Next Article in Journal
First Bacteremia Due to Corynebacterium gottingense in an Immunocompromised Child: A Case Report, 16S rDNA-Based Phylogenetic Analyses and Review of the Literature
Next Article in Special Issue
Antibiotic Resistance and Food Safety: Perspectives on New Technologies and Molecules for Microbial Control in the Food Industry
Previous Article in Journal
Analysis of Bacterial Pathogens Causing Complicating HAP in Patients with Secondary Peritonitis
Previous Article in Special Issue
Antimicrobial Resistance Challenged with Platinum(II) and Palladium(II) Complexes Containing 1,10-Phenanthroline and 5-Amino-1,3,4-Thiadiazole-2(3H)-Thione in Campylobacter jejuni
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Serotype Occurrence, Virulence Profiles, Antimicrobial Resistance and Molecular Characterization of Salmonella Isolated from Hospitalized Patients with Gastroenteritis in Great Tunisia between 2010 and 2020

1
Laboratory of Management of Animal Production’s Health and Quality, National School of Veterinary Medicine of Sidi Thabet, University Manouba, La Manouba 2010, Tunisia
2
Departments of Animal Production, National Agronomic Institute, University Carthage, Carthage 1054, Tunisia
3
Laboratory of Parasitology, National School of Veterinary Medicine of Sidi Thabet, University Manouba, La Manouba 2010, Tunisia
4
Laboratory of Parasitology, Veterinary Research Institute, University of Tunis El Manar, Tunis 1068, Tunisia
5
Laboratory of Microorganisms and Environment, Molecular Diagnostic Tools and Emerging and Re-Emerging Infections, Military Hospital of Tunis, University of Tunis El Manar, Tunis 1068, Tunisia
6
Laboratory of Microbiology, National School of Veterinary Medicine of Sidi Thabet, University Manouba, La Manouba 2010, Tunisia
7
Laboratory of Bacteriology, Military Hospital of Tunis, Tunis 1008, Tunisia
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(3), 526; https://doi.org/10.3390/antibiotics12030526
Submission received: 30 December 2022 / Revised: 25 February 2023 / Accepted: 28 February 2023 / Published: 6 March 2023
(This article belongs to the Special Issue Foodborne Pathogens: Features of Virulence and Antibiotic Resistance)

Abstract

Non-typhoid Salmonella is one of the major causes of food-borne infections worldwide. The aim of the current study is to determine the serotype occurrence, virulence factors and antimicrobial resistance patterns of Salmonella isolated from hospitalized patients. The identification of Salmonella strains was performed according to REMIC, 2018. The susceptibility of Salmonella isolates was assessed against 20 antimicrobials using the disk diffusion method. Some virulence and antimicrobial resistance genes were identified using PCR. Among the 61 isolated Salmonella strains, seven serotypes were identified and all were positive for the virulence genes invA, mgtC and sirA. Critical resistance rates (>40%) were detected for tetracycline, nalidixic acid, amoxicillin and fluoroquinolones. However, resistances to ertapenem, ceftazidim, aztreonam and colistin were null. In addition, 33% of the isolated strains were multidrug-resistant (MDR). Moreover, 80% and 60% of S. Kentucky isolates were identified as fluoroquinolone-resistant and MDR strains, respectively. The qnrB gene was amplified in 63.2% of fluoroquinolone-resistant strains. The dfrA1 gene was identified in 20% (4/20) of the trimethoprim-sulfamethoxazole resistant strains and the integrase Class 2 gene was amplified in only 8.2% (5/61) of the isolates. Our findings highlight the emergence of MDR Salmonella isolates. A rationalization of antimicrobial use is urgently recommended in both human and veterinary medicine.

1. Introduction

Non-typhoid Salmonella (NTS) gastroenteritis outbreaks are a major public health problem worldwide [1]. In fact, Salmonella serotypes are considered to be the most common zoonotic food-borne pathogens that can be transmitted to humans through food [2]. In 2019, Salmonellosis was the second-most-reported zoonotic disease in the European Union (EU), affecting about 88,000 people [3]. In the USA, the Centers for Disease Control and Prevention (CDC) estimates that NTS causes more food-borne illnesses than any other bacterium [4]. Chicken is a major source of these illnesses [4]. In fact, about 1 in every 25 packages of chicken at the grocery store is contaminated with Salmonella [4]. Due to the suspected high correlation between salmonellosis in poultry and the number of human infections, Directive 2003/99/EC of the European Parliament and Council requires that the following five serotypes of Salmonella are monitored in poultry flocks: Enteritidis, Typhimurium, Virchow, Hadar and Infantis [5]. In general, contaminated food products (meat, poultry, eggs and dairy) have been reported to be a source of more than 95% NTS gastroenteritis [4]. Symptoms of NTS gastroenteritis include diarrhea, abdominal cramps, fever, vomiting, nausea and headache, which develop within 12 h–72 h and last for 3–7 days [6]. However, up to 5% of the cases may develop invasive extra-intestinal and focal systemic infections requiring effective intravenous (IV) antibiotic therapy or result in death [7]. As a result of extensive and random use of antibiotics in human and veterinary medicine, there has been an alarming increase in the reports that express the spreading of multidrug-resistant (MDR) Salmonella strains [8]. Thus, the World Health Organization has defined Salmonella as a “priority pathogen” and aims to guide and promote research and development into new antibiotics for its treatment [9]. In fact, in children, the elderly and immune-compromised persons, NTS digestive infections may lead to sepsis and meningitis, and even death, associated with therapeutic failure [4]. Multidrug-resistant (MDR) Salmonella strains are an emergent public health worldwide warning [2]. In many African countries, MDR Salmonella strains exhibiting resistance to ciprofloxacin have been reported in several studies [10,11,12]. Since 2002 in Europe, the emergence of ciprofloxacin-resistant Salmonella isolates has been reported among travelers returning from northeast and eastern Africa [13]. In addition, ampicillin, chloramphenicol and trimethoprim/sulfamethoxazole (SXT) are no longer used as primary antimicrobials because of the high resistance rates of NTS to these agents [14]. Third-generation cephalosporin and fluoroquinolone are recommended as first-line antimicrobials in human use; however, there have been several reports of resistance [15,16].
In Tunisia, data are still lacking about MDR Salmonella strains associated with gastroenteritis. The present study aimed to determine the serotype occurrence, virulence factors and antimicrobial resistance patterns of Salmonella strains isolated from hospitalized patients with diarrhea/gastroenteritis in Great Tunisia during the last 11 years (2010–2020).

2. Results

2.1. Occurrence of Salmonella serotypes

Seven serotypes of Salmonella were identified in this study; Salmonella Enteritidis (27.9%; 17/61), S. Typhimurium (26.2%; 16/61) and S. Kentucky (24.6%; 15/61) were the most predominant. However, S. Anatum (8.2%; 5/61), S. Infantis (4.9%; 3/61), S. Muenster (4.9%; 3/61) and S. Mbandaka (3.3%; 2/61) were rarely found.
The subdivision of the strains according to the years of isolation revealed that from 2010 to 2015, it was only the three predominant serovars (S. Enteritidis, S. Typhimurium and S. Kentucky) that were often identified, but from 2016 new serovars appeared, represented in particular by S. Anatum, S. Infantis and S. Muenster.

2.2. Occurrence of Salmonella virulotypes

Analyzed Salmonella strains showed five different virulence factor profiles, namely invA-mgtC-sirA-gipA-pagK (32.8%; 20/61), invA-mgtC-sirA-gipA-pagK-Hli (27.9%; 17/61), invA-mgtC-sirA-pagK-Hli (19.7%; 12/61), invA-mgtC-sirA-pagK (14.7%; 9/61) and invA-mgtC-sirA (4.9%; 3/61). All Salmonella strains (61) were positive for the genes invA (host cell invasion), mgtC (intracellular survival) and sirA (control enteropathogenic functions), and were negative for the virulence genes spvC, trhH, SEN1417, sipA, sipD and sopD (Table 1).

2.3. Antimicrobial Susceptibility Testing

Critical resistance rates were detected for tetracycline (50%; 30/61), nalidixic acid (42.6%; 26/61), amoxicillin (40%; 24/61), fluoroquinolones (ofloxacin (41%; 25/61), norfloxacin (31.2%; 19/61), ciprofloxacin (31.2%; 19/61)), trimethoprim-sulfamethoxazole (33%; 20/61), amoxicillin + clavulanic acid (30%; 18/61) and cefalotin (30%; 18/61). However, resistances to ertapenem, ceftazidim, aztreonam, colistin, gentamicin and amikacin (0%; 0/61) were significantly lower than the other antibiotics (p < 0.05) (Table 2, Figure 1).
In addition, 40% (24/61) of the isolated strains were susceptible to all antibiotics used and 33% (20/61) were multidrug-resistant (MDR). Moreover, 80% (12/15) and 60% (9/15) of S. Kentucky isolates were identified as fluoroquinolone-resistant and MDR strains, respectively (Table 2, Figure 2).
Moreover, the subdivision of the strains according to the years of isolation revealed the presence of a significant increase in the resistance to tetracycline. Indeed, the tetracycline resistance rate increased from 39% (9/23) to 55% (21/38) during the period from 2017 to 2020. However, the resistance rate to nalidixic acid decreased significantly from 60% (14/23) during the period from 2010 to 2016 to 31% (12/38) during the period from 2017 to 2020. For the other antibiotics, no significant differences in resistance rates were recorded.

2.4. Prevalence of Antimicrobial Resistance Genes

Beyond the phenotypic determination, we tested the presence of antimicrobial resistance genes that could have been mediators of antimicrobial resistance in Salmonella spp. The qnrB gene was amplified in 63.2% (12/19) of the fluoroquinolone-resistant strains. The dfrA1 gene was identified in 20% (4/20) of the trimethoprim-sulfamethoxazole resistant strains and the integrase Class 2 gene was amplified in only 8.2% (5/61) of the isolates.

3. Discussion

In the present study, seven Salmonella serotypes were identified, namely S. Enteritidis, S. Typhimurium, S. Kentucky, S. Anatum, S. Infantis, S. Muenster and S. Mbandaka. Three serotypes (S. Enteritidis, S. Typhimurium and S. Kentucky) were significantly predominant (p < 0.05). Our results showed slight similarities with other studies carried out in other countries such as Greece, Ethiopia, Saudi Arabia, India, China and Korea. Indeed, in all of these studies S. Enteritidis and S. Typhimurium were the serovars most implicated in NTS gastroenteritis outbreaks [17,18,19,20,21,22,23]. Moreover, S. Enteritidis and S. Typhimurium are known to be closely associated with broiler flocks, and human infection is generally believed to be derived from poultry and poultry products, including eggs [23,24]. In fact, poultry products are the sources of most NTS food-borne infection cases [2]. In the United States of America, 29% of Salmonella strains causing food-borne illnesses were isolated in poultry meat [4].
On the other hand, the high prevalence rate of S. Kentucky (24.6%; 15/61) revealed by the current study represents a real threat to human health since it is often associated with multidrug resistance to several antibiotics families, as indicated by Turki et al. (2012) [25]. The increased development in the international food trade and the transport of animals from one country to another are factors favoring the rapid dissemination of S. Kentucky in different regions of the world [26]. The global spread of S. Kentucky, especially in Europe, Africa and Asia, has been illustrated by the isolation of a particular epidemic clone (S. Kentucky ST198-X1) in different reservoirs of livestock, especially in poultry, chicken and turkey farms. For this purpose, poultry are considered the main potential vectors of human infection [26,27].
In this investigation, virulence gene screening classified studied strains into five virulotypes of which 100% were positive for invA, mgtC and sirA and negative for the other virulence genes investigated (spvC, trhH, SEN1417, sipA, sipD and sopD). These findings are comparable to the results reported by Capuano et al. (2013) who studied 114 Salmonella strains of human (71/114) and food (43/114) origin. These strains were screened for 12 virulence factors (gipA, gtgB, sopE, sspH1, sspH2, sodC1, gtgE, spvC, pefA, mig5, rck and srgA) and fifty-nine different virulence profiles were identified with the highest homology related to the presence of prophages (gipA, gtgB, sopE, sspH1, sspH2, sodC1 and gtgE), while plasmid genes (spvC, pefA, mig5, rck and srgA) were less detected [8]. Nevertheless, Borah et al. (2021) reported that the virulence genes invA, sipA, sipB, sipC, stn and T2544 were identified in all Salmonella strains (88). These strains had different origins; they were isolated in humans and several animal species. The sopB, sopE, pefA, sefC and fepA genes were present in 2/3 of the strains of human and animal origin. The sefC gene was present in half of the isolated strains. The multitude of the virulence genes of Salmonella highlights the importance of continuous monitoring [28]. In addition, our results revealed that 33% (20/61) of Salmonella strains were multi-resistant to antimicrobials considered of great importance for human and animal health. Moreover, 80% (12/15) and 60% (9/15) of S. Kentucky isolates were identified as fluoroquinolone-resistant and MDR strains, respectively. This serotype, commonly isolated from poultry carcasses, was reported as being MDR too [29]. In fact, according to the current study, critical resistance rates (>40%) were detected for tetracycline, nalidixic acid, fluoroquinolones, amoxicillin and trimethoprim-sulfamethoxazole. The spread of Salmonella with antimicrobial resistance is principally promoted by the use of antibiotics in animal feed to promote the growth of food animals, and in veterinary medicine to treat bacterial infections in those animals [30]. This poses a high risk of zoonotic disease with the transmission of MDR Salmonella strains from animals to humans via the ingestion of food or water contaminated with the animals’ feces, direct contact or the consumption of infected food animals [31].
Moreover, qnrB and dfrA1 genes were amplified in 63.2% (12/19) and 20% (4/20) of the fluoroquinolones and trimethoprim-sulfamethoxazole resistant strains, respectively. In the present study, phenotypic resistance is not covered by the occurrence of genes because resistance to an antimicrobial can be linked to different genes, but we cannot test all of these genes. In fact, antibiotic-resistant genes in Salmonella spp. induce resistance against common antibiotics. Salmonella spp. could obtain resistance to antibiotics through various mechanisms, such as chromosomal mutations, resistance transmission through genetic materials (mostly by plasmids), reduction in cell wall permeability to antibiotics, enzymatic inactivation of antibiotics, efflux pump mechanism for taking out antibiotics and the altered target position of antibiotics [32]. Our findings do not corroborate with the results of Borah et al. (2021), indicating high rates of resistance (more than 60%) to ampicillin, tetracycline and cefotaxime and moderate resistance rates (almost 10%) to ceftriaxon, chloramphenicol, ciprofloxacin and cefepim in 88 Salmonella strains. blaTEM, tetA and dfrA12 resistance genes were the most prevalent; they were isolated in strains of different origin [28]. Moreover, according to the current study, the subdivision of the strains according to the years of isolation revealed the presence of a significant increase in the resistance to tetracycline. Indeed, the tetracycline resistance rate increased from 39% (9/23) to 55% (21/38) during the period from 2017 to 2020. However, the resistance rate to nalidixic acid decreased significantly from 60% (14/23) during the period from 2010 to 2016 to 31% (12/38) during the period from 2017 to 2020. For the other antibiotics, no significant difference in resistance rates was recorded.
Then, according to the present study and other reports [33,34,35], extended-spectrum cephalosporines (especially ceftriaxon), aztreonam and ertapenem, should be suggested as the drugs of choice for treating patients with serious NTS infections. In addition, clinicians should be vigilant toward the emergence of MDR Salmonella strains with decreased susceptibility to extended-spectrum cephalosporines. Nevertheless, the prevention of NTS gastroenteritis requires the vigorous application of hygienic good practices regarding hands, food and healthcare management which is firmly the most efficient strategy to deal with infections and limit the spread of antimicrobial resistance [33].

4. Materials and Methods

4.1. Sample Collection and Salmonella Identification

A total of 61 Salmonella strains were isolated from hospitalized patients with gastroenteritis at a university hospital in Great Tunisia between 2010 and 2020. The isolation of Salmonella from the selective enrichment SX2 broth (bioMérieux SA, Lyon, France) previously inoculated by a clinical specimen and incubated at 37 °C for 24 h, on selective agar (XLD and SS) (Biokar Diagnostics, Beauvais, France), was conducted following the reference technique indicated in REMIC, 2018 [36]. The identification and confirmation of Salmonella strains were performed via the urease test followed by the API 20E system test (bioMérieux SA, Lyon, France) according to the reference technique indicated in REMIC, 2018 [36].

4.2. Salmonella Strain Serotyping

Serotyping was carried out on Salmonella isolates according to the White–Kauffmann-Le Minor scheme [37]. Slide agglutination tests were performed with specific immune sera against O, H and Vi Salmonella antigens (BioRad, Marne-La-Coquette, France).

4.3. Molecular Study

Salmonella genomic DNA extraction was performed from the selective enrichment SX2 broth (bioMérieux SA, Lyon, France) according to the manufacturer’s guidelines using the ONE-4-ALL GENOMIC DNA Mini-Preps Kit (Bio Basic, Markham, Canada). Salmonella genomic DNA was stored at −20 °C until it was used.
The specific primers (F-5’ACCACGCTCTTTCGTCTGG3’ and R-5GAACTGACTACGTAGACGCTC3’) [11] were used for Salmonella molecular confirmation and all isolates were tested for 12 invasion and virulence genes (Table 3).
The PCR was conducted in a total reaction volume of 25 µL consisting of 1 U Taq Polymerase, 1.5 mM MgCl2, 0.1 mM dNTPs, 1 µM forward and reverse primer (Bio Basic, Markham, ON, Canada), 1x PCR buffer (5 mM KCl Tris-HCl, pH 8.5) and 1 µL of DNA. The first denaturation was conducted at 95 °C for 10 min followed by 35 cycles (denaturation for 1 min at 95 °C, annealing for 1 min at different temperatures according to the target gene and elongation for 1 min at 72 °C) and the last elongation was performed for 10 min at 72 °C. All of the PCR reactions were performed in an Esco Swift Max Pro thermocycler (Horsham PA, USA).
The primers (Bio Basic, Markham, Canada) used for detecting virulence and the antimicrobial resistance genes of Salmonella are listed in Table 3 and Table 4.
Gene amplicons were visualized in 1.5% agarose gel stained with ethidium bromide and photographed under UV transilluminate. Positive and negative controls represented by Salmonella strains isolated in a previous study [27,52] and distilled sterile water were added in each PCR run, respectively.

4.4. Antimicrobial Susceptibility Testing and Identification of Antimicrobial Resistance Genes

The antimicrobial susceptibility tests were performed using the agar disc diffusion method on Mueller–Hinton agar (Bio-Rad, Marne-La-Coquette, France) plates. Salmonella isolated strains were examined for their susceptibility to 20 antibiotic discs (Bio-Rad, Marne-La-Coquette, France). The inhibition zone was measured to survey the resistance or the susceptibility according to the interpretation criteria established by the Antibiogram Committee of the French Society for Microbiology [53]. The Colispot test was performed for detecting colistin resistance. The resistant Salmonella strains were revealed by the absence of an inhibition zone after an application of a single drop of 8 mg/L colistin solution on previously inoculated Mueller–Hinton agar [54]. The screening of resistance genes beta-lactams (blaTEM, blaNDM1 and blaCTX-M), fluoroquinolones (qnrB), tetracycline (tet(A) and tet(B)), trimethoprim (dfrA1) and colistin (mcr-1 to mcr-5) indicated in Table 4 [40,41,42,43,44,45,46,47] was carried out by performing PCRs as described above. Class 1 and Class 2 integrons were screened in all of the Salmonella isolated strains using primers described by Mazel et al. (2000) [51].

4.5. Statistical Analysis

Salmonella serotypes, virulotypes and antimicrobial resistance percentages were compared using Epi Info 6 with the Mantel Haenszel chi-square test. Observed differences were considered significant when the p value was lower than 0.05.

5. Conclusions

The current study reported the predominance of three serovars represented by S. Enteritidis, S. Typhimurium and S. Kentucky in isolated Salmonella strains from hospitalized patients with gastroenteritis in Great Tunisia between 2010 and 2020. In addition, more than half of the S. Kentucky isolates were identified as being fluoroquinolone-resistant and MDR strains. Moreover, high resistance rates were detected for tetracycline, nalidixic acid, fluoroquinolones, amoxicillin and trimethoprim-sulfamethoxazole. However, resistance rates to cephalosporines 3/4G, ertapenem, aztreonam, colistin, gentamicin and amikacin were usually lower than 5%. Our findings highlight the emergence of multidrug-resistant Salmonella isolates in Tunisia with decreased susceptibility to many antimicrobials. To this end, a rationalization of antimicrobial use is urgently recommended in both human and veterinary medicine.

Author Contributions

This work was carried out in collaboration with all authors; W.O., M.R.R., M.J., M.S.E.A., F.B. and A.E. designed the experimental procedures; W.O., M.R.R., H.B., F.S. and R.S. conducted the experimental analysis; W.O., M.R.R. and R.S. analyzed the data and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Laboratory of Management of Animal Production’s Health and Quality, National School of Veterinary Medicine of Sidi Thabet, Univ. Manouba, Tunisia (LR14AGR03).

Institutional Review Board Statement

This study was approved by the Local Committee for the Protection of Persons (LCPPs), Military Hospital of Tunis, Tunisia (Approval Code: 07/2022/CLPP/Military Hospital of Tunis; Approval Date: 21 February 2022).

Informed Consent Statement

Not applicable.

Data Availability Statement

The study did not report any data.

Acknowledgments

We would like to express our gratitude to Ridha BEN AISSA and to all of the staff of the Laboratory of Food and Water Control (Pasteur Institute of Tunis (Tunisia)) for their precious help in the development of this work.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Najjar, Z.; Furlong, C.; Stephens, N.; Shadbolt, C.; Maywood, P.; Conaty, S.; Hogg, G. An outbreak of Salmonella Infantis gastroenteritis in a residential aged care facility associated with thickened fluids. Epidemiol. Infect. 2012, 140, 2264–2272. [Google Scholar] [CrossRef] [PubMed]
  2. Penha Filho, R.A.C.; Ferreira, J.C.; Kanashiro, A.M.I.; Berchieri Junior, A.; da Costa Darini, A.L. Emergent multidrug-resistant nontyphoidal Salmonella serovars isolated from poultry in Brazil coharboring blaCTX-M-2 and qnrB or blaCMY-2 in large plasmids. Diagn. Microbiol. Infect. Dis. 2019, 95, 93–98. [Google Scholar] [CrossRef] [PubMed]
  3. EFSA. The European Union Summary Report on Antimicrobial Resistance in Zoonotic and Indicator Bacteria from Humans, Animals and Food in 2019–2020; Wiley: Hoboken, NJ, USA, 2022; Volume 20. [Google Scholar]
  4. Centers for Disease Control and Prevention Centers for Disease Control and PreventionGonorrhea. Available online: http://www.cdc.gov/std/gonorrhea/stdfact-gonorrhea.htm (accessed on 16 October 2022).
  5. Lapierre, L.; Cornejo, J.; Zavala, S.; Galarce, N.; Sánchez, F.; Benavides, M.B.; Guzmán, M.; Sáenz, L. Phenotypic and genotypic characterization of virulence factors and susceptibility to antibiotics in salmonella infantis strains isolated from chicken meat: First findings in Chile. Animals 2020, 10, 1049. [Google Scholar] [CrossRef] [PubMed]
  6. Van Velsen, L.; Beaujean, D.J.M.A.; Van Gemert-Pijnen, J.E.W.C.; Van Steenbergen, J.E.; Timen, A. Public knowledge and preventive behavior during a large-scale Salmonella outbreak: Results from an online survey in The Netherlands. BMC Public Health 2014, 14, 100. [Google Scholar] [CrossRef] [PubMed]
  7. Parry, C.M.; Thomas, S.; Aspinall, E.J.; Cooke, R.P.D.; Rogerson, S.J.; Harries, A.D.; Beeching, N.J. A retrospective study of secondary bacteraemia in hospitalised adults with community acquired non-typhoidal Salmonella gastroenteritis. BMC Infect. Dis. 2013, 13, 107. [Google Scholar] [CrossRef] [PubMed]
  8. Capuano, F.; Mancusi, A.; Capparelli, R.; Esposito, S.; Proroga, Y.T.R. Characterization of Drug Resistance and Virulotypes of Salmonella Strains Isolated from Food and Humans. Foodborne Pathog. Dis. 2013, 10, 963–968. [Google Scholar] [CrossRef]
  9. Castro-vargas, R.E.; Herrera-sánchez, M.P.; Rodríguez-hernández, R. Antibiotic resistance in Salmonella spp. isolated from poultry: A global overview. Vetreinary World 2020, 13, 2070–2084. [Google Scholar] [CrossRef]
  10. Aragaw, K.; Molla, B.; Muckle, A.; Cole, L.; Wilkie, E.; Poppe, C.; Kleer, J.; Hildebrandt, G. The characterization of Salmonella serovars isolated from apparently healthy slaughtered pigs at Addis Ababa abattoir, Ethiopia. Prev. Vet. Med. 2007, 82, 252–261. [Google Scholar] [CrossRef]
  11. Karraouan, B.; Fassouane, A.; El Ossmani, H.; Cohen, N.; Charafeddine, O.; Bouchrif, B. Prevalence and virulence genes of Salmonella in raw minced meat from turkey in Casablanca, Morocco. Rev. Med. Vet. 2010, 161, 127–132. [Google Scholar]
  12. Oueslati, W.; Ridha Rjeibi, M.; Ettriqui, A.; Zrelli, S. Serotypes, Virulence and Antibiotic Susceptibility of Salmonella Spp. Strains, Isolated from Poultry Meat Cutting Parts in Greater Tunis (Tunisia). J. Food Nutr. Disord. 2017, 6, 154–159. [Google Scholar] [CrossRef]
  13. Collard, J.-M.; Place, S.; Denis, O.; Rodriguez-Villalobos, H.; Vrints, M.; Weill, F.-X.; Baucheron, S.; Cloeckaert, A.; Struelens, M.; Bertrand, S. Travel-acquired salmonellosis due to Salmonella Kentucky resistant to ciprofloxacin, ceftriaxone and co-trimoxazole and associated with treatment failure. J. Antimicrob. Chemother. 2007, 60, 190–192. [Google Scholar] [CrossRef]
  14. Biedenbach, D.J.; Toleman, M.; Walsh, T.R.; Jones, R.N. Analysis of Salmonella spp. with resistance to extended-spectrum cephalosporins and fluoroquinolones isolated in North America and Latin America: Report from the SENTRY Antimicrobial Surveillance Program (1997-2004). Diagn. Microbiol. Infect. Dis. 2006, 54, 13–21. [Google Scholar] [CrossRef] [PubMed]
  15. Guerrant, R.L.; Van Gilder, T.; Slutsker, L.; Tauxe, R.V.; Hennessy, T.; Griffin, P.M.; Pickering, L.K.; Steiner, T.S.; Thielman, N.M.; DuPont, H.; et al. Practice guidelines for the management of infectious diarrhea. Clin. Infect. Dis. 2001, 32, 331–351. [Google Scholar] [CrossRef] [PubMed]
  16. Krueger, A.L.; Greene, S.A.; Barzilay, E.J.; Henao, O.; Vugia, D.; Hanna, S.; Meyer, S.; Smith, K.; Pecic, G.; Hoefer, D.; et al. Clinical outcomes of nalidixic acid, ceftriaxone, and multidrug-resistant nontyphoidal salmonella infections compared with pansusceptible infections in FoodNet sites, 2006–2008. Foodborne Pathog. Dis. 2014, 11, 335–341. [Google Scholar] [CrossRef] [PubMed]
  17. Maraki Samonis E Mantadakis E Nioti Y Tselentis, S.G. Serotype distribution and antimicrobial resistance of Salmonella enterica from patients with gastroenteritis in Crete, Greece. Eur. J. Clin. Microbiol. Infect. Dis. 2006, 25, 116–119. [Google Scholar] [CrossRef]
  18. Eguale, T.; Gebreyes, W.A.; Asrat, D.; Alemayehu, H.; Gunn, J.S.; Engidawork, E. Non-typhoidal Salmonella serotypes, antimicrobial resistance and co-infection with parasites among patients with diarrhea and other gastrointestinal complaints in Addis Ababa, Ethiopia. BMC Infect. Dis. 2015, 15, 497. [Google Scholar] [CrossRef] [PubMed]
  19. Jain, P.; Chowdhury, G.; Samajpati, S.; Basak, S.; Ganai, A.; Samanta, S.; Okamoto, K.; Mukhopadhyay, A.K.; Dutta, S. Characterization of non-typhoidal Salmonella isolates from children with acute gastroenteritis, Kolkata, India, during 2000–2016. Braz. J. Microbiol. 2020, 51, 623–627. [Google Scholar] [CrossRef]
  20. Li, Y.; Xie, X.; Xu, X.; Wang, X.; Chang, H.; Wang, C.; Wang, A.; He, Y.; Yu, H.; Wang, X.; et al. Nontyphoidal Salmonella Infection in Children with Acute Gastroenteritis: Prevalence, Serotypes, and Antimicrobial Resistance in Shanghai, China. Foodborne Pathog. Dis. 2014, 11, 200–206. [Google Scholar] [CrossRef]
  21. Woh, P.Y.; Yeung, M.P.S.; Goggins, W.B.; Lo, N.; Wong, K.T.; Chow, V.; Chau, K.Y.; Fung, K.; Chen, Z.; Ip, M. Genomic Epidemiology of Multidrug-Resistant Nontyphoidal Salmonella in Young Children Hospitalized for Gastroenteritis. Microbiol. Spectr. 2021, 9, e0024821. [Google Scholar] [CrossRef]
  22. Yoon, K.B.; Song, B.J.; Shin, M.Y.; Lim, H.C.; Yoon, Y.H.; Jeon, D.Y.; Ha, H.; Yang, S.I.; Kim, J.B. Antibiotic Resistance Patterns and Serotypes of Salmonella spp. Isolated at Jeollanam-do in Korea. Osong Public Health Res. Perspect. 2017, 8, 211–219. [Google Scholar] [CrossRef]
  23. Elhadi, N.; Aljindan, R.; Aljeldah, M. Infection and Drug Resistance Dovepress Prevalence of nontyphoidal Salmonella serogroups and their antimicrobial resistance patterns in a university teaching hospital in eastern Province of saudi arabia. Infect. Drug Resist. 2013, 2013, 199–205. [Google Scholar] [CrossRef] [PubMed][Green Version]
  24. Olsen, S.J.; Bishop, R.; Brenner, F.W.; Roels, T.H.; Bean, N.; Tauxe, R.V.; Slutsker, L. The changing epidemiology of salmonella: Trends in serotypes isolated from humans in the United States, 1987–1997. J. Infect. Dis. 2001, 183, 753–761. [Google Scholar] [CrossRef] [PubMed]
  25. Cheung, P.Y.; Kam, K.M. Salmonella in food surveillance: PCR, immunoassays, and other rapid detection and quantification methods. Food Res. Int. 2012, 45, 802–808. [Google Scholar] [CrossRef]
  26. Antunes, P.; Mourão, J.; Campos, J.; Peixe, L. Salmonellosis: The role of poultry meat. Clin. Microbiol. Infect. 2016, 22, 110–121. [Google Scholar] [CrossRef]
  27. Oueslati, W.; Rjeibi, M.R.; Benyedem, H.; Mamlouk, A.; Souissi, F.; Selmi, R.; Ettriqui, A.; Archambault, M.; Rhouma, M.; Butaye, P. Prevalence, Risk Factors, Antimicrobial Resistance and Molecular Characterization of Salmonella in Northeast Tunisia Broiler Flocks. Vet. Sci. 2022, 9, 12. [Google Scholar] [CrossRef] [PubMed]
  28. Borah, P.; Dutta, R.; Das, L.; Hazarika, G.; Choudhury, M.; Deka, N.K.; Malakar, D.; Hussain, M.I.; Barkalita, L.M. Prevalence, antimicrobial resistance and virulence genes of Salmonella serovars isolated from humans and animals. Vet. Res. Commun. 2022, 46, 799–810. [Google Scholar] [CrossRef] [PubMed]
  29. Tasmin, R.; Hasan, N.A.; Grim, C.J.; Grant, A.; Choi, S.Y.; Alam, M.S.; Bell, R.; Cavanaugh, C.; Balan, K.V.; Babu, U.S.; et al. Genotypic and phenotypic characterization of multidrug resistant Salmonella Typhimurium and Salmonella Kentucky strains recovered from chicken carcasses. PLoS ONE 2017, 12, e0176938. [Google Scholar] [CrossRef] [PubMed]
  30. Vidovic, N.; Vidovic, S. Antimicrobial Resistance and Food Animals: Influence of Livestock Environment on the Emergence and Dissemination of Antimicrobial Resistance. Antibiotics 2020, 9, 52. [Google Scholar] [CrossRef]
  31. Eng, S.K.; Pusparajah, P.; Ab Mutalib, N.S.; Ser, H.L.; Chan, K.G.; Lee, L.H. Salmonella: A review on pathogenesis, epidemiology and antibiotic resistance. Front. Life Sci. 2015, 8, 284–293. [Google Scholar] [CrossRef]
  32. Sales, A.J.; Naebi, S. The Antibiotic Resistance Pattern and Prevalence of bla TEM, bla SHV, bla CTX-M, bla PSE-1, sip B C, and cml A/tet R Genes in Salmonella typhimurium Isolated from Children with Diarrhea in Tabriz, Iran. Int. J. Health Life Sci. 2021, 7, e118523. [Google Scholar] [CrossRef]
  33. Hung, Y.T.; Lay, C.J.; Wang, C.L.; Koo, M. Characteristics of nontyphoidal Salmonella gastroenteritis in Taiwanese children: A 9-year period retrospective medical record review. J. Infect. Public Health 2017, 10, 518–521. [Google Scholar] [CrossRef] [PubMed]
  34. Wu, L.J.; Luo, Y.; Shi, G.L.; Li, Z.Y. Prevalence, Clinical Characteristics and Changes of Antibiotic Resistance in Children with Nontyphoidal Salmonella Infections from 2009–2018 in Chongqing, China. Infect. Drug Resist. 2021, 14, 1403. [Google Scholar] [CrossRef] [PubMed]
  35. Fernández, J.; Guerra, B.; Rodicio, M.R. Resistance to Carbapenems in Non-Typhoidal Salmonella enterica Serovars from Humans, Animals and Food. Vet. Sci. 2018, 5, 40. [Google Scholar] [CrossRef] [PubMed]
  36. REMIC 6.2 Catalogue en Ligne. Available online: https://documentation.le04.fr/index.php?lvl=notice_display&id=31782 (accessed on 16 September 2022).
  37. Popoff, M.Y.; Bockemühl, J.; Gheesling, L.L. Supplement 2001 (no. 45) to the Kauffmann-White scheme. Res. Microbiol. 2003, 154, 173–174. [Google Scholar] [CrossRef]
  38. Raffatellu, M.; Wilson, R.P.; Chessa, D.; Andrews-Polymenis, H.; Tran, Q.T.; Lawhon, S.; Khare, S.; Adams, L.G.; Bäumler, A.J. SipA, SopA, SopB, SopD, and SopE2 contribute to Salmonella enterica serotype typhimurium invasion of epithelial cells. Infect. Immun. 2005, 73, 146–154. [Google Scholar] [CrossRef] [PubMed]
  39. Pan, Z.; Carter, B.; Núñez-García, J.; AbuOun, M.; Fookes, M.; Ivens, A.; Woodward, M.J.; Anjum, M.F. Identification of genetic and phenotypic differences associated with prevalent and non-prevalent Salmonella Enteritidis phage types: Analysis of variation in amino acid transport. Microbiology 2009, 155, 3200–3213. [Google Scholar] [CrossRef]
  40. Huehn, S.; La Ragione, R.M.; Anjum, M.; Saunders, M.; Woodward, M.J.; Bunge, C.; Helmuth, R.; Hauser, E.; Guerra, B.; Beutlich, J.; et al. Virulotyping and antimicrobial resistance typing of salmonella enterica serovars relevant to human health in Europe. Foodborne Pathog. Dis. 2010, 7, 523–535. [Google Scholar] [CrossRef]
  41. Shah, D.H.; Zhou, X.; Addwebi, T.; Davis, M.A.; Orfe, L.; Call, D.R.; Guard, J.; Besser, T.E. Cell invasion of poultry-associated salmonella enterica serovar enteritidis isolates is associated with pathogenicity, motility and proteins secreted by the type III secretion system. Microbiology 2011, 157, 1428–1445. [Google Scholar] [CrossRef]
  42. Malorny, B.; Hoorfar, J.; Bunge, C.; Helmuth, R. Multicenter validation of the analytical accuracy of salmonella PCR: Towards an international standard. Appl. Environ. Microbiol. 2003, 69, 290–296. [Google Scholar] [CrossRef]
  43. Abouzeed, Y.M.; Hariharan, H.; Poppe, C.; Kibenge, F.S.B. Characterization of Salmonella isolates from beef cattle, broiler chickens and human sources on prince Edward Island. Comp. Immunol. Microbiol. Infect. Dis. 2000, 23, 253–266. [Google Scholar] [CrossRef][Green Version]
  44. Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
  45. Colom, K.; Pérez, J.; Alonso, R.; Fernández-Aranguiz, A.; Lariño, E.; Cisterna, R. Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiol. Lett. 2003, 223, 147–151. [Google Scholar] [CrossRef]
  46. Mulvey, M.R.; Soule, G.; Boyd, D.; Demczuk, W.; Ahmed, R. Characterization of the first extended-spectrum beta-lactamase-producing Salmonella isolate identified in Canada. J. Clin. Microbiol. 2003, 41, 460–462. [Google Scholar] [CrossRef] [PubMed]
  47. Robicsek, A.; Strahilevitz, J.; Jacoby, G.A.; Macielag, M.; Abbanat, D.; Chi, H.P.; Bush, K.; Hooper, D.C. Fluoroquinolone-modifying enzyme: A new adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 2006, 12, 83–88. [Google Scholar] [CrossRef] [PubMed]
  48. Pfeifer, Y.; Wilharm, G.; Zander, E.; Wichelhaus, T.A.; Göttig, S.; Hunfeld, K.-P.; Seifert, H.; Witte, W.; Higgins, P.G. Molecular characterization of blaNDM-1 in an Acinetobacter baumannii strain isolated in Germany in 2007. J. Antimicrob. Chemother. 2011, 66, 1998–2001. [Google Scholar] [CrossRef]
  49. Torkan, S.; Bahadoranian, M.A.; Khamesipour, F.; Anyanwu, M.U. Detection of Virulence and Antimicrobial Resistance Genes in Escherichia Coli Isolates from Diarrhoiec dogs in Iran Detección de Virulencia y Genes de Resistencia Antimicrobiana en Aislados de Escherichia Coli Provenientes de Perros en Irán. Arch. Med. Vet. 2016, 48, 181–200. [Google Scholar] [CrossRef]
  50. Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance 2018, 23, 17-00672. [Google Scholar] [CrossRef]
  51. Mazel, D.; Dychinco, B.; Webb, V.A.; Davies, J. Antibiotic resistance in the ECOR collection: Integrons and identification of a novel aad gene. Antimicrob. Agents Chemother. 2000, 44, 1568–1574. [Google Scholar] [CrossRef]
  52. Oueslati, W.; Rjeibi, M.R.; Mhadhbi, M.; Jbeli, M.; Zrelli, S.; Ettriqui, A. Prevalence, virulence and antibiotic susceptibility of Salmonella spp. strains, isolated from beef in Greater Tunis (Tunisia). Meat Sci. 2016, 119, 154–159. [Google Scholar] [CrossRef]
  53. Comité de l’Antibiograme de la Société Française de Microbiologie. Available online: https://www.sfm-microbiologie.org/boutique/comite-de-lantibiograme-de-la-sfm-casfm/ (accessed on 16 September 2022).
  54. Jouy, E.; Haenni, M.; Le Devendec, L.; Le Roux, A.; Châtre, P.; Madec, J.Y.; Kempf, I. Improvement in routine detection of colistin resistance in E. coli isolated in veterinary diagnostic laboratories. J. Microbiol. Methods 2017, 132, 125–127. [Google Scholar] [CrossRef]
Figure 1. Antimicrobial-resistant percentages in Salmonella strains isolated from hospitalized patients with gastroenteritis in Great Tunisia between 2010 and 2020. AMX: Amoxicillin, AUC: Amoxicillin + Clavulanic acid, CEF: Cefalotin, FOX: Cefoxitin, CAZ: Ceftazidim, CTX: Cefotaxim, CRO: Ceftriaxon, CPM: Cefepim, ATM: Aztreonam, ETP: Ertapenem, GME: Gentamicin, CS50: Colistin, NA: Nalidixic acid, OFL: Ofloxacin, CIP: Ciprofloxacin, NFL: Norfloxacin, C: Chloramphenicol, TE: Tetracycline, SXT: Trimethoprim-Sulfamethoxazole and AMK: Amikacin.
Figure 1. Antimicrobial-resistant percentages in Salmonella strains isolated from hospitalized patients with gastroenteritis in Great Tunisia between 2010 and 2020. AMX: Amoxicillin, AUC: Amoxicillin + Clavulanic acid, CEF: Cefalotin, FOX: Cefoxitin, CAZ: Ceftazidim, CTX: Cefotaxim, CRO: Ceftriaxon, CPM: Cefepim, ATM: Aztreonam, ETP: Ertapenem, GME: Gentamicin, CS50: Colistin, NA: Nalidixic acid, OFL: Ofloxacin, CIP: Ciprofloxacin, NFL: Norfloxacin, C: Chloramphenicol, TE: Tetracycline, SXT: Trimethoprim-Sulfamethoxazole and AMK: Amikacin.
Antibiotics 12 00526 g001
Figure 2. Proportion of MDR Salmonella strains according to predominant serotypes.
Figure 2. Proportion of MDR Salmonella strains according to predominant serotypes.
Antibiotics 12 00526 g002
Table 1. Serotypes and virulence genes of Salmonella isolated in the present study.
Table 1. Serotypes and virulence genes of Salmonella isolated in the present study.
Serotypes
(%)
Strains Virulence Genes (a)
invAmgtCsirAgipApagKhlitrhHspvCsipAsipDsopDSEN 1417
S. Enteritidis
27.9% (17/61)
600/20+++++-------
645/19+++-++------
888/19+++++-------
644/18+++++-------
697/18+++-++------
148/17+++++-------
323/17+++++-------
1102/17+++++-------
1456/16+++++-------
984/14+++-+-------
29/12+++++-------
732/12+++++-------
735/12+++++-------
2157/12+++-+-------
621/11+++++-------
1038/11+++++-------
1749/10+++++-------
S. Typhimurium
26.2% (16/61)
17/20+++-+-------
18/20++++++------
828/19+++-++------
1007/18+++-++------
1017/18++++++------
211/17+++-++------
859/17++++++------
860/17++++++------
861/17++++++------
862/17++++++------
863/17++++++------
880/17+++-++------
881/17++++++------
1103/17+++-++------
1523/12++++++------
2156/12++++++------
S. Kentucky
24.6% (15/61)
319/20++++++------
981/19++++++------
69/18+++-++------
322/17+++++-------
1212/17+++++-------
1213/17++++++------
1278/17++++++------
390/16+++-++------
1457/16++++++------
1821/15++++++------
774/13++++++------
1114/12+++-++------
1119/12+++-++------
171/11+++-++------
622/11+++---------
S. Anatum
8.2% (5/61)
333/20+++-+-------
598/18+++-+-------
1268/17+++++-------
391/16+++++-------
1750/10+++---------
S. Infantis
4.9% (3/61)
17/18+++-+-------
684/18+++-+-------
1006/18+++-+-------
S. Muenster
4.9% (3/61)
1210/17+++-+-------
1211/17+++++-------
1093/16+++---------
S. Mbandaka
3.3% (2/61)
226/18+++++-------
804/15 +++++-------
(a) +: present; -: absent.
Table 2. Serotypes and antimicrobial resistance profiles of Salmonella isolated in the present study.
Table 2. Serotypes and antimicrobial resistance profiles of Salmonella isolated in the present study.
Serotypes
(%)
StrainsAntibiotic Resistance Profiles (a)
AMXAUCCEFCAZCTXATMCROCPMFOX ETPNANFLCIPOFLTESXTCCS50GMEAMK
S. Enteritidis
27.9% (17/61)
600/20
645/19
888/19
644/18
697/18 *
148/17 *
323/17
1102/17
1456/16
984/14 *
29/12
732/12
735/12
2157/12
621/11
1038/11
1749/10
S. Typhimurium
26.2% (16/61)
17/20
18/20 *
828/19 *
1007/18
1017/18
211/17
859/17 *
860/17
861/17
862/17
863/17
880/17
881/17 *
1103/17
1523/12 *
2156/12
S. Kentucky
24.6% (15/61)
319/20
981/19 *
69/18
322/17 *
1212/17 *
1213/17 *
1278/17 *
390/16
1457/16 *
1821/15 *
774/13 *
1114/12 *
1119/12
171/11
622/11
S. Anatum
8.2% (5/61)
333/20
598/18
1268/17
391/16
1750/10
S. Infantis
4.9% (3/61)
17/18
684/18
1006/18 *
S. Muenster
4.9% (3/61)
1210/17 *
1211/17
1093/16
S. Mbandaka
3.3% (2/61)
226/18
804/15 *
(a) AMX: Amoxicillin, AUC: Amoxicillin + Clavulanic acid, CEF: Cefalotin, FOX: Cefoxitin, CAZ: Ceftazidim, CTX: Cefotaxim, CRO: Ceftriaxon, CPM: Cefepim, ATM: Aztreonam, ETP: Ertapenem, GME: Gentamicin, CS50: Colistin, NA: Nalidixic acid, OFL: Ofloxacin, CIP: Ciprofloxacin, NFL: Norfloxacin, C: Chloramphenicol, TE: Tetracycline, SXT: Trimethoprim-Sulfamethoxazole and AMK: Amikacin. Susceptible Antibiotics 12 00526 i001 Resistant Antibiotics 12 00526 i002. * MDR strains.
Table 3. Primers of Salmonella for virulence genes targeted in the present study.
Table 3. Primers of Salmonella for virulence genes targeted in the present study.
Gene FunctionPrimer Sequence
(5′ to 3′)
Product Size
(bp)
Annealing Temperature
(°C)
Reference
SEN1417Intracellular survivalF: GATCGCTGGCTGGTC67058 [38]
R: CTGACCGTAATGGCGA
sipAHost cell invasionF: ATGGTTACAAGTGTAAGGACTCAG205553 [39]
R: ACGCTGCATGTGCAAGCCATC
sipDHost cell invasionF: ATGCTTAATATTCAAAATTATTCCG102953 [39]
R: TCCTTGCAGGAAGCTTTTG
sopDHost cell invasionF: GAGCTCACGACCATTTGCGGCG1291 59 [40]
R: GAGCTCCGAGACACGCTTCTTCG
gipAGrowth or survival in a Peyer’s patchF: ACGACTGAGCAGGCTGAG51858 [41]
R: TTGGAAATGGTGACGGTAGAC
mgtCIntracellular survivalF: TGACTATCAATGCTCCAGTGAAT67758 [41]
R: ATTTACTGGCCGCTATGCTGTTG
trhHCode for the putative F pilus assembly proteinF: AACTGGTGCCGTTGTCATTG41853 [41]
R: GATGGTCTGTGCTTGCTGAG
spvCMultiplication in host cellF: CTCCTTGCACAACCAAATGCG57053 [41]
R: TGTCTCTGCATTTCACCACCATC
sirAControl enteropathogenic virulence functionsF: TGCGCCTGGTGACAAAACTG313 55 [41]
R: ACTGACTTCCCAGGCTACAGCA
pagKBiofilm formation F: ACCATCTTCACTATATTCTGCTC15160 [41]
R: ACCTCTACACATTTTAAACCAATC
invAHost cell invasionF: GTGAAATTATCGCCACGTTCGGGCAA28464 [42]
R: TCATCGCACCGTCAAAGGAACC
HliControl of phase change and motilityF: AGCCTCGGCTACTGGTCTTG17355 [43]
R: CCGCAGCAAGAGTCACCTCA
F: forward primer; R: reverse primer.
Table 4. Primers of Salmonella for antibiotic resistance genes targeted in the present study.
Table 4. Primers of Salmonella for antibiotic resistance genes targeted in the present study.
Gene Primer Sequence
(5′ to 3′)
Product Size (bp)Annealing Temperature (°C)Reference
blaTEMF: ATCAGCAATAAACCAGC51654 [44]
R: CCCCGAAGAACGTTTTC
blaCTX-MF: ATGTGCAGYACCAGTAARGTKATGGC59258 [45]
R: TGGGTRAARTARGTSACCAGAAYSAGCGG
blaNDM1F: CTGAGCACCGCATTAGCC62152 [46]
R: GGGCCGTATGAGTGATTGC
tetAF: GGTTCACTCGAACGACGTCA57755 [47]
R: CTGTCCGACAAGTTGCATGA
tetBF: CCTCAGCTTCTCAACGCGTG63455 [47]
R: GCACCTTGCTGATGACTCTT
dfrA1F: GGAGTGCCAAAGGTGAACAGC36755 [48]
R: GAGGCGAAGTCTTGGGTAAAAAC
qnrBF: GATCGTGAAAGCCAGAAAGG46953 [49]
R: ACGATGCCTGGTAGTTGTCC
mcr-1F: AGTCCGTTTGTTCTTGTGGC32058 [50]
R: AGATCCTTGGTCTCGGCTTG
mcr-2F: CAAGTGTGTTGGTCGCAGTT715 58 [50]
R: TCTAGCCCGACAAGCATACC
mcr-3F: AAATAAAAATTGTTCCGCTTATG92958 [50]
R: AATGGAGATCCCCGTTTTT
mcr-4F: TCACTTTCATCACTGCGTTG111658 [50]
R: TTGGTCCATGACTACCAATG
mcr-5F: ATGCGGTTGTCTGCATTTATC164458 [50]
R: TCATTGTGGTTGTCCTTTTCTG
int1F: GGGTCAAGGATCTGGATTTCG48362 [51]
R: ACATGGGTGTAAATCATCGTC
int2F: CACGGATATGCGACAAAAAGGT23362 [51]
R: GTAGCAAACGAGTGACGAAATG
F: forward primer; R: reverse primer.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Oueslati, W.; Ridha Rjeibi, M.; Benyedem, H.; Jebali, M.; Souissi, F.; Selmi, R.; El Asli, M.S.; Barguellil, F.; Ettriqui, A. Serotype Occurrence, Virulence Profiles, Antimicrobial Resistance and Molecular Characterization of Salmonella Isolated from Hospitalized Patients with Gastroenteritis in Great Tunisia between 2010 and 2020. Antibiotics 2023, 12, 526. https://doi.org/10.3390/antibiotics12030526

AMA Style

Oueslati W, Ridha Rjeibi M, Benyedem H, Jebali M, Souissi F, Selmi R, El Asli MS, Barguellil F, Ettriqui A. Serotype Occurrence, Virulence Profiles, Antimicrobial Resistance and Molecular Characterization of Salmonella Isolated from Hospitalized Patients with Gastroenteritis in Great Tunisia between 2010 and 2020. Antibiotics. 2023; 12(3):526. https://doi.org/10.3390/antibiotics12030526

Chicago/Turabian Style

Oueslati, Walid, Mohamed Ridha Rjeibi, Hayet Benyedem, Mounir Jebali, Fatma Souissi, Rachid Selmi, Mohamed Sélim El Asli, Farouk Barguellil, and Abdelfettah Ettriqui. 2023. "Serotype Occurrence, Virulence Profiles, Antimicrobial Resistance and Molecular Characterization of Salmonella Isolated from Hospitalized Patients with Gastroenteritis in Great Tunisia between 2010 and 2020" Antibiotics 12, no. 3: 526. https://doi.org/10.3390/antibiotics12030526

APA Style

Oueslati, W., Ridha Rjeibi, M., Benyedem, H., Jebali, M., Souissi, F., Selmi, R., El Asli, M. S., Barguellil, F., & Ettriqui, A. (2023). Serotype Occurrence, Virulence Profiles, Antimicrobial Resistance and Molecular Characterization of Salmonella Isolated from Hospitalized Patients with Gastroenteritis in Great Tunisia between 2010 and 2020. Antibiotics, 12(3), 526. https://doi.org/10.3390/antibiotics12030526

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop