Next Article in Journal
Dynamic Gene Clusters Mediating Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates
Next Article in Special Issue
Comparative Genomic Analysis of a Panton–Valentine Leukocidin-Positive ST22 Community-Acquired Methicillin-Resistant Staphylococcus aureus from Pakistan
Previous Article in Journal
Factors Associated with Antimicrobial Stewardship Practices on California Dairies: One Year Post Senate Bill 27
Previous Article in Special Issue
Colistin and Carbapenem-Resistant Acinetobacter baumannii Aci46 in Thailand: Genome Analysis and Antibiotic Resistance Profiling
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 11
Issue 2
10.3390/antibiotics11020167
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Description of Ceftazidime/Avibactam Resistance in a ST13 KPC-70-Producing Klebsiella pneumoniae Strain from Portugal

by
Gabriel Mendes
1,
João F. Ramalho
1,
Ana Bruschy-Fonseca
2,
Luís Lito
2,
Aida Duarte
3,4,
José Melo-Cristino
2,5 and
Cátia Caneiras
1,3,6,*
1
Microbiology Research Laboratory on Environmental Health (EnviHealthMicro Lab), Institute of Environmental Health (ISAMB), Faculty of Medicine, Universidade de Lisboa (ULisboa), 1649-028 Lisboa, Portugal
2
Microbiology Laboratory, Clinical Pathology Department, Centro Hospitalar Universitário Lisboa Norte, 1649-035 Lisboa, Portugal
3
Faculty of Pharmacy, Universidade de Lisboa (ULisboa), 1649-033 Lisboa, Portugal
4
Egas Moniz Interdisciplinary Research Center, Egas Moniz University Institute, 2829-511 Monte da Caparica, Portugal
5
Institute of Microbiology, Faculty of Medicine, Universidade de Lisboa (ULisboa), 1649-028 Lisboa, Portugal
6
Institute of Preventive Medicine and Public Health, Faculty of Medicine, Universidade de Lisboa (ULisboa), 1649-028 Lisboa, Portugal
*
Author to whom correspondence should be addressed.
Antibiotics 2022, 11(2), 167; https://doi.org/10.3390/antibiotics11020167
Submission received: 28 December 2021 / Revised: 25 January 2022 / Accepted: 25 January 2022 / Published: 27 January 2022
(This article belongs to the Special Issue Genomic Analysis of Antibiotics Resistance in Pathogens)
Versions Notes

Abstract

:
The combination of ceftazidime/avibactam (CZA) is a novel β-lactam/β-lactamase inhibitor with activity against Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacterales. Emerging cases caused by CZA-resistant strains that produce variants of KPC genes have already been reported worldwide. However, to the best of our knowledge, no CZA-resistant strains were reported in Portugal. In September 2019, a K. pneumoniae CZA-resistant strain was collected from ascitic fluid at a surgery ward of a tertiary University Hospital Center in Lisboa, Portugal. The strain was resistant to ceftazidime/avibactam, as well as to ceftazidime, cefoxitin, gentamicin, amoxicillin/clavulanic acid, and ertapenem, being susceptible to imipenem and tigecycline. A hypermucoviscosity phenotype was confirmed by string test. Whole-genome sequencing (WGS) analysis revealed the presence of an ST13 KPC70-producing K. pneumoniae, a KPC-3 variant, differing in two amino-acid substitutions (D179Y and T263A). The D179Y mutation in the KPC Ω-loop region is the most common amino-acid substitution in KPC-2 and KPC-3, further leading to CZA resistance. The second mutation causes a KPC-70 variant in which threonine replaces alanine (T263A). The CZA-resistant strain showed the capsular locus KL3 and antigen locus O1v2. Other important virulence factors were identified: fimbrial adhesins type 1 and type 3, as well as the cluster of iron uptake systems aerobactin, enterobactin, salmochelin, and yersiniabactin included in integrative conjugative element 10 (ICEKp10) with the genotoxin colibactin cluster. Herein, we report the molecular characterization of the first hypervirulent CZA-resistant ST13 KPC-70-producing K. pneumoniae strain in Portugal. The emergence of CZA-resistant strains might pose a serious threat to public health and suggests an urgent need for enhanced clinical awareness and epidemiologic surveillance.

1. Introduction

Klebsiella pneumoniae belongs to the order Enterobacterales and is one of the most common nosocomial pathogens worldwide, representing a serious threat to clinical and public health [1]. Carbapenemase-producing Enterobacterales, such as K. pneumoniae producing carbapenemase (KPC-Kp), are resistant to almost all β-lactam inhibitors, including carbapenem, leading to scarce therapeutic options [1]. In Portugal, an increasing trend of carbapenem resistance has been reported by the European Center for Disease Prevention and Control (ECDC) [2] with an overlapping of multidrug resistance and virulence determinants in KPC-3 K. pneumoniae clinical strains that impose an additional challenge in the treatment of infections caused by this pathogen [3]. Furthermore, despite the improvements in recent years, Portugal has been identified as one of the countries in Europe with the highest rate of hospital infections [4] and with an increasing resistance tendency to the latest therapeutic lines available [5].
A recently developed drug, ceftazidime/avibactam (CZA), combines a third-generation cephalosporin (ceftazidime) and a non-β-lactam β-lactamase inhibitor (avibactam) that inactivates most Amber class A (including KPC), class C, and class D β-lactamases, but it is not effective against class B (metallo-β-lactamase-producing strains) [6]. CZA is approved for use in Europe since 2016 for the treatment of complicated intra-abdominal infections (cIAI), complicated urinary tract infections (cUTI) including pyelonephritis, hospital-acquired pneumonia (HAP) including ventilator-associated pneumonia (VAP), and infections due to aerobic Gram-negative organisms in patients with limited treatment options [7].
A high rate of clinical success and survival with ceftazidime/avibactam treatment regimen has been demonstrated in patients with infections caused by K. pneumoniae carbapenemase-producing Enterobacterales [8,9,10], and it has become an important first-line option [11]. However, despite the limited use of CZA worldwide, emerging ceftazidime/avibactam-resistant strains that produce variants of KPC genes have already been reported [12,13,14,15,16,17] and may represent a serious cause of concern [18], despite not being reported to date in Portugal. Thus, this article aims to describe the genomic molecular characterization of a CZA-resistant K. pneumoniae strain that was identified at a Tertiary University Hospital Center in Lisboa, leading, to the best of our knowledge, to the first description of a CZA-resistant strain in Portugal.

2. Results

The clinical strain was recovered from a 65 year old patient admitted at a Tertiary University Hospital Center in Lisboa, Portugal, in September 2019. The ceftazidime/avibactam-resistant K. pneumoniae was obtained from the biological product ascitic fluid and from a surgery hospital ward. After its identification, the antimicrobial susceptibility profiling analysis indicated that the strain was resistant to ceftazidime/avibactam, without an inhibition zone, as well as to ceftazidime, cefoxitin, gentamicin, amoxicillin/clavulanic acid, and ertapenem, being susceptible to imipenem and tigecycline and susceptible with increased exposure to ciprofloxacin, cefotaxime, aztreonam, and doripenem (Table 1). The hypermucoviscosity phenotype was confirmed by the string test.
MLST analyses of internal fragments of seven housekeeping genes revealed that the K. pneumoniae clinical strain belonged to sequence type 13 (ST13). In accordance with Table 2, and regarding the resistance determinants, we initially identified a carbapenemase-coding gene (blaKPC) by PCR screening. After WGS and using the BLAST and the Clustal Omega programs, we confirmed that the blaKPC-70 gene was a variant of the blaKPC-3 gene with two single-amino-acid variants: D179Y and T263A. Beyond the carbapenemase, three genes coding for narrow-spectrumβ-lactamases were found: blaTEM-1, blaSHV-1, and blaOXA-9. The aac(6′)-Ib′, aadA, aph(3″)-Ib, and aph(6)-Id genes producing aminoglycoside-modifying enzymes were also detected. Trimethoprim–sulfamethoxazole resistance was encoded by dfrA14 and sul2 genes, respectively. The fosA gene, which codes for fosfomycin resistance, was also identified. One mutation in the chromosomal gyrA locus was identified at the gyrA-87N gene, while a homology of only 70% was found in the OmpK35 porin gene. Using the criterion of >95% nucleotide identity for large plasmids and >80% for Col-like plasmids, as well as >96% coverage with the reference replicon sequences, we found two plasmid replicon types IncFIA (pBK30683) and IncFII (pBK30683) and ColRNAI. These plasmids can contribute to the evolution of the clone by hosting the blaKPC variants, as well as to rearrangement (gain or loss of additional resistance determinants) and fusion with coresident plasmids [19]. The genetic context of blaKPC-70 was found totally in the same contig as part of the Tn4401d isoform, characterized by a 68 bp deletion between istB and blaKPC genes when compared with the Tn4401b isoform, which is a Tn3-based transposon involved in blaKPC gene dissemination [20]. Moreover, regarding the virulence genes in K. pneumoniae, the antigen O encoded on rfb locus type O1v2 and the polysaccharide capsule are encoded in K-loci (KL3), while the rcsA and rcsB genes responsible for regulation of capsule synthesis were also found, but not the rmpA gene regulator of mucoid phenotype A. Others important virulence factors identified were fimbria adhesins type 1 (fimA–fimK genes) and type 3 (mrkA–mrkJ genes), as well as the iron uptake systems kfu, enterobactin cluster (entA–fes), aerobactin (iutA), salmochelin (iroN and iroE), and yersiniabactin cluster (fyuA–ybtX), which was included in integrative conjugative element 10 (ICEKp10) with the genotoxin colibactin cluster (12 out of 18 genes). The hypermucoviscosity phenotype was confirmed.

3. Discussion

Ceftazidime/avibactam is a recent therapeutic option for treating serious infections caused by carbapenem-resistant K. pneumoniae (CRK) [9]. However, increased reports of CZA resistance in CRK are worrisome [16,17,21]. In Portugal, no reports of CZA resistance were found to date. In this study, we report a K. pneumoniae KPC-70 CZAR strain that produces a blaKPC-70 gene, a blaKPC-3 variant with two single-amino-acid variants (D179Y and T263A).
The first mutation in the KPC Ω-loop region (D179Y) is the most common amino-acid substitution of KPC in KPC-2 [21] and KPC-3 [22,23]. It has been previously shown that mutations occurring at the 164–179 site result in flexibility of the Ω-loop region, which decreases the binding of avibactam and ceftazidime hydrolysis activity, leading to CZA resistance [24]. The KPC-70 variant, recently described in Italy [12], presents a D179Y mutation in the KPC Ω-loop region and a second mutation in which threonine replaces alanine (T263A).
Multilocus sequence typing (MLST) revealed that the K. pneumoniae clinical strain belonged to sequence type 13 (ST13). A previous study detected seven KPC-3-producers strains belonging to ST13 in Portugal [25] despite the genomic population structure being apparently dominated by ST147 [25,26]. In the remainder of the European continent, most ST13 K. pneumoniae strains were identified as OXA-48-like producers [27,28,29]. In contrast, KPC-producing clones were recently reported among South American public hospitals [30,31,32]. Nevertheless, none of these studies found CZA-resistant strains. In fact, although there has been an evident increase in CZA-resistant K. pneumoniae reports in the last few years [12,15,18,21] none of them exhibited an ST13 allelic profile, which highlights the importance of genomic surveillance of this ST13 clone.
Concerning virulence factors that have been characterized for K. pneumoniae, there are different types according to infection source, as well as K. pneumoniae ST strain. However, there are four major classes of virulence factors: capsule, including the production of hypermucoviscosity, lipopolysaccharide (LPS), siderophores, and fimbriae [33]. The iron acquisition systems are essential in K. pneumoniae infections, generally to control host defenses by inducing the dissemination through chelation of host cellular iron and regulating the production of multiple bacterial virulence factors [34]. Four principal siderophore systems were found in our strain. Firstly, enterobactin (ent) is common to all K. pneumoniae and conserved in the chromosome as core gene. Secondly, yersiniabactin is the most common virulence factor associated with human K. pneumoniae infections and enhances bacterial survival in the host [33,34]. Usually, this siderophore is included in an integrative and conjugative element (ICE) ICEKp10, which in our study was harboring yersiniabactin (ybt17) and colibactin (clb3), which have a genotoxin effect on host cells by crosslinking DNA and disrupting host immune response [35]. Most ICEs are extremely prevalent in hypervirulent K. pneumoniae lineages. In particular, ICEKp10 is the most common type found in ST23 and ST258 [36]. The remaining siderophore gene clusters found encode for the biosynthesis of aerobactin and salmochelin. They are associated with invasive disease and are common amongst hypervirulent K. pneumoniae clones that cause severe community-associated infections such as liver abscesses and pneumonia. These siderophores were considered as the primary virulence determinant among iron acquisition systems in hypervirulent K. pneumoniae species [37], representing key genes for high virulence scores [38]. The other iron uptake system, kfu, is associated with invasive infections, capsule formation, and hypermucoviscosity [33]. Our CZA-resistant strain also presented a hypermucoviscosity (HMV) phenotype and genes coding for biofilm production, which are two key factors for colonization and persistence in the host. Notably, infection with biofilm-producing KPC-Kp strains was an independent predictor of mortality [39]. Worryingly, our strain revealed the presence of the type 3 fimbriae mrkA–mrkJ cluster, including the type 3 fimbriae-related coding genes (mrkA and mrkD) and regulation gene (mrkH). The biofilm formation capacity of strains that carried the mrkH cassette was previously reported as significantly higher than other strains considering that the expression of mrkA in K. pneumoniae carrying the mrkH gene was significantly upregulated [40]. Indeed, the assessment of biofilm production may provide a key element in supporting the clinical management of high-risk patients with KPC-Kp infection [39] and a relevant emerging problem [39,40,41].
Additionally, the CZA-resistant strain reported herein produced a capsular type K3 (considered the usual cause of rhinoscleroma) [42], not previously associated with hvKp, since it is not amongst the most common capsule loci associated with hvKp—K1, K2, K5, and K57 [36]. Nevertheless, the string test confirmed the hypermucoviscosity phenotype of our strain; the PCR and WGS analyses were negative for magA gene (considered to be restricted to K1 strains) [36], as well as for rmpA and rmpA2. However, given that our strain was isolated from an ascitic fluid, the number of virulence factors found (including relevant siderophores as aerobactin and yersiniabactin), associated with resistance to last-line antibiotic ceftazidime/avibactam, it can be characterized as an hvKp strain. However, this is still a controversial concept. In the literature, hypermucoviscous and hypervirulent are often used synonymously, but studies found that the string test performed could be a predictor of hypervirulent strains, and that most hypermucoviscosity phenotypes likely contribute to the majority of hvKp strains [36]. The emergence of hvKp strains is a great cause for concern, as they successfully escape immune system mechanisms due to their high number of virulence factors. Because genes that encode for virulence or antibiotic resistance are often on mobile genetic elements such as plasmids, transposons, and ICE, it is not surprising that we are observing a convergence of virulence and antibiotic resistance. Despite this fact, the interplay between antimicrobial resistance and virulence still remains poorly understood worldwide, particularly in the convergence of hvKp and CZA-resistant strains.
Interestingly, it has been described that, during CZA administration, the MIC of meropenem (MEM) can decrease and some KPC-producing K. pneumoniae strains can result in CZA-resistant and MEM-susceptible strains [43,44]. Indeed, our CZA-resistant strain is MEM-susceptible considering the EUCAST category. However, this information should be interpreted with caution by the clinicians. Previous studies confirmed the difficulty of treating infections caused by KPC-Kp, which, under CZA-treatment, can rapidly evolve from CZA-susceptible to CZA-resistant via the emergence of KPC-3 variants. These KPC-3 variant-producing strains can be treated with MEM, but the colonization persistence of MEM-resistant KPC-3 producers can lead to treatment failure [19] with high mortality rates [18]. In fact, the role of carbapenems in treating such infections remains uncertain, because meropenem resistance is readily selected during passage experiments [43].
Ceftazidime/avibactam has definitely become an important first-line option due the limited therapeutic options available for KPC-Kp infections, which was recently recognized by Infectious Diseases Society of America (IDSA) guidelines that indicate CZA, meropenem/vaborbactam, and imipenem/cilastatin/relebactam as the preferred agents for KPC-Kp infections outside of the urinary tract [11]. Previous existing options, such as polymyxins, aminoglycosides, tigecycline, and carbapenems, were of limited use due to inferior efficacy, resistance rates, suboptimal doses, and high toxicity [45]. Therefore, it is imperative to encourage CZA use from an antimicrobial stewardship perspective in order to retain the activity against KPC-Kp strains. However, the data currently available highlight that an optimal therapeutic regimen for CZA or for patients infected by CZA-resistant strains remains lacking [18]. In Italy, a case of a 68 year old man with recurrent bacteremia caused by a KPC-Kp strain resistant to ceftazidime/avibactam and cefiderocol was reported. A KPC-3 variant enzyme (D179Y; KPC-31) was identified, which confers resistance to ceftazidime/avibactam and restores meropenem susceptibility. The patient that was successfully treated with meropenem/vaborbactam [46], which previously demonstrated potential to be an effective option as salvage therapy for ceftazidime/avibactam-resistant KPC-producing K. pneumoniae infections [47].

4. Materials and Methods

4.1. Bacterial Strain

The strain was recovered using standard clinical operating procedures. The identification was performed by microbiology laboratories using conventional methods or automated systems such as Vitek2® (BioMérieux, Marcy, l’Étoile, France) or MicroScan (Snap-on, Kenosha, WI, USA). The strain was frozen in brain heart infusion (BHI) broth (VWR Prolabo, Lisboa, Portugal) with 15% glycerol at −80 °C. For analysis, the strain was grown using BHI broth (18 h, 37 °C) and later seeded in Mueller–Hinton agar (VWR Prolabo, Lisboa, Portugal).

4.2. Antimicrobial Susceptibility Testing and Hypermucoviscosity Phenotype

Antimicrobial susceptibility testing was performed using the standardized Kirby– Bauer disc diffusion technique, in accordance with the European Committee on Antimicrobial Susceptibility Testing (EUCAST). The detailed methodology is available at http://www.eucast.org/ast_of_bacteria/disk_diffusion_methodology/ (accessed on 17 December 2021). Detailed instructions for Mueller–Hinton agar medium (VWR Prolabo®, Lisboa, Portugal), including preparation and storage, are also available in the same EUCAST guidelines document. Quality control was carried out in accordance with EUCAST (version 11.0, 2021). Susceptibility was tested by a panel of antibiotics: amoxicillin/clavulanic acid (20/10 µg), cefoxitin (30 µg), cefotaxime (5 µg), ceftazidime (10 µg), imipenem (10 µg), gentamicin (10 µg), ciprofloxacin (5 µg), tigecycline (15 µg), aztreonam (30 µg), ertapenem (10 µg), doripenem (10 µg), meropenem (10 µg), and ceftazidime/avibactam (10/4 µg) (Biorad, Portugal). The strains were categorized as susceptible to standard dosing regimen (S), susceptible to increased exposure (I), and resistant (R) by applying the breakpoints in the phenotypic test results. A complementary Etest® (BioMérieux, Marcy l’ Étoile, France) for ceftazidime/avibactam was also performed. The inhibition zones and MIC values were interpreted according to the EUCAST breakpoints (version 11.0, 2021) (available at https://eucast.org/clinical_breakpoints/ (accessed on 17 December 2021)).
The hypermucoviscosity phenotype is a known virulent factor which was determined using a simple method, the string test. A positive string test is defined as the formation of viscous strings of >5 mm in length when a loop is used to stretch the colony on an agar plate. Multidrug-resistant (MDR) bacteria were defined as those that acquired nonsusceptibility to at least one agent in three or more antimicrobial categories, in accordance with the United States Center for Disease Control and Prevention (CDC) and the European Center for Disease Prevention and Control (ECDC) consensual definition [48].

4.3. Resistance and Virulence Determinants

PCR-based screening was performed to identify carbapenemase genes with primers designed for blaOXA-48 (F: 5′–GGCTGTGTTTTTGGTGGCATC–3′; R: 5′–GCAGCCCTAAACCATCCGATG–3′), blaKPC [49], blaVIM [50], blaNDM [51], and blaGES [52]. The virulence factors were also assessed by PCR with specific primers for the fimbrial adhesins type 1 (fimH) [53], hemolysin (khe), iron uptake system (kfu) [54], siderophore (enterobactin, entB), and the hypermucoviscosity phenotype (magA) [55].

4.4. Molecular Methods

Polymerase chain reaction (PCR) was performed using the NZYTaq II 2× Green Master Mix (NZYTech, Lisboa, Portugal) following the manufacturer’s instructions. The PCR products were resolved in 1% agarose gel in 10× concentrated Tris–borate–EDTA (TBE buffer) (NZYTech, Lisboa, Portugal). Positive and negative controls were included in all PCR assays. The positive controls were used with strains containing the respective genes and previously sequenced. The purification of PCR amplification products was performed using the ExoCleanUp FAST (VWR Prolabo®, Lisboa, Portugal) kit, and they were sequenced at STABVida Portugal. Searches for nucleotide sequences were performed with the BLAST program, which is available at the National Center for Biotechnology Information website (http://www.ncbi.nim.nih.gov/ accessed on 17 December 2021). Multiple-sequence alignments were performed with the Clustal Omega program, which is available at https://cge.cbs.dtu.dk/services (accessed on 17 December 2021).

4.5. Multilocus Sequence Typing (MLST)

MLST was performed by analyses of internal fragments of seven housekeeping genes (gapA, infB, mdh, pgi, phoE, rpoB, and tonB), as previously described [56]; the sequencing was performed at STABVida Portugal and submitted to the MLST database for allele attribution. The K. pneumoniae database is available at the Pasteur MLST website (http://www.pasteur.fr/mlst/ (accessed on 17 December 2021)).

4.6. Whole-Genome Sequencing

The genomic DNA of the clinical strain was extracted from cultures grown overnight, in Mueller–Hinton agar, using the NZY Tissue gDNA Isolation kit (NZYTech, Lisboa, Portugal), as per the manufacturer’s recommendations. The sequencing was performed at STABVida Portugal. Sequencing libraries were prepared using the KAPA HyperPrep Library Preparation Kit (Roche, Switzerland) following the manufacturer’s recommended protocol and sequenced using an Illumina HiSeq Novaseq 6000 platform with paired-end reads (2 × 151 bp). The raw data quality control was performed using FASTQC v0.11.9, and the trimming and de novo assembly were performed using CLC Genomics Workbench 12.0.3 (QIAGEN, Aarhus, Denmark). All assemblies were carried out with automatic word size, a similarity fraction of 0.95, a length fraction of 0.95, and a minimum contig size of 500 bp.

4.7. Drug Resistance-Associated Genes, Virulence Genes, Capsular Types, and Plasmid Replicons

Antimicrobial resistance (AMR) K and O antigen loci were identified using Kleborate (https://github.com/katholt/Kleborate (accessed on 17 December 2021)), a K. pneumoniae-specific genomic typing tool, and virulence factors using the virulence factor database VFDB (http://www.mgc.ac.cn/VFs/ accessed on 17 December 2021). Plasmid analyses were identified using the PlasmidFinder database with the following cutoff values: minimum of 60% coverage and 95% identity (https://cge.cbs.dtu.dk/services/PlasmidFinder/ (accessed on 17 December 2021)).

4.8. Accession Number

The sequence was submitted in the NCBI database under the GenBank accession number MZ893465.

5. Conclusions

Herein, we reported a hypervirulent multidrug-resistant ST13 K. pneumoniae strain producing KPC-70, a KPC-3 variant conferring resistance to ceftazidime/avibactam combination. To the best of our knowledge, this is the first report of a CZA-resistant strain in Portugal and the second KPC-70 variant description worldwide. The application of genomic characterization and molecular surveillance promotes the understanding of K. pneumoniae population structure, AMR, pathogenicity, and transmission in clinical environments and should be widely encouraged. Further studies are needed to elucidate the molecular features involved in CZA resistance development and spread.

Author Contributions

Conceptualization, C.C.; data curation, G.M. and C.C.; formal analysis, G.M., J.F.R., A.D. and C.C.; investigation, G.M., J.F.R., A.D. and C.C.; methodology, C.C.; project administration, C.C.; resources, A.B.-F., L.L. and J.M.-C.; software, G.M. and J.F.R.; supervision, C.C.; writing—original draft, G.M.; writing—review and editing, J.F.R., A.B.-F., L.L., A.D., J.M.-C. and C.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially funded by the Fundação para a Ciência e a Tecnologia (FCT), grant number UIDB/04295/2020 and UIDP/04295/2020. Gabriel Mendes (G.M.) is supported by the Fundação para a Ciência e Tecnologia (FCT), Portugal, through a PhD Research Studentship Contract (Contrato de Bolsa de Investigação para Doutoramento 2020.07736.BD). Cátia Caneiras (C.C.) acknowledges the funding provided by the “Research Award in Healthcare Associated Infections” granted by the Escola Superior de Saúde Norte da Cruz Vermelha Portuguesa (2019) and by the “BInov award”, an innovation award granted by Southern Regional and Autonomous Regions Section of the Portuguese Pharmaceutical Society (2021).

Institutional Review Board Statement

The strains were obtained as part of routine diagnostic testing and were analyzed anonymously. The study proposal was analyzed and dismissed from evaluation by the Ethics Committee of the Lisboa Academic Medical Centre of the Faculty of Medicine, University of Lisboa, Portugal (Nr. 248/21).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

J.M.C. received research grants administered through his university and honoraria for serving on the speaker’s bureaus of Pfizer and MSD, not related to the present study. The other authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Wyres, K.L.; Lam, M.M.C.; Holt, K.E. Population genomics of Klebsiella pneumoniae. Nat. Rev. Microbiol. 2020, 18, 344–359. [Google Scholar] [CrossRef] [PubMed]
  2. ECDC. Country Summaries EARS-Net 2019. EARSS Report. 2019. Available online: https://www.ecdc.europa.eu/en/publications-data/surveillance-antimicrobial-resistance-europe-2019 (accessed on 13 December 2021).
  3. Caneiras, C.; Lito, L.; Mayoralas-Alises, S.; Diaz-Lobato, S.; Melo-Cristino, J.; Duarte, A. Virulence and resistance determinants of Klebsiella pneumoniae isolated from a Portuguese tertiary university hospital centre over a 31-year period. Enfermedades Infecciosas y Microbiología Clínica 2019, 37, 387–393. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Cassini, A.; Hogberg, L.D.; Plachouras, D.; Quattrocchi, A.; Hoxha, A.; Simonsen, G.S.; Colomb-Cotinat, M.; Kretzschmar, M.E.; Devleesschauwer, B.; Cecchini, M.; et al. Attributable deaths and disability-adjusted life-years caused by infections with antibiotic-resistant bacteria in the EU and the European Economic Area in 2015: A population-level modelling analysis. Lancet Infect. Dis. 2019, 19, 56–66. [Google Scholar] [CrossRef] [Green Version]
  5. Brolund, A.; Lagerqvist, N.; Byfors, S.; Struelens, M.J.; Monnet, D.L.; Albiger, B.; Kohlenberg, A.; European Antimicrobial Resistance Genes Surveillance Network (EURGen-Net) Capacity Survey Group. Worsening epidemiological situation of carbapenemase-producing Enterobacteriaceae in Europe, assessment by national experts from 37 countries, July 2018. Eurosurveillance 2019, 24, 1900123. [Google Scholar] [CrossRef]
  6. Shirley, M. Ceftazidime-Avibactam: A Review in the Treatment of Serious Gram-Negative Bacterial Infections. Drugs 2018, 78, 675–692. [Google Scholar] [CrossRef] [PubMed]
  7. EML Secretariat on behalf of the EML Antibiotic Working Group. Application for Inclusion of Ceftazidime—Avibactam (J01DD52) as a Reserve Antibiotic on the WHO Model List of Essential Medicines (EML) and Model List of Essential Medicines for Children (EMLc). Available online: https://www.who.int/selection_medicines/committees/expert/22/applications/s6.2_new-antibiotics-AWaRe.pdf?ua=1 (accessed on 26 December 2021).
  8. King, M.; Heil, E.; Kuriakose, S.; Bias, T.; Huang, V.; El-Beyrouty, C.; McCoy, D.; Hiles, J.; Richards, L.; Gardner, J.; et al. Multicenter Study of Outcomes with Ceftazidime-Avibactam in Patients with Carbapenem-Resistant Enterobacteriaceae Infections. Antimicrob. Agents Chemother. 2017, 61, e00449-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Shields, R.K.; Nguyen, M.H.; Chen, L.; Press, E.G.; Potoski, B.A.; Marini, R.V.; Doi, Y.; Kreiswirth, B.N.; Clancy, C.J. Ceftazidime-Avibactam is Superior to Other Treatment Regimens against Carbapenem-Resistant Klebsiella pneumoniae Bacteremia. Antimicrob. Agents Chemother. 2017, 61, e00883-17. [Google Scholar] [CrossRef] [Green Version]
  10. Tumbarello, M.; Trecarichi, E.M.; Corona, A.; De Rosa, F.G.; Bassetti, M.; Mussini, C.; Menichetti, F.; Viscoli, C.; Campoli, C.; Venditti, M.; et al. Efficacy of Ceftazidime-Avibactam Salvage Therapy in Patients with Infections Caused by Klebsiella pneumoniae Carbapenemase-producing K. pneumoniae. Clin. Infect. Dis. 2019, 68, 355–364. [Google Scholar] [CrossRef] [Green Version]
  11. Tamma, P.D.; Aitken, S.L.; Bonomo, R.A.; Mathers, A.J.; van Duin, D.; Clancy, C.J. Infectious Diseases Society of America Guidance on the Treatment of Extended-Spectrum beta-lactamase Producing Enterobacterales (ESBL-E), Carbapenem-Resistant Enterobacterales (CRE), and Pseudomonas aeruginosa with Difficult-to-Treat Resistance (DTR-P. aeruginosa). Clin. Infect. Dis. 2021, 72, 1109–1116. [Google Scholar] [CrossRef]
  12. Carattoli, A.; Arcari, G.; Bibbolino, G.; Sacco, F.; Tomolillo, D.; Di Lella, F.M.; Trancassini, M.; Faino, L.; Venditti, M.; Antonelli, G.; et al. Evolutionary Trajectories toward Ceftazidime-Avibactam Resistance in Klebsiella pneumoniae Clinical Isolates. Antimicrob. Agents Chemother. 2021, 65, e0057421. [Google Scholar] [CrossRef]
  13. Gaibani, P.; Re, M.C.; Campoli, C.; Viale, P.L.; Ambretti, S. Bloodstream infection caused by KPC-producing Klebsiella pneumoniae resistant to ceftazidime/avibactam: Epidemiology and genomic characterization. Clin. Microbiol. Infect. 2020, 26, 516.e1–516.e4. [Google Scholar] [CrossRef] [PubMed]
  14. Gottig, S.; Frank, D.; Mungo, E.; Nolte, A.; Hogardt, M.; Besier, S.; Wichelhaus, T.A. Emergence of ceftazidime/avibactam resistance in KPC-3-producing Klebsiella pneumoniae in vivo. J. Antimicrob. Chemother. 2019, 74, 3211–3216. [Google Scholar] [CrossRef] [PubMed]
  15. Mueller, L.; Masseron, A.; Prod’Hom, G.; Galperine, T.; Greub, G.; Poirel, L.; Nordmann, P. Phenotypic, biochemical and genetic analysis of KPC-41, a KPC-3 variant conferring resistance to ceftazidime-avibactam and exhibiting reduced carbapenemase activity. Antimicrob. Agents Chemother. 2019, 63, e01111-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Shields, R.K.; Chen, L.; Cheng, S.; Chavda, K.D.; Press, E.G.; Snyder, A.; Pandey, R.; Doi, Y.; Kreiswirth, B.N.; Nguyen, M.H.; et al. Emergence of Ceftazidime-Avibactam Resistance Due to Plasmid-Borne blaKPC-3 Mutations during Treatment of Carbapenem-Resistant Klebsiella pneumoniae Infections. Antimicrob. Agents Chemother. 2017, 61, e02097-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Zhang, P.; Shi, Q.; Hu, H.; Hong, B.; Wu, X.; Du, X.; Akova, M.; Yu, Y. Emergence of ceftazidime/avibactam resistance in carbapenem-resistant Klebsiella pneumoniae in China. Clin. Microbiol. Infect. 2020, 26, 124.e1–124.e4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Di Bella, S.; Giacobbe, D.R.; Maraolo, A.E.; Viaggi, V.; Luzzati, R.; Bassetti, M.; Luzzaro, F.; Principe, L. Resistance to ceftazidime/avibactam in infections and colonisations by KPC-producing Enterobacterales: A systematic review of observational clinical studies. J. Glob. Antimicrob. Resist. 2021, 25, 268–281. [Google Scholar] [CrossRef]
  19. Arcari, G.O.A.; Sacco, F.; Di Lella, F.M.; Raponi, G.; Tomolillo, D.; Curtolo, A.; Venditti, M.; Carattoli, A. Interplay between Klebsiella pneumoniae producing KPC-31 and KPC-3 under treatment with high dosage meropenem: A case report. Eur. J. Clin. Microbiol. Infect. Dis. 2021. [Google Scholar] [CrossRef]
  20. Cuzon, G.; Naas, T.; Nordmann, P. Functional characterization of Tn4401, a Tn3-based transposon involved in blaKPC gene mobilization. Antimicrob. Agents Chemother. 2011, 55, 5370–5373. [Google Scholar] [CrossRef] [Green Version]
  21. Giddins, M.J.; Macesic, N.; Annavajhala, M.K.; Stump, S.; Khan, S.; McConville, T.H.; Mehta, M.; Gomez-Simmonds, A.; Uhlemann, A.C. Successive Emergence of Ceftazidime-Avibactam Resistance through Distinct Genomic Adaptations in blaKPC-2-Harboring Klebsiella pneumoniae Sequence Type 307 Isolates. Antimicrob. Agents Chemother. 2018, 62, e02101-17. [Google Scholar] [CrossRef] [Green Version]
  22. Gaibani, P.; Campoli, C.; Lewis, R.E.; Volpe, S.L.; Scaltriti, E.; Giannella, M.; Pongolini, S.; Berlingeri, A.; Cristini, F.; Bartoletti, M.; et al. In vivo evolution of resistant subpopulations of KPC-producing Klebsiella pneumoniae during ceftazidime/avibactam treatment. J. Antimicrob. Chemother. 2018, 73, 1525–1529. [Google Scholar] [CrossRef] [Green Version]
  23. Shields, R.K.; Nguyen, M.H.; Press, E.G.; Chen, L.; Kreiswirth, B.N.; Clancy, C.J. In Vitro Selection of Meropenem Resistance among Ceftazidime-Avibactam-Resistant, Meropenem-Susceptible Klebsiella pneumoniae Isolates with Variant KPC-3 Carbapenemases. Antimicrob. Agents Chemother. 2017, 61, e00079-17. [Google Scholar] [CrossRef] [Green Version]
  24. Wang, Y.; Wang, J.; Wang, R.; Cai, Y. Resistance to ceftazidime-avibactam and underlying mechanisms. J. Glob. Antimicrob. Resist. 2020, 22, 18–27. [Google Scholar] [CrossRef] [PubMed]
  25. Aires-de-Sousa, M.; Ortiz de la Rosa, J.M.; Goncalves, M.L.; Pereira, A.L.; Nordmann, P.; Poirel, L. Epidemiology of Carbapenemase-Producing Klebsiella pneumoniae in a Hospital, Portugal. Emerg Infect. Dis 2019, 25, 1632–1638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Perdigao, J.; Caneiras, C.; Elias, R.; Modesto, A.; Spadar, A.; Phelan, J.; Campino, S.; Clark, T.G.; Costa, E.; Saavedra, M.J.; et al. Genomic Epidemiology of Carbapenemase Producing Klebsiella pneumoniae Strains at a Northern Portuguese Hospital Enables the Detection of a Misidentified Klebsiella variicola KPC-3 Producing Strain. Microorganisms 2020, 8, 1986. [Google Scholar] [CrossRef] [PubMed]
  27. Fursova, N.K.; Astashkin, E.I.; Gabrielyan, N.I.; Novikova, T.S.; Fedyukina, G.N.; Kubanova, M.K.; Esenova, N.M.; Sharapchenko, S.O.; Volozhantsev, N.V. Emergence of Five Genetic Lines ST395(NDM-1), ST13(OXA-48), ST3346(OXA-48), ST39(CTX-M-14), and Novel ST3551(OXA-48) of Multidrug-Resistant Clinical Klebsiella pneumoniae in Russia. Microb. Drug Resist. 2020, 26, 924–933. [Google Scholar] [CrossRef]
  28. Osterblad, M.; Kirveskari, J.; Hakanen, A.J.; Tissari, P.; Vaara, M.; Jalava, J. Carbapenemase-producing Enterobacteriaceae in Finland: The first years (2008–2011). J. Antimicrob. Chemother. 2012, 67, 2860–2864. [Google Scholar] [CrossRef] [Green Version]
  29. Wrenn, C.; O’Brien, D.; Keating, D.; Roche, C.; Rose, L.; Ronayne, A.; Fenelon, L.; Fitzgerald, S.; Crowley, B.; Schaffer, K. Investigation of the first outbreak of OXA-48-producing Klebsiella pneumoniae in Ireland. J. Hosp. Infect. 2014, 87, 41–46. [Google Scholar] [CrossRef]
  30. Cejas, D.; Elena, A.; Guevara Nunez, D.; Sevillano Platero, P.; De Paulis, A.; Magarinos, F.; Alfonso, C.; Berger, M.A.; Fernandez-Canigia, L.; Gutkind, G.; et al. Changing epidemiology of KPC-producing Klebsiella pneumoniae in Argentina: Emergence of hypermucoviscous ST25 and high-risk clone ST307. J. Glob. Antimicrob. Resist. 2019, 18, 238–242. [Google Scholar] [CrossRef]
  31. Rodrigues, A.C.S.; Chang, M.R.; Santos, I.C.O.; Carvalho-Assef, A.P.D. Molecular Epidemiology of blaKPC-Encoding Klebsiella pneumoniae Isolated from Public Hospitals in Midwest of Brazil. Microb. Drug Resist. 2021, 28, 1–6. [Google Scholar] [CrossRef]
  32. Vargas, J.M.; Moreno Mochi, M.P.; Lopez, C.G.; Alarcon, J.A.; Acosta, N.; Soria, K.; Nunez, J.M.; Villafane, S.; Ramacciotti, J.; Del Campo, R.; et al. Impact of an active surveillance program and infection control measures on the incidence of carbapenem-resistant Gram-negative bacilli in an intensive care unit. Revista Argentina de Microbiologia 2021. [Google Scholar] [CrossRef]
  33. Paczosa, M.K.; Mecsas, J. Klebsiella pneumoniae: Going on the Offense with a Strong Defense. Microbiol. Mol. Biol. Rev. 2016, 80, 629–661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Holden, V.I.; Bachman, M.A. Diverging roles of bacterial siderophores during infection. Metallomics 2015, 7, 986–995. [Google Scholar] [CrossRef] [PubMed]
  35. Vizcaino, M.I.; Crawford, J.M. The colibactin warhead crosslinks DNA. Nat. Chem. 2015, 7, 411–417. [Google Scholar] [CrossRef] [PubMed]
  36. Choby, J.E.; Howard-Anderson, J.; Weiss, D.S. Hypervirulent Klebsiella pneumoniae—Clinical and molecular perspectives. J. Intern. Med. 2020, 287, 283–300. [Google Scholar] [CrossRef] [Green Version]
  37. Russo, T.A.; Marr, C.M. Hypervirulent Klebsiella pneumoniae. Clin. Microbiol. Rev. 2019, 32, e00001-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Lam, M.M.C.; Wick, R.R.; Watts, S.C.; Cerdeira, L.T.; Wyres, K.L.; Holt, K.E. A genomic surveillance framework and genotyping tool for Klebsiella pneumoniae and its related species complex. Nat. Commun. 2021, 12, 4188. [Google Scholar] [CrossRef] [PubMed]
  39. Di Domenico, E.G.; Cavallo, I.; Sivori, F.; Marchesi, F.; Prignano, G.; Pimpinelli, F.; Sperduti, I.; Pelagalli, L.; Di Salvo, F.; Celesti, I.; et al. Biofilm Production by Carbapenem-Resistant Klebsiella pneumoniae Significantly Increases the Risk of Death in Oncological Patients. Front. Cell Infect. Microbiol. 2020, 10, 561741. [Google Scholar] [CrossRef]
  40. Fang, R.; Liu, H.; Zhang, X.; Dong, G.; Li, J.; Tian, X.; Wu, Z.; Zhou, J.; Cao, J.; Zhou, T. Difference in biofilm formation between carbapenem-resistant and carbapenem-sensitive Klebsiella pneumoniae based on analysis of mrkH distribution. Microb. Pathog. 2021, 152, 104743. [Google Scholar] [CrossRef]
  41. Chung, P.Y. The emerging problems of Klebsiella pneumoniae infections: Carbapenem resistance and biofilm formation. FEMS Microbiol. Lett. 2016, 363, fnw219. [Google Scholar] [CrossRef] [Green Version]
  42. Fevre, C.; Passet, V.; Deletoile, A.; Barbe, V.; Frangeul, L.; Almeida, A.S.; Sansonetti, P.; Tournebize, R.; Brisse, S. PCR-based identification of Klebsiella pneumoniae subsp. rhinoscleromatis, the agent of rhinoscleroma. PLoS Negl. Trop. Dis. 2011, 5, e1052. [Google Scholar] [CrossRef]
  43. Shields, R.K.; Nguyen, M.H.; Press, E.G.; Chen, L.; Kreiswirth, B.N.; Clancy, C.J. Emergence of Ceftazidime-Avibactam Resistance and Restoration of Carbapenem Susceptibility in Klebsiella pneumoniae Carbapenemase-Producing K pneumoniae: A Case Report and Review of Literature. Open Forum Infect. Dis. 2017, 4, ofx101. [Google Scholar] [CrossRef] [PubMed]
  44. Haidar, G.C.C.; Shields, R.K.; Hao, B.; Cheng, S.; Nguyen, M.H. Mutations in blaKPC-3 that confer ceftazidime-avibactam resistance encode novel KPC-3 variants that function as extended spectrum β-lactamases. Antimicrob. Agents Chemother. 2017, 61, e02534-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Van Duin, D.; Lok, J.J.; Earley, M.; Cober, E.; Richter, S.S.; Perez, F.; Salata, R.A.; Kalayjian, R.C.; Watkins, R.R.; Doi, Y.; et al. Colistin Versus Ceftazidime-Avibactam in the Treatment of Infections Due to Carbapenem-Resistant Enterobacteriaceae. Clin. Infect. Dis. 2018, 66, 163–171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Tiseo, G.; Falcone, M.; Leonildi, A.; Giordano, C.; Barnini, S.; Arcari, G.; Carattoli, A.; Menichetti, F. Meropenem-Vaborbactam as Salvage Therapy for Ceftazidime-Avibactam-, Cefiderocol-Resistant ST-512 Klebsiella pneumoniae-Producing KPC-31, a D179Y Variant of KPC-3. Open Forum Infect. Dis. 2021, 8, ofab141. [Google Scholar] [CrossRef]
  47. Athans, V.; Neuner, E.A.; Hassouna, H.; Richter, S.S.; Keller, G.; Castanheira, M.; Brizendine, K.D.; Mathers, A.J. Meropenem-Vaborbactam as Salvage Therapy for Ceftazidime-Avibactam-Resistant Klebsiella pneumoniae Bacteremia and Abscess in a Liver Transplant Recipient. Antimicrob. Agents Chemother. 2019, 63, e01551-18. [Google Scholar] [CrossRef] [Green Version]
  48. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Green Version]
  49. Yigit, H.; Queenan, A.M.; Anderson, G.J.; Domenech-Sanchez, A.; Biddle, J.W.; Steward, C.D.; Alberti, S.; Bush, K.; Tenover, F.C. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2001, 45, 1151–1161. [Google Scholar] [CrossRef] [Green Version]
  50. Poirel, L.; Naas, T.; Nicolas, D.; Collet, L.; Bellais, S.; Cavallo, J.D.; Nordmann, P. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-beta-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob. Agents Chemother. 2000, 44, 891–897. [Google Scholar] [CrossRef] [Green Version]
  51. Yong, D.; Toleman, M.A.; Giske, C.G.; Cho, H.S.; Sundman, K.; Lee, K.; Walsh, T.R. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob. Agents Chemother. 2009, 53, 5046–5054. [Google Scholar] [CrossRef] [Green Version]
  52. Poirel, L.; Le Thomas, I.; Naas, T.; Karim, A.; Nordmann, P. Biochemical sequence analyses of GES-1, a novel class A extended-spectrum beta-lactamase, and the class 1 integron In52 from Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2000, 44, 622–632. [Google Scholar] [CrossRef] [Green Version]
  53. Struve, C.; Bojer, M.; Krogfelt, K.A. Identification of a conserved chromosomal region encoding Klebsiella pneumoniae type 1 and type 3 fimbriae and assessment of the role of fimbriae in pathogenicity. Infect. Immun. 2009, 77, 5016–5024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Ku, Y.H.; Chuang, Y.C.; Yu, W.L. Clinical spectrum and molecular characteristics of Klebsiella pneumoniae causing community-acquired extrahepatic abscess. J. Microbiol. Immunol. Infect. 2008, 41, 311–317. [Google Scholar] [PubMed]
  55. Wu, K.M.; Li, L.H.; Yan, J.J.; Tsao, N.; Liao, T.L.; Tsai, H.C.; Fung, C.P.; Chen, H.J.; Liu, Y.M.; Wang, J.T.; et al. Genome sequencing and comparative analysis of Klebsiella pneumoniae NTUH-K2044, a strain causing liver abscess and meningitis. J. Bacteriol. 2009, 191, 4492–4501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Diancourt, L.; Passet, V.; Verhoef, J.; Grimont, P.A.; Brisse, S. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J. Clin. Microbiol. 2005, 43, 4178–4182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Table
Table 1. Antimicrobial susceptibility profile from the ceftazidime/avibactam-resistant K. pneumoniae strain.
Table 1. Antimicrobial susceptibility profile from the ceftazidime/avibactam-resistant K. pneumoniae strain.
Antibiotic TestedAST Dose (μg)AST aMIC (mg/L)
Inhibition Zone (mm)Interpretation
Penicillins:
Amoxicillin/clavulanic acid20/1012R-
Cephalosporins:
Cefoxitin3016R-
Cefotaxime518R-
Ceftazidime106R-
Ceftazidime/avibactam10/46R>256
Carbapenems:
Imipenem1028S-
Ertapenem1018R-
Doripenem1023I-
Meropenem1021I-
Monobactams:
Aztreonam3023I-
Fluoroquinolones:
Ciprofloxacin524I-
Aminoglycosides:
Gentamicin1010R-
Tetracycline:
Tigecycline1522S-
a Following European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. MIC = minimum inhibitory concentration; AST = antimicrobial susceptibility testing; S = susceptible standard dosing regimen; I = susceptible, increased exposure; R = resistant.
Table
Table 2. Molecular characterization of the ceftazidime/avibactam-resistant K. pneumoniae.
Table 2. Molecular characterization of the ceftazidime/avibactam-resistant K. pneumoniae.
IDMLSTbla_Carbbla_Narrow SpectrumAminoglycosidestmpsulQuinolonesfosOmpKwziK_locusO_locusFimbriaeIron UptakeICEKpGenotoxinPlasmid
FMUL94ST13KPC-70TEM-1; SHV-1; OXA-9aac(6′)-Ib; aadA; aph(3″)-Ib; aph(6)-IddfrA14sul2gyrA-87NfosAOmpK35-70%wzi40KL3O1v2fimA-fimK; mrkA-mrkJkfu,
enterobactin(entA–fes), aerobactin(iutA),
salmochelin (iroN–iroE),
yersiniabactin(fyuA–ybtX)		ybt17; ICEKp10colibactin
(clb-c,2-i,l-q)		ColRNAI; IncFIA (pBK30683); IncFII (pBK30683)
bla: β-lactamase; tmp: trimetoprim; sul: sulfanamides; fos: fosfomycin.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Mendes, G.; Ramalho, J.F.; Bruschy-Fonseca, A.; Lito, L.; Duarte, A.; Melo-Cristino, J.; Caneiras, C. First Description of Ceftazidime/Avibactam Resistance in a ST13 KPC-70-Producing Klebsiella pneumoniae Strain from Portugal. Antibiotics 2022, 11, 167. https://doi.org/10.3390/antibiotics11020167

AMA Style

Mendes G, Ramalho JF, Bruschy-Fonseca A, Lito L, Duarte A, Melo-Cristino J, Caneiras C. First Description of Ceftazidime/Avibactam Resistance in a ST13 KPC-70-Producing Klebsiella pneumoniae Strain from Portugal. Antibiotics. 2022; 11(2):167. https://doi.org/10.3390/antibiotics11020167

Chicago/Turabian Style

Mendes, Gabriel, João F. Ramalho, Ana Bruschy-Fonseca, Luís Lito, Aida Duarte, José Melo-Cristino, and Cátia Caneiras. 2022. "First Description of Ceftazidime/Avibactam Resistance in a ST13 KPC-70-Producing Klebsiella pneumoniae Strain from Portugal" Antibiotics 11, no. 2: 167. https://doi.org/10.3390/antibiotics11020167

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop