Ojewole, C.O.; Ojewole, A.E.; Nwi-Mozu, I. Antimicrobial Resistance Development Pathways in Surface Waters and Public Health Implications. Antibiotics 2022, 11, 821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serwecińska, L. Antimicrobials and Antibiotic-Resistant Bacteria: A Risk to the Environment and to Public Health. Water 2020, 12, 3313. [Google Scholar] [CrossRef] [Scilit]
- Murray, C.J.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Robles Aguilar, G.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global Burden of Bacterial Antimicrobial Resistance in 2019: A Systematic Analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Boeckel, T.P.; Pires, J.; Silvester, R.; Zhao, C.; Song, J.; Criscuolo, N.G.; Gilbert, M.; Bonhoeffer, S.; Laxminarayan, R. Global Trends in Antimicrobial Resistance in Animals in Low- and Middle-Income Countries. Science 2019, 365, eaaw1944. [Google Scholar] [CrossRef] [Scilit]
- Gargano, V.; Sciortino, S.; Gambino, D.; Costa, A.; Agozzino, V.; Reale, S.; Alduina, R.; Vicari, D. Antibiotic Susceptibility Profile and Tetracycline Resistance Genes Detection in Salmonella Spp. Strains Isolated from Animals and Food. Antibiotics 2021, 10, 809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giakkoupi, P.; Petrikkos, G.; Tzouvelekis, L.S.; Tsonas, S.; Legakis, N.J.; Vatopoulos, A.C. Spread of Integron-Associated VIM-Type Metallo-β-Lactamase Genes among Imipenem-Nonsusceptible Pseudomonas Aeruginosa Strains in Greek Hospitals. J. Clin. Microbiol. 2003, 41, 822–825. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deekshit, V.K.; Srikumar, S. ‘To Be, or Not to Be’—The Dilemma of ‘Silent’ Antimicrobial Resistance Genes in Bacteria. J. Appl. Microbiol. 2022, 133, 2902–2914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McVey, D.S.; Kennedy, M.; Chengappa, M.M.; Wilkes, R. (Eds.) Veterinary Microbiology, 1st ed.; Wiley: Hoboken, NJ, USA, 2022; ISBN 978-1-119-65075-1. [Google Scholar]
- Takahashi, S.; Tomita, J.; Nishioka, K.; Hisada, T.; Nishijima, M. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing. PLoS ONE 2014, 9, e105592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, X.; Hu, M.; Zhang, Q.; Zhao, C.; Zhang, Y.; Li, L.; Qi, J.; Luo, Y.; Zhou, D.; Liu, Y. Characterization of Integrons and Antimicrobial Resistance in Salmonella from Broilers in Shandong, China. Poult. Sci. 2020, 99, 7046–7054. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hassuna, N.A.; Darwish, M.K.; Sayed, M.; Ibrahem, R.A. Molecular Epidemiology and Mechanisms of High-Level Resistance to Meropenem and Imipenem in Pseudomonas aeruginosa. Infect. Drug Resist. 2020, 13, 285–293. [Google Scholar] [CrossRef] [Scilit]
- Di Cesare, A.; Eckert, E.M.; D’Urso, S.; Bertoni, R.; Gillan, D.C.; Wattiez, R.; Corno, G. Co-Occurrence of Integrase 1, Antibiotic and Heavy Metal Resistance Genes in Municipal Wastewater Treatment Plants. Water Res. 2016, 94, 208–214. [Google Scholar] [CrossRef] [Scilit]

| Antimicrobial Agent | Number of Isolates at the Indicated MIC Value (µg/mL) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0.015 | 0.03 | 0.06 | 0.12 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | 32 | 64 | 128 | 256 | 512 | 1024 | |
| Ampicillin | 5 | 21 | 36 | 4 | 3 | ||||||||||||
| Azithromycin | 69 | ||||||||||||||||
| Cefotaxime | 66 | 3 | |||||||||||||||
| Ceftazidime | 67 | 2 | |||||||||||||||
| Chloramphenicol | 69 | ||||||||||||||||
| Ciprofloxacin | 69 | ||||||||||||||||
| Colistin | 69 | ||||||||||||||||
| Gentamicin | 69 | ||||||||||||||||
| Meropenem | 60 | 9 | |||||||||||||||
| Nalidixic acid | 69 | ||||||||||||||||
| Sulfamethoxazole | 36 | 15 | 7 | 8 | 2 | 1 | |||||||||||
| Tetracycline | 52 | 17 | |||||||||||||||
| Trimethoprim | 66 | 3 | |||||||||||||||
| Strains ID | Bacterial Species | ARGs and int1 Detection |
|---|---|---|
| 23b | Klebsiella oxytoca | blaOXA-1, blaVIM-35, int1 |
| 23c | Enterobacter cloacae | blaIMP-70, int1 |
| 24b | Enterobacter cloacae | blaNDM-5, int1 |
| 32b | Klebsiella oxytoca | blaOXA-1, int1 |
| 40b | Klebsiella oxytoca | blaOXA-1, blaVIM-35 |
| 58b | Enterobacter cloacae | blaNDM-5, int1 |
| 60b | Enterobacter cloacae | blaIMP-70, int1 |
| Target | Primer Sequence (5′-3′) | Annealing Temperature (°C) | Amplicon Size (bp) | References | |
|---|---|---|---|---|---|
| blaTEM | F | ATTCTTGAAGACGAAAGGGC | 60 | 661 | [45] |
| R | ACGCTCAGTGGAACGAAAAC | ||||
| blaCTX-M | F | CTATGGCACCACCAACGATA | 60 | 585 | |
| R | ACGGCTTTCTGCCTTAGGTT | ||||
| blaOXA | F | ACACAATACATATCAACTTCGC | 60 | 590 | |
| R | AGTGTGTTTAGAATGGTGATC | ||||
| blaIMP1 | F | CTACCGCAGCAGAGTCTTTG | 55 | 587 | [46] |
| R | AACCAGTTTTGCCTTACCAT | ||||
| blaIMP2 | F | GTTTTATGTGTATGCTTCC | 55 | 678 | |
| R | AGCCTGTTCCCATGTAC | ||||
| blaVIM1 | F | AGTGGTGAGTATCCGACAG | 55 | 261 | |
| R | ATGAAAGTGCGTGGAGAC | ||||
| blaVIM2 | F | ATGTTCAAACTTTTGAGTAAG | 55 | 801 | |
| R | CTACTCAACGACTGAGCG | ||||
| blaNDM | F | GGTTTGGCGATCTGGTTTTC | 55 | 621 | |
| R | CGGAATGGCTCATCACGATC | ||||
| int1 | F | GGCTTCGTGATGCCTGCTT | 60 | 148 | [47] |
| R | CATTCCTGGCCGTGGTTCT | ||||
| 16S rDNA | F | CGGTGAATACGTTCYCGG | 55 | 142 | |
| R | GGHTACCTTGTTACGACTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gargano, V.; Gambino, D.; Oddo, A.M.; Pizzo, M.; Sucato, A.; Cammilleri, G.; La Russa, F.; Di Pasquale, M.L.; Parisi, M.G.; Cassata, G.; et al. Scolopax rusticola Carrying Enterobacterales Harboring Antibiotic Resistance Genes. Antibiotics 2024, 13, 234. https://doi.org/10.3390/antibiotics13030234
Gargano V, Gambino D, Oddo AM, Pizzo M, Sucato A, Cammilleri G, La Russa F, Di Pasquale ML, Parisi MG, Cassata G, et al. Scolopax rusticola Carrying Enterobacterales Harboring Antibiotic Resistance Genes. Antibiotics. 2024; 13(3):234. https://doi.org/10.3390/antibiotics13030234
Chicago/Turabian StyleGargano, Valeria, Delia Gambino, Adriana Maria Oddo, Mariangela Pizzo, Arianna Sucato, Gaetano Cammilleri, Francesco La Russa, Maria Liliana Di Pasquale, Maria Giovanna Parisi, Giovanni Cassata, and et al. 2024. "Scolopax rusticola Carrying Enterobacterales Harboring Antibiotic Resistance Genes" Antibiotics 13, no. 3: 234. https://doi.org/10.3390/antibiotics13030234
APA StyleGargano, V., Gambino, D., Oddo, A. M., Pizzo, M., Sucato, A., Cammilleri, G., La Russa, F., Di Pasquale, M. L., Parisi, M. G., Cassata, G., & Giangrosso, G. (2024). Scolopax rusticola Carrying Enterobacterales Harboring Antibiotic Resistance Genes. Antibiotics, 13(3), 234. https://doi.org/10.3390/antibiotics13030234

