Wild Duck (Anas platyrhynchos) as a Source of Antibiotic-Resistant Salmonella enterica subsp. diarizonae O58—The First Report in Poland
Abstract
1. Introduction
2. Results
2.1. Serological Identification
2.2. Antimicrobial Susceptibility Testing
2.3. Detection of Antimicrobial Resistance Genes (ARGs) by Multiplex PCR
3. Discussion
4. Materials and Methods
4.1. Salmonella spp. Isolation and Identification
4.1.1. Salmonella spp. Identification with Molecular Biology Methods
4.1.2. Biochemical Strain Identification
4.1.3. Serological Typing
4.2. Antimicrobial Susceptibility Testing
4.3. Detection of Antimicrobial Resistance Genes (ARGs) by Multiplex PCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, H.; Whitehouse, C.A.; Li, B. Presence and Persistence of Salmonella in Water: The Impact on Microbial Quality of Water and Food Safety. Front. Public Health 2018, 6, 159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control). The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2018/2019. EFSA J. 2021, 19, e06490. [Google Scholar] [CrossRef]
- Giner-Lamia, J.; Vinuesa, P.; Betancor, L.; Silva, C.; Bisio, J.; Soleto, L.; Chabalgoity, J.A.; Puente, J.L.; Soncini, F.C.; García-Vescovi, E.; et al. Genome analysis of Salmonella enterica subsp. diarizonae isolates from invasive human infections reveals enrichment of virulence-related functions in lineage ST1256. BMC Genom. 2019, 20, 99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schröter, M.; Roggentin, P.; Hofmann, J.; Speicher, A.; Laufs, R.; Mack, D. Pet Snakes as a Reservoir for Salmonella enterica subsp. diarizonae (Serogroup IIIb): A Prospective Study. Appl. Environ. Microbiol. 2004, 70, 613–615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bjelland, A.M.; Sandvik, L.M.; Skarstein, M.M.; Svendal, L.; Debenham, J.J. Prevalence of Salmonella serovars isolated from reptiles in Norwegian zoos. Acta Vet. Scand. 2020, 62, 3. [Google Scholar] [CrossRef] [Scilit]
- Alvseike, O.; Skjerve, E. Prevalence of a Salmonella subspecies diarizonae in Norwegian sheep herds. Prev. Vet. Med. 2002, 52, 277–285. [Google Scholar] [CrossRef] [Scilit]
- Stokar-Regenscheit, N.; Overesch, G.; Giezendanner, R.; Roos, S.; Gurtner, C. Salmonella enterica subsp. diarizonae serotype 61:k:1,5,(7) associated with chronic proliferative rhinitis and high nasal colonization rates in a flock of Texel sheep in Switzerland. Prev. Vet. Med. 2017, 145, 78–82. [Google Scholar] [CrossRef] [Scilit]
- Chatzopoulos, D.C.; Sarrou, S.; Vasileiou, N.G.C.; Ioannidi, K.S.; Peteinaki, E.; Valiakos, G.; Tsokana, C.N.; Papadopoulos, E.; Spyrou, V.; Mavrogianni, V.S.; et al. Dissemination of intestinal pathogens between lambs and puppies in sheep farms. Small Rumin. Res. 2016, 141, 5–10. [Google Scholar] [CrossRef] [Scilit]
- Chatzopoulos, D.C.; Vasileiou, N.G.C.; Ioannidi, K.S.; Katsafadou, A.I.; Mavrogianni, V.S.; Michael, C.K.; Katsarou, E.I.; Karavanis, E.; Papadopoulos, N.; Sbiraki, A.; et al. Experimental study of the potential role of Salmonella enterica subsp. Diarizonae in the diarrhoeic syndrome of lambs. Pathogens 2021, 10, 113. [Google Scholar] [CrossRef] [Scilit]
- Gawin, P. Wild game in Poland. In Hunting Traditions, Law, Game; Gawin, P., Ed.; SBM Sp. z o.o.: Warsaw, Poland, 2015; pp. 129–131. ISBN 9788378458661. [Google Scholar]
- David Black Modelling the Potential Spatiotemporal Spread of Avian Influenza. 2006. Available online: https://www.geos.ed.ac.uk/~mscgis/05-06/s0566972/index.html#Introduction (accessed on 1 June 2021).
- Redlisiak, M.; Wardecki, Ł.; Karpińska, O.; Hayatli, F.; Grzębkowski, M.K.K. Report on the project of ringing of the Mallards Anas platyrhynchos in the Warsaw Metropolitan Area in 2015–2018: Sprawozdanie z projektu znakowania krzy ż ówki Anas platyr. Kulon 2018, 23, 177–243. [Google Scholar]
- Van Toor, M.L.; Hedenström, A.; Waldenström, J.; Fiedler, W.; Holland, R.A.; Thorup, K.; Wikelski, M. Flexibility of Continental Navigation and Migration in European Mallards. PLoS ONE 2013, 8, e72629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lillehaug, A.; Jonassen, C.M.; Bergsjø, B.; Hofshagen, M.; Tharaldsen, J.; Nesse, L.L.; Handeland, K. Screening of feral pigeon (Colomba livia), mallard (Anas platyrhynchos) and graylag goose (Anser anser) populations for Campylobacter spp., Salmonella spp., avian influenza virus and avian paramyxovirus. Acta Vet. Scand. 2005, 46, 193–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dera-Tomaszewska, B. Epidemiology and Pathology of Salmonella Enteritidis and Salmonella Serovars First Isolated in Poland; Medical University of Gdańsk: Gdańsk, Poland, 2013; Volume 43. [Google Scholar]
- Wattiau, P.; Boland, C.; Bertrand, S. Methodologies for Salmonella enterica subsp. Enterica Subtyping: Gold Standards and Alternatives. Appl. Environ. Microbiol. 2011, 77, 7877–7885. [Google Scholar] [CrossRef] [Scilit]
- Pintado, V. Old and new antibiotics for therapy of multidrug resistant bacteria/Fármacos antiguos y nuevos en el tratamiento de la infección por bacterias multirresistentes. Rev. Esp Quim. 2016, 29, 39–42. [Google Scholar]
- Goodlet, K.J.; Benhalima, F.Z.; Nailor, M.D. A systematic review of single-dose aminoglycoside therapy for urinary tract infection: Is it time to resurrect an old strategy? Antimicrob. Agents Chemother. 2019, 63, e02165-18. [Google Scholar] [CrossRef] [Scilit]
- Kapoor, G.; Saigal, S.A.E. Action and resistance mechanisms of antibiotics: A guide for clinicians. J. Anaesthesiol. Clin. Pharmacol. 2017, 33, 300–305. [Google Scholar] [CrossRef] [Scilit]
- Gebreyes, W.A.; Altier, C. Molecular characterization of multidrug-resistant Salmonella enterica subsp. enterica serovar Typhimurium isolates from swine. J. Clin. Microbiol. 2002, 40, 2813–2822. [Google Scholar] [CrossRef] [Scilit]
- Regulation of the Minister of the Environment of 11 March 2005 on the List of Game Species Dz.U. 2005 nr 45 poz. 433. 2005. Available online: https://isap.sejm.gov.pl/isap.nsf/DocDetails.xsp?id=WDU20050450433 (accessed on 1 June 2021).
- EN ISO 6579-1:2017; Microbiology of the Food Chain—Horizontal Method for the Detection, Enumeration and Serotyping of Salmonella—Part 1: Detection of Salmonella spp. ISO: Geneva, Switzerland, 2017.
- Pławińska-Czarnak, J.; Wódz, K.; Kizerwetter-Świda, M.; Nowak, T.; Bogdan, J.; Kwieciński, P.; Kwieciński, A.; Anusz, K. Citrobacter braakii yield false-positive identification as salmonella, a note of caution. Foods 2021, 10, 2177. [Google Scholar] [CrossRef] [Scilit]
- Załęska, H.; Teisseyre, T.; Janczura, E. Media and nutrients for microorganisms of the Enterobacteriaceae family. In Bacteriological Media. Composition and Preparation; Załęska, H., Ed.; National Institute of Hygiene, Department of Bacteriology, Methodological Publishers of the National Institute of Hygiene: Warsaw, Poland, 2015; Volume 5, pp. 82–131. ISBN 978-83-7845-866-1. [Google Scholar]
- Issenhuth-Jeanjean, S.; Roggentin, P.; Mikoleit, M.; De Pinna, E.; Nair, S.; Fields, P.I.; Weill, F.X. Supplement 2008–2010 (no. 48) to the White-Kauffmann-Le Minor Scheme. Res. Microbiol. 2014, 165, 526–530. [Google Scholar] [CrossRef] [Scilit]
- Grimont, P.A.D.; Weill, F.-X. Antigenic Formulae of the Salmonella Serovars, 9th ed.; WHO Collaborating Centre for Reference and Research on Salmonella: Paris, France, 2007; pp. 1–167. [Google Scholar]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 28th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Ramtahal, M.A.; Somboro, A.M.; Amoako, D.G.; Abia, A.L.K.; Perrett, K.; Bester, L.A.; Essack, S.Y. Molecular Epidemiology of Salmonella enterica in Poultry in South Africa Using the Farm-to-Fork Approach. Int. J. Microbiol. 2022, 2022, 5121273. [Google Scholar] [CrossRef] [Scilit]
- Kozak, G.K.; Boerlin, P.; Janecko, N.; Reid-Smith, R.J.; Jardine, C. Antimicrobial resistance in Escherichia coli isolates from Swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 2009, 75, 559–566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsui, K.; Nakazawa, C.; Khin, S.T.M.M.; Iwabuchi, E.; Asai, T.; Ishihara, K. Molecular characteristics and antimicrobial resistance of Salmonella enterica serovar schwarzengrund from chicken meat in japan. Antibiotics 2021, 10, 1336. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Antibiotic | Minimal Inhibitory Concentration, μg/mL | Sensitivity |
|---|---|---|
| ampicillin | ≤2 | S |
| amoxicillin | 2 | S |
| amoxicillin and clavulanic acid | ≤2 | S |
| cefalexin | ≥8 | R |
| cefalotin | ≤2 | S |
| cefapirin | ≥8 | R |
| cefoperazone | ≤4 | S |
| ceftiofur | ≤2 | S |
| cefquinome | ≤2 | S |
| cloxacillin | >2 | R |
| penicillin G | 8 | R |
| nafcillin | >2 | R |
| imipenem | ≤0.25 | S |
| gentamicin | ≥16 | R |
| neomycin | ≥8 | R |
| streptomycin | ≥32 | R |
| colistin | ≤2 | S |
| polymixin B | ≤2 | S |
| enrofloxacin | ≤0.5 | S |
| flumequine | ≥32 | R |
| marbofloxacin | ≤0.25 | S |
| norfloxacin | ≤1 | S |
| doxycycline | ≤2 | S |
| oxytetracycline | ≤2 | S |
| tetracycline | ≤1 | S |
| erythromycin | >0.5 | R |
| tylosin | > 1 | R |
| florfenicol | 4 | I |
| lincomycin | ≥8 | R |
| lincomycin/spectinomycin | ≤8 | S |
| trimethoprim–sulfamethoxazole | ≤2 | S |
| tiamulin | >16 | R |
| tylvalosin | >4 | R |
| Multiplex PCR | Gene | Primer Sequences 5′–3′ | Annealing Temperature | Product Size (bp) |
|---|---|---|---|---|
| 1 | aadA | F: GTG GAT GGC GGC CTG AAG CC R: AAT GCC CAG TCG GCA GCG | 63 °C | 525 bp |
| 1 | strA/strB | F: ATGGTG GAC CCT AAA ACT CT R: CGT CTA GGA TCG AGA CAA AG | 63 °C | 893 bp |
| 2 | aphA1 | F: ATG GGC TCG CGA TAA TGT C R: CTC ACC GAG GCA GTT CCA T | 55 °C | 634 bp |
| 2 | aphA2 | F: GAT TGA ACA AGA TGG ATT GC R: CCA TGA TGG ATA CTT TCT CG | 55 °C | 347 bp |
| 2 | aadB | F: GAG GAG TTG GAC TAT GGA TT R: CTT CAT CGG CAT AGT AAA AG | 55 °C | 208 bp |
| 3 | tetA | F: GGC GGT CTT CTT CAT CAT GC R: CGG CAG GCA GAG CAA GTA GA | 63 °C | 502 bp |
| 3 | tetB | F: CGC CCA GTG CTG TTG TTG TC R: CGC GTT GAG AAG CTG AGG TG | 63 °C | 173 bp |
| 4 | sul1 | F: CGG CGT GGG CTA CCT GAA CG R: GCC GAT CGC GTG AAG TTC CG | 66 °C | 433 bp |
| 4 | sul2 | F: CGG CAT CGT CAA CAT AAC CT R: TGT GCG GAT GAA GTC AGC TC | 66 °C | 721 bp |
| 5 | blaTEM | F: TTAACTGGCGAACTACTTAC R: GTCTATTTCGTTCATCCATA | 55 °C | 247 bp |
| 5 | blaSHV | F: AGGATTGACTGCCTTTTTG R: ATTTGCTGATTTCGCTCG | 55 °C | 393 bp |
| 5 | blaCMY-2 | F: GACAGCCTCTTTCTCCACA R: TGGACACGAAGGCTACGTA | 55 °C | 1000 bp |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pławińska-Czarnak, J.; Wódz, K.; Piechowicz, L.; Tokarska-Pietrzak, E.; Bełkot, Z.; Bogdan, J.; Wiśniewski, J.; Kwieciński, P.; Kwieciński, A.; Anusz, K. Wild Duck (Anas platyrhynchos) as a Source of Antibiotic-Resistant Salmonella enterica subsp. diarizonae O58—The First Report in Poland. Antibiotics 2022, 11, 530. https://doi.org/10.3390/antibiotics11040530
Pławińska-Czarnak J, Wódz K, Piechowicz L, Tokarska-Pietrzak E, Bełkot Z, Bogdan J, Wiśniewski J, Kwieciński P, Kwieciński A, Anusz K. Wild Duck (Anas platyrhynchos) as a Source of Antibiotic-Resistant Salmonella enterica subsp. diarizonae O58—The First Report in Poland. Antibiotics. 2022; 11(4):530. https://doi.org/10.3390/antibiotics11040530
Chicago/Turabian StylePławińska-Czarnak, Joanna, Karolina Wódz, Lidia Piechowicz, Ewa Tokarska-Pietrzak, Zbigniew Bełkot, Janusz Bogdan, Jan Wiśniewski, Piotr Kwieciński, Adam Kwieciński, and Krzysztof Anusz. 2022. "Wild Duck (Anas platyrhynchos) as a Source of Antibiotic-Resistant Salmonella enterica subsp. diarizonae O58—The First Report in Poland" Antibiotics 11, no. 4: 530. https://doi.org/10.3390/antibiotics11040530
APA StylePławińska-Czarnak, J., Wódz, K., Piechowicz, L., Tokarska-Pietrzak, E., Bełkot, Z., Bogdan, J., Wiśniewski, J., Kwieciński, P., Kwieciński, A., & Anusz, K. (2022). Wild Duck (Anas platyrhynchos) as a Source of Antibiotic-Resistant Salmonella enterica subsp. diarizonae O58—The First Report in Poland. Antibiotics, 11(4), 530. https://doi.org/10.3390/antibiotics11040530

