Characterization of Mutations in DNA Gyrase and Topoisomerase IV in Field Strains and In Vitro Selected Quinolone-Resistant Mycoplasma hyorhinis Mutants
Abstract
1. Introduction
2. Results
2.1. Antimicrobial Susceptibility of M. hyorhinis Field Strains
2.2. In Vitro Selection of Fluoroquinolone-Resistant Mutants of M. hyorhinis
2.3. Characterization of Mutations in QRDRs in Both In Vitro Selected Mutants and Field Strains
3. Discussion
4. Materials and Methods
4.1. Mycoplasma Isolates and Growth Conditions
4.2. Antimicrobial Susceptibility Testing
4.3. Selection of Fluoroquinolone-Resistant Mutants
4.4. Analysis of Quinolone Resistance Determining Region
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Carter, C.R.; McKay, K.A. A Pleuropneumonia-like Organism Associated with Infectious Atrophic Rhinitis of Swine. Can. J. Comp. Med. Vet. Sci. 1953, 17, 413–416. [Google Scholar] [PubMed]
- Li, J.; Wang, J.; Shao, J.; Li, Y.; Yu, Y.; Shao, G.; Feng, Z.; Xiong, Q. The variable lipoprotein family participates in the interaction of Mycoplasma hyorhinis with host extracellular matrix and plasminogen. Vet. Microbiol. 2022, 265, 109310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Friis, N.F.; Feenstra, A.A. Mycoplasma-Hyorhinis in the Etiology of Serositis among Piglets. Acta Vet. Scand. 1994, 35, 93–98. [Google Scholar] [PubMed]
- Clavijo, M.J.; Murray, D.; Oliveira, S.; Rovira, A. Infection dynamics of Mycoplasma hyorhinis in three commercial pig populations. Vet. Rec. 2017, 181, 68. [Google Scholar] [CrossRef] [Scilit]
- Gimenez-Lirola, L.G.; Meiroz-De-Souza-Almeida, H.; Magtoto, R.L.; McDaniel, A.J.; Merodio, M.M.; Matias Ferreyra, F.S.; Poonsuk, K.; Gatto, I.R.H.; Baum, D.H.; Ross, R.F.; et al. Early detection and differential serodiagnosis of Mycoplasma hyorhinis and Mycoplasma hyosynoviae infections under experimental conditions. PLoS ONE 2019, 14, e0223459. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Li, Y.; Pan, L.; Li, J.; Yu, Y.; Liu, B.; Zubair, M.; Wei, Y.; Pillay, B.; Olaniran, A.O.; et al. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) moonlights as an adhesin in Mycoplasma hyorhinis adhesion to epithelial cells as well as a plasminogen receptor mediating extracellular matrix degradation. Vet Res. 2021, 52, 80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vande Voorde, J.; Balzarini, J.; Liekens, S. Mycoplasmas and cancer: Focus on nucleoside metabolism. EXCLI J. 2014, 13, 300–322. [Google Scholar] [PubMed]
- Uphoff, C.C.; Drexler, H.G. Detection of Mycoplasma contamination in cell cultures. Curr. Protoc. Mol. Biol. 2014, 106. [Google Scholar] [CrossRef] [Scilit]
- Gautier-Bouchardon, A.V. Antimicrobial Resistance in Mycoplasma spp. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nikfarjam, L.; Farzaneh, P. Prevention and detection of Mycoplasma contamination in cell culture. Cell J. 2012, 13, 203–212. [Google Scholar] [PubMed]
- Beko, K.; Felde, O.; Sulyok, K.M.; Kreizinger, Z.; Hrivnak, V.; Kiss, K.; Biksi, I.; Jerzsele, A.; Gyuranecz, M. Antibiotic susceptibility profiles of Mycoplasma hyorhinis strains isolated from swine in Hungary. Vet. Microbiol. 2019, 228, 196–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drlica, K.; Malik, M. Fluoroquinolones: Action and resistance. Curr. Top. Med. Chem. 2003, 3, 249–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tatay-Dualde, J.; Prats-van der Ham, M.; de la Fe, C.; Paterna, A.; Sanchez, A.; Corrales, J.C.; Contreras, A.; Gomez-Martin, A. Mutations in the quinolone resistance determining region conferring resistance to fluoroquinolones in Mycoplasma agalactiae. Vet. Microbiol. 2017, 207, 63–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reinhardt, A.K.; Bebear, C.M.; Kobisch, M.; Kempf, I.; Gautier-Bouchardon, A.V. Characterization of mutations in DNA gyrase and topoisomerase IV involved in quinolone resistance of Mycoplasma gallisepticum mutants obtained in vitro. Antimicrob. Agents Chemother. 2002, 46, 590–593. [Google Scholar] [CrossRef] [Scilit]
- Lysnyansky, I.; Gerchman, I.; Mikula, I.; Gobbo, F.; Catania, S.; Levisohn, S. Molecular characterization of acquired enrofloxacin resistance in Mycoplasma synoviae field isolates. Antimicrob. Agents Chemother. 2013, 57, 3072–3077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vicca, J.; Maes, D.; Stakenborg, T.; Butaye, P.; Minion, F.; Peeters, J.; de Kruif, A.; Decostere, A.; Haesebrouck, F. Resistance mechanism against fluoroquinolones in Mycoplasma hyopneumoniae field isolates. Microb. Drug Resist. 2007, 13, 166–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sato, T.; Okubo, T.; Usui, M.; Higuchi, H.; Tamura, Y. Amino acid substitutions in GyrA and ParC are associated with fluoroquinolone resistance in Mycoplasma bovis isolates from Japanese dairy calves. J. Vet. Med. Sci. 2013, 75, 1063–1065. [Google Scholar] [CrossRef] [Scilit]
- Ter Laak, E.A.; Pijpers, A.; Noordergraaf, J.H.; Schoevers, E.C.; Verheijden, J.H. Comparison of methods for in vitro testing of susceptibility of porcine Mycoplasma species to antimicrobial agents. Antimicrob. Agents Chemother. 1991, 35, 228–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosales, R.S.; Ramirez, A.S.; Tavio, M.M.; Poveda, C.; Poveda, J.B. Antimicrobial susceptibility profiles of porcine mycoplasmas isolated from samples collected in southern Europe. BMC Vet. Res. 2020, 16, 324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jang, J.; Kim, K.; Park, S.; Park, B.; Um, H.; Coulier, M.; Hahn, T.W. In vitro antibiotic susceptibility of field isolates of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis from Korea. Korean J. Vet. Res. 2016, 56, 109–111. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.C.; Shryock, T.R.; Lin, T.L.; Faderan, M.; Veenhuizen, M.F. Antimicrobial susceptibility of Mycoplasma hyorhinis. Vet. Microbiol. 2000, 76, 25–30. [Google Scholar] [CrossRef] [Scilit]
- Bebear, C.M.; Renaudin, H.; Charron, A.; Bove, J.M.; Bebear, C.; Renaudin, J. Alterations in topoisomerase IV and DNA gyrase in quinolone-resistant mutants of Mycoplasma hominis obtained in vitro. Antimicrob. Agents Chemother. 1998, 42, 2304–2311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khalil, D.; Becker, C.A.M.; Tardy, F. Alterations in the Quinolone Resistance-Determining Regions and Fluoroquinolone Resistance in Clinical Isolates and Laboratory-Derived Mutants of Mycoplasma bovis: Not All Genotypes May Be Equal. Appl. Environ. Microbiol. 2015, 82, 1060–1068. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Carrou, J.; Laurentie, M.; Kobisch, M.; Gautier-Bouchardon, A.V. Persistence of Mycoplasma hyopneumoniae in experimentally infected pigs after marbofloxacin treatment and detection of mutations in the parC gene. Antimicrob. Agents Chemother. 2006, 50, 1959–1966. [Google Scholar] [CrossRef] [Scilit]
- Reinhardt, A.K.; Kempf, I.; Kobisch, M.; Gautier-Bouchardon, A.V. Fluoroquinolone resistance in Mycoplasma gallisepticum: DNA gyrase as primary target of enrofloxacin and impact of mutations in topoisomerases on resistance level. J. Antimicrob. Chemoth. 2002, 50, 589–592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.; Xiao, S.; Li, M.; Guo, S.; Li, S.; Luo, R.; Feng, Z.; Li, B.; Zhou, Z.; Shao, G.; et al. Comparative genomic analyses of Mycoplasma hyopneumoniae pathogenic 168 strain and its high-passaged attenuated strain. BMC Genomics. 2013, 14, 80. [Google Scholar] [CrossRef] [Scilit]
- Hannan, P.C. Guidelines and recommendations for antimicrobial minimum inhibitory concentration (MIC) testing against veterinary mycoplasma species. Vet. Res. 2000, 31, 373–395. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Strain | Origin | Year | MIC (μg/mL) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CIP | TIA | TYL | DOX | TVN | LIN | OTC | TIL | FFC | |||
| Mhr-JS-2010-36 | Nanjing, China | 2010 | 0.5 | 0.12 | 0.5 | 1 | 0.06 | 0.5 | 2 | 2 | 2 |
| Mhr-JS-2010-37 | Nanjing, China | 2010 | 0.5 | 0.12 | 0.5 | 1 | 0.12 | 0.5 | 4 | 2 | 2 |
| Mhr-JS-2011-40 | Nanjing, China | 2011 | 0.5 | 0.015 | 0.25 | 0.25 | 0.03 | 0.12 | 0.5 | 0.5 | 0.5 |
| Mhr-JS-2014-43 | Lishui, China | 2014 | 0.5 | 0.25 | 1 | 0.12 | 0.12 | 1 | 0.25 | 4 | 1 |
| Mhr-JS-2015-44 | Nanjing, China | 2015 | 0.5 | 0.12 | 0.5 | 0.5 | 0.12 | 0.5 | 2 | 2 | 2 |
| Mhr-JS-2016-47 | Liuhe, China | 2016 | 0.5 | 0.25 | 0.5 | 1 | 0.06 | 1 | 2 | 4 | 8 |
| Mhr-JS-2018-53 | Taixing, China | 2018 | 0.5 | 0.06 | 1 | 1 | 0.25 | 0.5 | 2 | 8 | 2 |
| Stains | Initial MIC | QRDRs | Concentration of Ciprofloxacin for Selection (μg/mL) | |||||
|---|---|---|---|---|---|---|---|---|
| 0.5 | 1 | 2 | 4 | 8 | 16 | |||
| Mhr-JS-2016-47 | 0.5 | ParC | Ser80Phe | Ser80Phe | Ser80Phe | Ser80Phe | Ser80Phe | Ser80Phe |
| ParE | Glu470Lys | Glu470Lys | Glu470Lys | Glu470Lys | Glu470Lys | |||
| GyrA | Asp87Tyr | Asp87Tyr | Asp87Tyr | |||||
| Mhr-JS-2018-53 | 0.5 | ParC | Ser80Tyr | Ser80Tyr | Ser80Tyr | Ser80Tyr | ||
| ParE | Glu470Lys | Glu470Lys | Glu470Lys | |||||
| GyrA | Ser84Pro | |||||||
| Mhr-JS-2014-43 | 0.5 | ParC | Ser80Tyr | Ser80Tyr | Ser80Tyr | Ser80Tyr | Ser80Tyr | |
| GyrA | Asp87Asn | Asp87Asn | Asp87Asn | |||||
| Mhr-JS-2015-44 | 0.5 | ParC | Phe80Tyr | Phe80Tyr | Phe80Tyr | Phe80Tyr | ||
| GyrA | Ala83Val | Ala83Val | Ala83Val | |||||
| Mhr-JS-2010-36 | 0.5 | ParC | Glu84Gly | Glu84Gly | Glu84Gly | Glu84Gly | ||
| GyrA | Ala83Val | |||||||
| Mhr-JS-2010-37 | 0.5 | ParC | Glu84Lys | Glu84Lys | Glu84Lys | Glu84Lys | Glu84Lys | |
| GyrA | Asp87Asn | Asp87Asn | Asp87Asn | Asp87Asn | ||||
| Mhr-JS-2011-40 | 0.5 | ParC | Glu84Lys | Glu84Lys | Glu84Lys | Glu84Lys | Glu84Lys | |
| GyrA | Ala83Val | Ala83Val | Ala83Val | Ala83Val | ||||
| Primer Target | Primer Sequence | Product Size (bp) |
|---|---|---|
| gyrA-F | ACTTCTTTTAAATTATGAGGG | 621 |
| gyrA-R | TGAAGCAGAACTAGAACAA | |
| gyrB-F | CACAGATAGTTATTCTGATTC | 831 |
| gyrB-R | GGTTGAGCTATGTAAACAT | |
| parC-F | ATGAAGAAACTAGATAATAATATG | 609 |
| parC-R | TTCTATACAAGCATCAATTA | |
| parE-F | AATTAAACATTCAAATCCAATT | 670 |
| parE-R | TGAATATGCATAAACAACTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Wei, Y.; Wang, J.; Li, Y.; Shao, G.; Feng, Z.; Xiong, Q. Characterization of Mutations in DNA Gyrase and Topoisomerase IV in Field Strains and In Vitro Selected Quinolone-Resistant Mycoplasma hyorhinis Mutants. Antibiotics 2022, 11, 494. https://doi.org/10.3390/antibiotics11040494
Li J, Wei Y, Wang J, Li Y, Shao G, Feng Z, Xiong Q. Characterization of Mutations in DNA Gyrase and Topoisomerase IV in Field Strains and In Vitro Selected Quinolone-Resistant Mycoplasma hyorhinis Mutants. Antibiotics. 2022; 11(4):494. https://doi.org/10.3390/antibiotics11040494
Chicago/Turabian StyleLi, Jun, Yanna Wei, Jia Wang, Yao Li, Guoqing Shao, Zhixin Feng, and Qiyan Xiong. 2022. "Characterization of Mutations in DNA Gyrase and Topoisomerase IV in Field Strains and In Vitro Selected Quinolone-Resistant Mycoplasma hyorhinis Mutants" Antibiotics 11, no. 4: 494. https://doi.org/10.3390/antibiotics11040494
APA StyleLi, J., Wei, Y., Wang, J., Li, Y., Shao, G., Feng, Z., & Xiong, Q. (2022). Characterization of Mutations in DNA Gyrase and Topoisomerase IV in Field Strains and In Vitro Selected Quinolone-Resistant Mycoplasma hyorhinis Mutants. Antibiotics, 11(4), 494. https://doi.org/10.3390/antibiotics11040494
